ID: 992861543

View in Genome Browser
Species Human (GRCh38)
Location 5:80916015-80916037
Sequence CTTTTAAAGCTGAAAGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992861543_992861545 -4 Left 992861543 5:80916015-80916037 CCCATCACTTTCAGCTTTAAAAG No data
Right 992861545 5:80916034-80916056 AAAGCCATAATAGAAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992861543 Original CRISPR CTTTTAAAGCTGAAAGTGAT GGG (reversed) Intergenic
No off target data available for this crispr