ID: 992861545

View in Genome Browser
Species Human (GRCh38)
Location 5:80916034-80916056
Sequence AAAGCCATAATAGAAGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992861542_992861545 2 Left 992861542 5:80916009-80916031 CCTCTTCCCATCACTTTCAGCTT No data
Right 992861545 5:80916034-80916056 AAAGCCATAATAGAAGAATGTGG No data
992861541_992861545 12 Left 992861541 5:80915999-80916021 CCTTTTTTGTCCTCTTCCCATCA No data
Right 992861545 5:80916034-80916056 AAAGCCATAATAGAAGAATGTGG No data
992861543_992861545 -4 Left 992861543 5:80916015-80916037 CCCATCACTTTCAGCTTTAAAAG No data
Right 992861545 5:80916034-80916056 AAAGCCATAATAGAAGAATGTGG No data
992861544_992861545 -5 Left 992861544 5:80916016-80916038 CCATCACTTTCAGCTTTAAAAGC No data
Right 992861545 5:80916034-80916056 AAAGCCATAATAGAAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992861545 Original CRISPR AAAGCCATAATAGAAGAATG TGG Intergenic
No off target data available for this crispr