ID: 992862810

View in Genome Browser
Species Human (GRCh38)
Location 5:80929317-80929339
Sequence ACCACTGAGGCCTGGACCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992862810_992862818 25 Left 992862810 5:80929317-80929339 CCAATGGTCCAGGCCTCAGTGGT No data
Right 992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG No data
992862810_992862817 18 Left 992862810 5:80929317-80929339 CCAATGGTCCAGGCCTCAGTGGT No data
Right 992862817 5:80929358-80929380 GGCTTAGAATGTGCCACAGATGG No data
992862810_992862814 -8 Left 992862810 5:80929317-80929339 CCAATGGTCCAGGCCTCAGTGGT No data
Right 992862814 5:80929332-80929354 TCAGTGGTCAATGGCTCTTTAGG No data
992862810_992862815 -4 Left 992862810 5:80929317-80929339 CCAATGGTCCAGGCCTCAGTGGT No data
Right 992862815 5:80929336-80929358 TGGTCAATGGCTCTTTAGGATGG No data
992862810_992862816 -3 Left 992862810 5:80929317-80929339 CCAATGGTCCAGGCCTCAGTGGT No data
Right 992862816 5:80929337-80929359 GGTCAATGGCTCTTTAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992862810 Original CRISPR ACCACTGAGGCCTGGACCAT TGG (reversed) Intergenic
No off target data available for this crispr