ID: 992862812

View in Genome Browser
Species Human (GRCh38)
Location 5:80929325-80929347
Sequence AGCCATTGACCACTGAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992862812_992862817 10 Left 992862812 5:80929325-80929347 CCAGGCCTCAGTGGTCAATGGCT No data
Right 992862817 5:80929358-80929380 GGCTTAGAATGTGCCACAGATGG No data
992862812_992862820 28 Left 992862812 5:80929325-80929347 CCAGGCCTCAGTGGTCAATGGCT No data
Right 992862820 5:80929376-80929398 GATGGAGCTAGGTGTAACCCAGG No data
992862812_992862818 17 Left 992862812 5:80929325-80929347 CCAGGCCTCAGTGGTCAATGGCT No data
Right 992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992862812 Original CRISPR AGCCATTGACCACTGAGGCC TGG (reversed) Intergenic
No off target data available for this crispr