ID: 992862818

View in Genome Browser
Species Human (GRCh38)
Location 5:80929365-80929387
Sequence AATGTGCCACAGATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992862810_992862818 25 Left 992862810 5:80929317-80929339 CCAATGGTCCAGGCCTCAGTGGT No data
Right 992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG No data
992862813_992862818 12 Left 992862813 5:80929330-80929352 CCTCAGTGGTCAATGGCTCTTTA No data
Right 992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG No data
992862812_992862818 17 Left 992862812 5:80929325-80929347 CCAGGCCTCAGTGGTCAATGGCT No data
Right 992862818 5:80929365-80929387 AATGTGCCACAGATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992862818 Original CRISPR AATGTGCCACAGATGGAGCT AGG Intergenic
No off target data available for this crispr