ID: 992864981

View in Genome Browser
Species Human (GRCh38)
Location 5:80949157-80949179
Sequence ATAACATATTTGTACAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992864977_992864981 29 Left 992864977 5:80949105-80949127 CCACTACTCCAAATGCGTGAAAT No data
Right 992864981 5:80949157-80949179 ATAACATATTTGTACAAATATGG No data
992864978_992864981 21 Left 992864978 5:80949113-80949135 CCAAATGCGTGAAATGCAGAGAA No data
Right 992864981 5:80949157-80949179 ATAACATATTTGTACAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992864981 Original CRISPR ATAACATATTTGTACAAATA TGG Intergenic
No off target data available for this crispr