ID: 992867754

View in Genome Browser
Species Human (GRCh38)
Location 5:80974671-80974693
Sequence CAGATCAAGAACTCACAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992867754_992867758 7 Left 992867754 5:80974671-80974693 CCACCTTGTGAGTTCTTGATCTG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 992867758 5:80974701-80974723 CTATCTTCAGATGGGAATTTAGG 0: 1
1: 0
2: 0
3: 15
4: 216
992867754_992867757 -1 Left 992867754 5:80974671-80974693 CCACCTTGTGAGTTCTTGATCTG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 992867757 5:80974693-80974715 GACTTCATCTATCTTCAGATGGG 0: 1
1: 0
2: 0
3: 6
4: 101
992867754_992867756 -2 Left 992867754 5:80974671-80974693 CCACCTTGTGAGTTCTTGATCTG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 992867756 5:80974692-80974714 TGACTTCATCTATCTTCAGATGG 0: 1
1: 0
2: 0
3: 17
4: 193
992867754_992867759 11 Left 992867754 5:80974671-80974693 CCACCTTGTGAGTTCTTGATCTG 0: 1
1: 0
2: 2
3: 15
4: 205
Right 992867759 5:80974705-80974727 CTTCAGATGGGAATTTAGGCCGG 0: 1
1: 0
2: 1
3: 21
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992867754 Original CRISPR CAGATCAAGAACTCACAAGG TGG (reversed) Intronic
900613993 1:3556172-3556194 CAGAGCATGGACTCACAGGGTGG - Intronic
904794640 1:33050228-33050250 CAGATCAACAGATCACAAGAAGG - Intronic
904955515 1:34280308-34280330 GAGACCCAGAACTCAGAAGGGGG - Intergenic
905234581 1:36537056-36537078 CAAAGCAAGAAGTCAGAAGGAGG - Intergenic
905679511 1:39858039-39858061 CAGATCAAGAGCTCACAGACAGG - Intronic
906717400 1:47980303-47980325 CAAACCAGGTACTCACAAGGAGG + Intronic
907041098 1:51260691-51260713 CAGATGAAGAACTGACAATGAGG - Intronic
911654785 1:100431193-100431215 CCCATTAAGAACTCACATGGAGG + Intronic
912437161 1:109669657-109669679 AAGACCAAGAACTCACCAGAAGG - Intronic
912573316 1:110640846-110640868 CAGATCACAAACTCACGAGTTGG + Intergenic
916463760 1:165051858-165051880 CAGATAAAGTACTCACAGGAGGG - Intergenic
917840846 1:178976307-178976329 GAGACCAAGAACCCACAAGAAGG + Intergenic
918489472 1:185065534-185065556 CAGACCATGAACCCACCAGGAGG + Intronic
919506530 1:198405369-198405391 AAGACCAAGAACCCACAAGAAGG + Intergenic
924731161 1:246712840-246712862 GAGATCACGAACCCACCAGGAGG + Intergenic
924758742 1:246965142-246965164 CAGATCACGAGGTCAGAAGGTGG + Intronic
1063517266 10:6709395-6709417 CTGATCAACAACTGACAAAGTGG + Intergenic
1064081222 10:12309412-12309434 GAGATCAAGAACTCACTGGAAGG - Intergenic
1067154771 10:43769938-43769960 CACATCAAGAAGGCACAATGGGG - Intergenic
1067859927 10:49835375-49835397 CTAATCAACAACTCAGAAGGGGG + Intronic
1069364535 10:67683657-67683679 GAGATCAAGAACCCACCAGAAGG - Intronic
1069365410 10:67690222-67690244 CAGATCATGAACCCACTGGGAGG - Intronic
1071277171 10:84065884-84065906 CAGGTCAAGAGCTCAGCAGGTGG - Intergenic
1072521001 10:96230041-96230063 CAGATCTAAAACTCACAGGTTGG + Intronic
1072740331 10:97905281-97905303 CAGATCAAGACCAGATAAGGCGG - Intronic
1075808010 10:125203989-125204011 CAGAACAAGAACACAAAGGGTGG + Intergenic
1076781001 10:132724569-132724591 AATCTCCAGAACTCACAAGGAGG + Intronic
1078904651 11:15672420-15672442 CAGTCCAAGAACTTCCAAGGAGG - Intergenic
1079093109 11:17494439-17494461 CAGAGCAAGGCCCCACAAGGGGG + Intronic
1079139503 11:17798603-17798625 CGGATTTAGAACTTACAAGGTGG + Intronic
1082171501 11:49010692-49010714 CAGATCAAGGAGTTACATGGGGG + Intergenic
1083074146 11:60019626-60019648 CAGACCACGAACCCACCAGGAGG - Intergenic
1084311815 11:68321414-68321436 CAGATCAAGAGATCAAAGGGTGG - Intronic
1085805751 11:79634494-79634516 CAAATCATTAACTCAGAAGGAGG + Intergenic
1087869186 11:103270629-103270651 CAGATCAACAGATCACAAGAAGG - Intronic
1087960275 11:104339727-104339749 CAGACCACGAACCCACCAGGAGG + Intergenic
1089465436 11:118682200-118682222 CAGATAAAGACATCACAAGAGGG - Intergenic
1090157797 11:124459942-124459964 CAGACCAAGAACCCACCAGAAGG + Intergenic
1090461292 11:126893887-126893909 CAGATTAAAAACTCATAAGATGG + Intronic
1093999707 12:25681945-25681967 CACATCAAAAACTCAGAAAGAGG - Intergenic
1095898890 12:47307124-47307146 GAGACCACGAACTCACCAGGAGG + Intergenic
1096698910 12:53369337-53369359 CAGGTCAAGAACTCACCGGCCGG - Intergenic
1097428037 12:59471454-59471476 AAGACCAAGAACCCACAAGAAGG + Intergenic
1098641149 12:72839547-72839569 GAGATTGAGAACTCACAGGGAGG - Intergenic
1099026300 12:77468569-77468591 CAGATCACGAAGTCACGAGATGG + Intergenic
1099804276 12:87498245-87498267 CAAATCCAGAAATCAAAAGGTGG - Intergenic
1100076171 12:90786340-90786362 GAGACCAAGAACCCACAAGAAGG + Intergenic
1101789513 12:107914140-107914162 CAGACCAAGAACCCACCAGAAGG - Intergenic
1102150863 12:110688624-110688646 CAGAGCCAGAACTCACAACCAGG - Exonic
1102536268 12:113583655-113583677 CAGCCCAAGAATTCACATGGAGG + Intergenic
1103029302 12:117599747-117599769 CATATCAAGAATGCACAAGAAGG + Intronic
1103593160 12:122006543-122006565 CTGATCCAGAACTCACAAACCGG - Intergenic
1106260190 13:28059736-28059758 CAGATCAAGAGGTCAAAAGACGG + Intronic
1106388067 13:29307490-29307512 CAGATCCACAACTGACAAGTTGG - Intronic
1107533410 13:41306043-41306065 GAGATGAAGAACTCAAAGGGAGG + Intergenic
1108725060 13:53171624-53171646 CAAATCAAGAACACACATGCAGG - Intergenic
1109419725 13:62095900-62095922 GAGACCATGAACTCACCAGGAGG - Intergenic
1110260240 13:73476652-73476674 CAGCTCAAGAATACACATGGAGG + Intergenic
1110887602 13:80658239-80658261 AAGACCAAGAACCCACCAGGAGG - Intergenic
1113204227 13:107897111-107897133 CAGATCACGAACTCACCAGGAGG - Intergenic
1116282971 14:42931966-42931988 CAGAACAGGAACTCAAATGGGGG + Intergenic
1119303549 14:73589939-73589961 CAGACCACGAACTCACCAGGAGG - Intergenic
1124128111 15:26957383-26957405 GATATCAAGAACACACAATGAGG - Intergenic
1126179875 15:45774981-45775003 CAGATAAGAAACTTACAAGGAGG - Intergenic
1126706704 15:51413048-51413070 CAGATAAAGCAATAACAAGGTGG - Intergenic
1128814360 15:70596628-70596650 ATGATCAACAACTCACAAAGTGG + Intergenic
1129944053 15:79523990-79524012 CAGAGCAAGAACACAAATGGAGG + Intergenic
1130178449 15:81599650-81599672 CAGACCAAGAACTCTAAAGAAGG - Intergenic
1131088521 15:89599617-89599639 CAGTTCCAGATCTCAGAAGGTGG + Intronic
1135224050 16:20640226-20640248 CTGATCAAAGACTCACAAGAAGG + Intronic
1136520703 16:30793971-30793993 CTGATCATGAAATCCCAAGGTGG - Intergenic
1137484882 16:48882562-48882584 CAGAGCTAGAACTCCCAAGCTGG + Intergenic
1138095110 16:54205364-54205386 CAGATCATGAACTCTCAAAAGGG + Intergenic
1139224889 16:65224953-65224975 CAGATCAAAAACTCACACCATGG + Intergenic
1143009071 17:3855766-3855788 CAGATCACAAAGTCACAAGTTGG - Intergenic
1145094962 17:20017299-20017321 GAGACCACGAACTCACCAGGAGG + Intronic
1145749695 17:27346492-27346514 CAGCCCCAGAACACACAAGGAGG + Intergenic
1146319031 17:31832043-31832065 CAGACCAAGAACCCACCAGAAGG - Intergenic
1153407067 18:4752894-4752916 GAGACCAAGAACTCACCAGAAGG - Intergenic
1155917426 18:31570194-31570216 CAGAGAAAGATCTCACATGGGGG - Intergenic
1156308789 18:35904249-35904271 CAGATCATGAACTCCCAATAGGG - Intergenic
1159289382 18:66396202-66396224 CAGACCACGAACCCACCAGGAGG + Intergenic
1161023046 19:2020387-2020409 AATATCAAGAACTCAGGAGGCGG + Intronic
1164534258 19:29073255-29073277 GAGTTCAACAATTCACAAGGGGG - Intergenic
1166049900 19:40252473-40252495 CACATCAGGTACTGACAAGGTGG - Intronic
1168090553 19:54080251-54080273 CAGATCAAGAAGTCAGGAGATGG + Intronic
925223643 2:2162908-2162930 CAGATCAAGAGGTCACAGGGTGG - Intronic
925795570 2:7538955-7538977 CAGAAAAAGAATTCAGAAGGTGG - Intergenic
925811197 2:7702593-7702615 TAGATCAAGAACTTACCAGAGGG + Intergenic
928704160 2:33929818-33929840 AAGATCAGGAAATCACAAGCGGG + Intergenic
929427214 2:41855472-41855494 CAGTTCCAGCACTCACAAGCAGG + Intergenic
932779605 2:74551871-74551893 CAGAGCTAAAACTAACAAGGTGG - Intronic
935039584 2:99413422-99413444 CAGAACAAGAATTCACAAAATGG + Intronic
937050419 2:118883761-118883783 CAGACCAAGAACTCACTGGAAGG - Intergenic
937335803 2:121061781-121061803 CACTTCAAGAACTCCCTAGGAGG + Intergenic
940225503 2:151396798-151396820 CAGAATAAGAACTCACAAACAGG - Intergenic
941819502 2:169829722-169829744 CAGTTCAAGAACTCAAATGTTGG - Intronic
942334875 2:174872719-174872741 CAGTTCAAGCACTCAAAAGATGG + Intronic
943103369 2:183512495-183512517 GAGACCAAGAACTCACCAGAAGG - Intergenic
944302884 2:198144698-198144720 CAGAGCAAGAACACACTAGCAGG - Intronic
946001693 2:216487678-216487700 CAGAGCAACCACTCACAAGGGGG - Intergenic
1169111838 20:3039143-3039165 CAGATCTAGAAGTCAGATGGTGG + Intergenic
1169663900 20:8012479-8012501 CAGAGCAAGAACACAGATGGAGG + Intronic
1171398824 20:24858444-24858466 CAGATCAAGAACCCACCTGAAGG - Intergenic
1173419534 20:42888684-42888706 CAGATAAAGAACTTCCAAGGTGG + Intronic
1175091118 20:56505137-56505159 CACAGCAAGACCTCACAAGCTGG - Intronic
1176663592 21:9663504-9663526 CAGACCACGAACCCACCAGGAGG - Intergenic
1176671191 21:9736666-9736688 GAGATCAAGAACCCACCAGGAGG + Intergenic
1177579005 21:22994902-22994924 CAGAAAAAGAATTCAGAAGGTGG + Intergenic
1179016696 21:37600133-37600155 CAGATCCAGAACACACACAGAGG - Intergenic
1180879514 22:19193797-19193819 CAGATCACGAACCCACCAGAAGG - Intronic
1182592707 22:31394372-31394394 GAGACCAAGAACCCACCAGGAGG + Intergenic
1182758552 22:32701460-32701482 CAGATCAAGAAATTATAAGAAGG + Intronic
1182916031 22:34031478-34031500 GATATCAAGAACACACAATGAGG - Intergenic
1183421970 22:37717207-37717229 CAGACCATGAACCCACAGGGAGG - Intronic
1184536736 22:45092693-45092715 CACATCAATACCTCACATGGGGG - Intergenic
952095926 3:29953978-29954000 GAAATCAAGAACATACAAGGAGG - Intronic
952466448 3:33592248-33592270 CAGAACAAGAACTCAGTATGTGG + Intronic
952554656 3:34518721-34518743 AAGACCAAGAACCCACAAGAAGG - Intergenic
952555352 3:34523888-34523910 GAGACCAAGAACCCACAAGAAGG - Intergenic
954426368 3:50445322-50445344 TGCATCAAGAACTCAGAAGGGGG - Intronic
954598596 3:51850347-51850369 CAGACCATGAACCCACCAGGAGG + Intergenic
955768789 3:62370349-62370371 CAGATCAAGAACAAAAAACGTGG + Intronic
955977279 3:64490760-64490782 CACAACAAGAACTCAGAAGAGGG - Intergenic
957510459 3:81181354-81181376 CAGACCAAGAACCCACAGGAAGG + Intergenic
957510529 3:81182180-81182202 GAGATGAAGAACCCACAAGAAGG - Intergenic
958575760 3:95948680-95948702 AAGACCAAGAACTCACCAGAAGG - Intergenic
958576101 3:95951039-95951061 CAGACCAAGAACCCACCAGAAGG - Intergenic
962690798 3:137896591-137896613 CATATTAAAAACTCTCAAGGGGG + Intergenic
965722585 3:171678006-171678028 TGAATAAAGAACTCACAAGGTGG + Intronic
966381755 3:179351541-179351563 CAGATCTTGAGCTCAGAAGGGGG - Intronic
967032420 3:185620365-185620387 CAACTCAAGAACTAAAAAGGAGG - Intronic
970783797 4:19771542-19771564 AAGACCAAGAACCCACAAGAAGG + Intergenic
970856281 4:20652124-20652146 CAGGTAAAGAATTCAGAAGGTGG + Intergenic
971291739 4:25348435-25348457 CAGATGCAGAACCCACAAGTGGG - Intronic
972791212 4:42373148-42373170 GAGACCAAGAACTCACCAGAAGG - Intergenic
974527499 4:63062250-63062272 GAGATCAAGAACCCACCGGGAGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
979235305 4:118393186-118393208 GAGACCAAGAACCCACAAGAAGG + Intergenic
980291211 4:130848781-130848803 AAGACCAAGAACTCACCAGAAGG - Intergenic
982036691 4:151352939-151352961 CAGACCAAGAACCCACCGGGAGG - Intergenic
983771661 4:171557681-171557703 CAGATCATGAAGTCAGAAGGTGG - Intergenic
984938937 4:184914752-184914774 GAGACCAAGAACCCACAAGAAGG - Intergenic
985235010 4:187862918-187862940 CTGTTCAAGACCTTACAAGGGGG - Intergenic
985298476 4:188460556-188460578 CAGACCAAGAACCCACCAGAAGG + Intergenic
985411715 4:189692429-189692451 CAGACCACGAACCCACCAGGAGG + Intergenic
987591204 5:19929433-19929455 TAGTGCAAGAAATCACAAGGAGG + Intronic
988442026 5:31244291-31244313 CAAATCAAGAACATAAAAGGTGG + Intronic
992867754 5:80974671-80974693 CAGATCAAGAACTCACAAGGTGG - Intronic
993529038 5:89002989-89003011 GAGACCATGAACTCACCAGGAGG - Intergenic
993864283 5:93173701-93173723 CAAAGGAGGAACTCACAAGGAGG + Intergenic
994126964 5:96178911-96178933 GAGATCAGGAACACAGAAGGAGG - Intergenic
994327773 5:98468966-98468988 GAGATCAAGAACCCACCAGAAGG - Intergenic
998701666 5:144709489-144709511 CAGACCAAGAACGCACCAGAAGG + Intergenic
1000301682 5:159962280-159962302 CACATCAGGAACTAACGAGGGGG + Intronic
1002757862 6:178833-178855 CAGACCATGAACCCACCAGGAGG - Intergenic
1002842296 6:916487-916509 CAGACCAAGAACCCACTGGGAGG + Intergenic
1003612693 6:7627869-7627891 CACAACAAGAAGTCACAAGTAGG - Intergenic
1005395227 6:25375959-25375981 CAGATAAAGAATTCAAAAGGTGG - Intronic
1005441627 6:25875416-25875438 CAGATCAAGAATTCAGAAGGAGG + Intronic
1006077129 6:31540917-31540939 CAGATCAAGAATTTATAAGTTGG - Intronic
1006221265 6:32494091-32494113 CAGACCAAGAACCCACCAGAAGG + Intergenic
1006422455 6:33943862-33943884 CAAATGAAGAACTTAAAAGGAGG + Intergenic
1009971210 6:70627491-70627513 GAGATCACGAACCCACCAGGAGG - Intergenic
1011164693 6:84432748-84432770 AAGACCAAGAATTCACAAGCAGG + Intergenic
1012260480 6:97082232-97082254 CACATCAAGAACCCAAAAGCTGG - Intronic
1012604135 6:101135967-101135989 CAAATAAAGAACTTAAAAGGGGG - Intergenic
1013461311 6:110377721-110377743 CAGATCAAAATCTCACAGGGTGG - Intergenic
1016415011 6:143822876-143822898 ATGTTCAGGAACTCACAAGGAGG + Intronic
1017500201 6:155017056-155017078 CAGAGCAGGAACTCACAGGCAGG + Intronic
1021529536 7:21628850-21628872 AAGATCAACAACACAAAAGGTGG - Intronic
1024668699 7:51570562-51570584 TAGATAAAAAACTCACATGGTGG + Intergenic
1024735657 7:52302149-52302171 GAGACCACGAACTCACCAGGAGG - Intergenic
1026379685 7:69786648-69786670 GAGATCAAGAACCCACCAGAAGG + Intronic
1027446384 7:78278398-78278420 CAGATCCACAAAACACAAGGCGG - Intronic
1029661327 7:101964047-101964069 CACATCAAGAAATGACAAGGCGG + Intronic
1030423492 7:109340090-109340112 CAGATCAACAGATCACAAGAAGG - Intergenic
1031622125 7:123946714-123946736 CTGATCAAGGACTCAAAAGAAGG - Intronic
1032531143 7:132621480-132621502 CAGATCATGAAGTCAAAAGATGG - Intronic
1034756081 7:153620851-153620873 AAGATCAACAACTATCAAGGAGG + Intergenic
1034776238 7:153829435-153829457 CAGATCATGAAGTCAGAAGTTGG - Intergenic
1037165243 8:15819777-15819799 CAAATTCAGAACTCACAATGTGG + Intergenic
1040016046 8:42701004-42701026 CAGATCATGAAGTCAGGAGGTGG + Intronic
1040559072 8:48507844-48507866 GAGACCAAGAACCCACAAGAAGG + Intergenic
1042640747 8:70931407-70931429 CAGATCTAGAACTAAGAAAGAGG - Intergenic
1044134065 8:88562004-88562026 CAGCTCAAGAAGTCACACAGGGG - Intergenic
1044213085 8:89573581-89573603 CAAATCAAAATCTCAGAAGGTGG - Intergenic
1045467599 8:102484787-102484809 CAGACCAAGAACCCACCAGAAGG - Intergenic
1048113019 8:131488300-131488322 GAGACCAAGAACCCACCAGGAGG + Intergenic
1050074561 9:1849885-1849907 AAGATCAAGAACTTTCAAGTTGG - Intergenic
1051420259 9:16882133-16882155 TAGATCGAGAACTCACCAGCAGG - Intergenic
1052620960 9:30909756-30909778 CAGATCAAGAACATACATTGGGG - Intergenic
1056132127 9:83597290-83597312 CAGATCTAGACCTCACTGGGTGG + Intergenic
1059045689 9:110863713-110863735 CAAAACAAGAACTCAGAATGTGG + Intergenic
1059775544 9:117471154-117471176 CATATCAATAAATCTCAAGGGGG - Intergenic
1061555336 9:131364661-131364683 CAGATAAAGAATACACATGGTGG - Intergenic
1203670881 Un_KI270755v1:10553-10575 CAGACCACGAACCCACCAGGAGG - Intergenic
1185706504 X:2271312-2271334 GAGACCAAGAACCCACAAGAAGG + Intronic
1185817521 X:3170017-3170039 GAGATCACGAACCCACCAGGAGG - Intergenic
1186671839 X:11775135-11775157 CAGGTGAATAACTAACAAGGTGG + Exonic
1186679094 X:11853521-11853543 CAGAATAAGAAATGACAAGGGGG + Intergenic
1187306258 X:18098010-18098032 CAGATCTAGCACTGAAAAGGTGG + Intergenic
1187611176 X:20944989-20945011 CACATCAAGGACTCACATGTAGG - Intergenic
1188176925 X:27002296-27002318 CAGACCAGGAACCCACCAGGAGG - Intergenic
1188364873 X:29303206-29303228 CAGCTAAAGAACTAACAAGATGG + Intronic
1188766217 X:34095376-34095398 CAGACCAAGAACCCACCAGAAGG - Intergenic
1189245875 X:39562911-39562933 CATATCATCAACTCAAAAGGAGG + Intergenic
1190744142 X:53311315-53311337 GAAATCAAGAAATCACAAGTTGG - Intronic
1193264947 X:79456809-79456831 GAGACCACGAACCCACAAGGAGG + Intergenic
1193382759 X:80834788-80834810 CAGATAAAGAATTCAAAAGATGG + Intergenic
1194066602 X:89269313-89269335 AAGATCACGAACCCACAAGGAGG - Intergenic
1194179198 X:90692232-90692254 AAGAACAGGAACTTACAAGGAGG - Intergenic
1194262807 X:91717550-91717572 CAGATAAACAATTCAGAAGGTGG + Intergenic
1199332574 X:146580189-146580211 CAGATAAAGAATTCAGAAGGTGG - Intergenic
1199586968 X:149424575-149424597 CAGATAAAGAATTCAGAAGGTGG + Intergenic
1200525866 Y:4274398-4274420 AAGAACAGGAACTTACAAGGAGG - Intergenic
1200581870 Y:4960693-4960715 CAGATAAACAATTCAGAAGGTGG + Intergenic
1200710955 Y:6484664-6484686 GAGACCAAGAACCCACAAGAAGG + Intergenic
1200720773 Y:6603467-6603489 AAGATCACGAACCCACAAGGAGG - Intergenic
1200750317 Y:6938891-6938913 GAGACCAAGAACCCACAGGGAGG - Intronic
1200881104 Y:8211863-8211885 GAGATCAAGAACACACCAGAAGG - Intergenic
1201321519 Y:12703289-12703311 GAGACCAAGAACCCACAAGAAGG - Intronic
1202089509 Y:21175184-21175206 GAGATCAAGAACCCACAAGAAGG - Intergenic