ID: 992868985

View in Genome Browser
Species Human (GRCh38)
Location 5:80987066-80987088
Sequence CTGTAGAAAAGGAGCTCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992868985_992868992 26 Left 992868985 5:80987066-80987088 CCAGATGAGCTCCTTTTCTACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 992868992 5:80987115-80987137 AGTTTGCCACACCTTGCCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 102
992868985_992868987 1 Left 992868985 5:80987066-80987088 CCAGATGAGCTCCTTTTCTACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 992868987 5:80987090-80987112 AGACCAACTCTCTGACCCTCTGG No data
992868985_992868988 2 Left 992868985 5:80987066-80987088 CCAGATGAGCTCCTTTTCTACAG 0: 1
1: 0
2: 0
3: 9
4: 138
Right 992868988 5:80987091-80987113 GACCAACTCTCTGACCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992868985 Original CRISPR CTGTAGAAAAGGAGCTCATC TGG (reversed) Intronic
900695452 1:4006669-4006691 CTGTAGATAATGAGTGCATCAGG - Intergenic
901879058 1:12183240-12183262 CTATGGATAAGAAGCTCATCAGG - Intronic
904669746 1:32154806-32154828 CTGTAGAAAAGTAGCTTACTAGG + Intronic
905048851 1:35031338-35031360 CTGTAGAAAAGAAACTCAATTGG + Intronic
906091687 1:43185022-43185044 CTGTGGAAAAGGGGATCATTGGG + Intronic
907235410 1:53041798-53041820 CTGTAGGAAAGGATGACATCGGG + Intronic
909438252 1:75669153-75669175 CTCAAGAAAATGAGCTCATCTGG - Intergenic
914429348 1:147606233-147606255 CTGAATAAAAGGAAGTCATCTGG + Intronic
914447225 1:147760305-147760327 CTGGACAAAAGGAACTCATGTGG - Intronic
916119549 1:161515918-161515940 CAGTATTAAAGGAGCTCAACTGG + Intronic
916129313 1:161597572-161597594 CAGTATTAAAGGAGCTCAACTGG + Intronic
922534402 1:226369231-226369253 CTGGAGAAAAGGCGCTGAACCGG - Intronic
923240264 1:232077744-232077766 CTGTTGAATGTGAGCTCATCAGG + Intergenic
1065946880 10:30612901-30612923 CTGTAAAAAGAGAGGTCATCAGG + Intronic
1066357393 10:34698213-34698235 CTGCAGATAATGATCTCATCTGG - Intronic
1070087581 10:73252024-73252046 CTGTAGAAAAGCAGCTGGTTAGG + Intronic
1070634155 10:78110563-78110585 CTATAGAAAAGGGGCTCAAAAGG - Intergenic
1070950333 10:80425927-80425949 CAGTGGTAAAGGAGCACATCAGG + Exonic
1071169339 10:82845388-82845410 GTGTAAAAAAGGAAATCATCTGG - Intronic
1071258410 10:83896304-83896326 CTGCAGAAATGGAGCTGCTCAGG - Intergenic
1073517283 10:104087768-104087790 AAGTAAAAAAGGAGCCCATCAGG - Intergenic
1075686074 10:124366062-124366084 CTGTTGGTCAGGAGCTCATCTGG + Intergenic
1075737859 10:124675057-124675079 CTGGGGAAGAGGAGTTCATCTGG - Intronic
1076126979 10:127982734-127982756 CTGCTGAAAAGGAGCTTCTCCGG + Intronic
1076600855 10:131656113-131656135 TTGTAGAAATGGGGCTCATGGGG + Intergenic
1077668000 11:4132263-4132285 CTAAAGAAAAGGAGATTATCAGG - Intronic
1078895515 11:15593859-15593881 CTGCAGGATTGGAGCTCATCTGG + Intergenic
1084898891 11:72295041-72295063 CTGAAAAAAAGGAGCACATCCGG - Intronic
1087885234 11:103472889-103472911 CTGTTGAAACGAAGCTCCTCAGG - Intronic
1088003183 11:104907467-104907489 CTGAAGGAAAGCAGCCCATCTGG + Intergenic
1095983203 12:47984254-47984276 GTGTGGAAATGGAGCTCAGCTGG - Intronic
1100807315 12:98299449-98299471 ATGTAGAAAATGAGCTTAACTGG + Intergenic
1101584888 12:106077043-106077065 CTGTTTATAATGAGCTCATCTGG + Intronic
1102360812 12:112286162-112286184 CTTTAGCAAAGGCGCTCTTCAGG + Intronic
1103492951 12:121337468-121337490 CTGTAGAAAAGAAAATAATCAGG - Intronic
1106898516 13:34330919-34330941 CAGTATTGAAGGAGCTCATCAGG - Intergenic
1109236582 13:59828843-59828865 CTGTAGATAATGTGCTCATTGGG - Intronic
1113399979 13:109982528-109982550 TTGTAGAAATGGAGCTGCTCAGG - Intergenic
1113459481 13:110472018-110472040 CTGGATAAAATGATCTCATCAGG - Intronic
1119761266 14:77153587-77153609 TTGTAGAAGAGAAGCTCAGCTGG + Intronic
1124864642 15:33477311-33477333 CCGGAGAAAAGGAGATCATATGG + Intronic
1126171000 15:45695237-45695259 ATGTATAAAAGTAGCTCCTCTGG + Intergenic
1128395419 15:67220308-67220330 CTGTAGCCAATGAACTCATCTGG + Intronic
1131758245 15:95589746-95589768 CTGTAGAAAAGCAGTGCTTCTGG + Intergenic
1137612030 16:49824704-49824726 CTGCAGAACAGGAGCTTTTCTGG + Intronic
1138100098 16:54245298-54245320 TTCTAGAAAAGGAGTTCATTCGG + Intergenic
1138335824 16:56252111-56252133 CTGTATCAAATGAGCTGATCAGG + Intronic
1139488100 16:67270789-67270811 GTGCAGAAAAGGAGCTCCCCTGG + Exonic
1141434009 16:83988664-83988686 TTGCAGAAAAGGTGCTCATCTGG + Intronic
1142782295 17:2190613-2190635 CTTTAGAAAAGGAGCCAACCTGG - Intronic
1142846888 17:2685747-2685769 CTGAAGGAAAGCAGCTCATGAGG - Intergenic
1142915417 17:3132692-3132714 CTGCAGAGAAAGGGCTCATCAGG + Intergenic
1146461760 17:33051538-33051560 CTGTAGGCAAGCACCTCATCTGG + Intronic
1147685023 17:42281989-42282011 GTGTAGAAAAGCAGCTCAGTGGG + Intergenic
1156242909 18:35271150-35271172 CTGTGGAAAAGGACCCCACCAGG + Intronic
1161040400 19:2108018-2108040 CTGCAGAAAAGGAACTCCCCAGG + Intronic
1166357093 19:42233619-42233641 CGGGAGAGAAGGAGCTCATTGGG - Intronic
1168552745 19:57311384-57311406 TAGGAGAAAAGGAGCTCAGCCGG - Intergenic
929979954 2:46668991-46669013 CTGGGGAAAATGAGCTCATCCGG + Intergenic
935132933 2:100274848-100274870 CTGGAGAAAAGGAGCGCACCAGG - Exonic
937885104 2:126894260-126894282 CTGTAGAGAAGGATGTCAGCAGG + Intergenic
938756942 2:134389422-134389444 CTTTAAAAAAGGAGCAAATCTGG - Intronic
939491803 2:142885283-142885305 CTGTAGAAAATGAGCCCTTTAGG - Intronic
941596296 2:167480919-167480941 CTGTAGAAAAACTGCTCATATGG + Intergenic
942513533 2:176728055-176728077 CTGGAGGTATGGAGCTCATCTGG - Intergenic
942810982 2:180001028-180001050 CTGTTGAAAAGAAGCACATTGGG - Intronic
943635657 2:190303976-190303998 CTGTAGAATACCATCTCATCTGG - Intronic
945114239 2:206395021-206395043 CTGTAGAAAAAGAGGTCAAGAGG + Intergenic
1170389983 20:15861706-15861728 CAGTAGAAAAGGAGATCTACAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1174737555 20:52979695-52979717 CTGTAGAAAAAGACATCCTCTGG + Intronic
1177423786 21:20896386-20896408 CTGTACAGAAGGAGCAAATCGGG + Intergenic
950321419 3:12058130-12058152 CTGTAGATAAGTAGGCCATCTGG + Intronic
951683565 3:25320426-25320448 CTGCAGAAAAGGAGCTTTCCAGG + Intronic
953002124 3:38945589-38945611 CTGCAGAAAAGGGGACCATCAGG - Intronic
953728957 3:45428625-45428647 ATGTAGGTAAGGAGTTCATCTGG - Intronic
954785623 3:53090247-53090269 CTGCAGAGAAGCAGCTCATGAGG + Exonic
954952744 3:54489611-54489633 CTGTAGATAAGGAGCAGAGCTGG + Intronic
955367236 3:58321528-58321550 ATGTAGAAAATCAACTCATCAGG - Intergenic
955924322 3:63990646-63990668 CTTCAGGAAAGGAGCTAATCAGG - Intronic
961521578 3:127470123-127470145 ACGTTGACAAGGAGCTCATCAGG + Intergenic
962983095 3:140508328-140508350 CTGTAGAAAAGGAGAATATGAGG - Intronic
963085676 3:141434091-141434113 CTGTACTCAAGGAGCTCATAGGG + Intronic
967434950 3:189432525-189432547 CTGTAAAAAAGGAACCCATACGG + Intergenic
968908590 4:3465552-3465574 CAGTGGAAAAGGTGCACATCGGG - Intronic
970267127 4:14300596-14300618 CTGGAGAAATGGTGGTCATCTGG - Intergenic
972686741 4:41360163-41360185 CTGGAGAAGAAAAGCTCATCAGG + Intronic
974055801 4:56981545-56981567 CTGTGGAAAAAGAGTTTATCAGG + Intronic
977114388 4:93004536-93004558 CTGTAGAAAAGGAGAAACTCGGG - Intronic
977922921 4:102665587-102665609 CTGCATAAACTGAGCTCATCTGG + Intronic
978413841 4:108454969-108454991 CTGAAGAAATCGAGGTCATCCGG + Intergenic
980043247 4:127963762-127963784 CTGTGGAAAGGGACCTCAGCGGG + Intronic
990119755 5:52436621-52436643 CTTTAGAAAAGGATATCATGAGG - Intergenic
991646345 5:68804149-68804171 CTGTCGAAAAGGAGGTGAACTGG - Intergenic
992050566 5:72936706-72936728 CTGTAGGCCAGGAGCTCAGCTGG + Intergenic
992868985 5:80987066-80987088 CTGTAGAAAAGGAGCTCATCTGG - Intronic
994915527 5:105972327-105972349 CTGTAGAAAAAGAGTTCATGTGG + Intergenic
995486570 5:112645840-112645862 CTGTAGACATGGGGATCATCTGG + Intergenic
999214852 5:149923996-149924018 GTCTAGAAAAAGAGCTCAACTGG - Intronic
999693115 5:154165960-154165982 CTGCAGCAAAGCAGCTCAGCAGG - Intronic
1000643900 5:163738207-163738229 CTGGAGCAAAGGAGTTTATCAGG + Intergenic
1000987710 5:167879076-167879098 CTATAGAACAGGTGCTCCTCGGG - Intronic
1006830832 6:36967293-36967315 CTGTAGAGAAGGAGGGCCTCGGG - Intergenic
1009509262 6:64528054-64528076 CTGTAGAAAATTAGGTCATATGG + Intronic
1010169713 6:72960725-72960747 CTGTATAAAAGTAACTTATCTGG - Intronic
1011220212 6:85047192-85047214 CTTTAAAAATGGAGTTCATCTGG - Intergenic
1015844464 6:137505344-137505366 CTGCAATACAGGAGCTCATCTGG - Intergenic
1017381793 6:153839662-153839684 CTGGAGAAAAGGGAATCATCTGG - Intergenic
1017797648 6:157861424-157861446 CTGTAGAAAGCGTGCTCATCAGG + Intronic
1018715242 6:166527301-166527323 AAGGAGAAAAGGAGCTCTTCCGG + Intronic
1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG + Intergenic
1019361284 7:605360-605382 CTGCAGAACAGGAGCCCAGCGGG + Intronic
1020125050 7:5528979-5529001 CACCAGAAAAAGAGCTCATCTGG + Intronic
1022409050 7:30122171-30122193 CTGTAGAAAACTGGCCCATCTGG + Intronic
1031232918 7:119133593-119133615 ATGTAGAAAACGTTCTCATCTGG - Intergenic
1032347930 7:131134145-131134167 CTCTAGAAACTGTGCTCATCAGG + Intronic
1034670968 7:152858306-152858328 CTGTAGAAGAGGAGCCAATCAGG + Intergenic
1035853303 8:2943823-2943845 TTGTTGAGAAGAAGCTCATCTGG + Intronic
1036529800 8:9574246-9574268 TTGCAGAAAAGCAGTTCATCGGG + Intronic
1037116195 8:15231004-15231026 CAGTGGAAAAGGTGCTGATCTGG - Intronic
1039622304 8:39009527-39009549 CTGTAGAAAAGGAGGAAAACAGG - Intronic
1042811928 8:72835107-72835129 ATGTGGAACAGAAGCTCATCAGG + Intronic
1042856996 8:73277692-73277714 CAGTGGTAAAGGAGCACATCAGG - Intergenic
1048605223 8:135961361-135961383 CTGTAGAAACTGTGCTCACCAGG - Intergenic
1048856915 8:138693945-138693967 CTGTAGAAATGTAGCTCAGAGGG + Intronic
1051750486 9:20336358-20336380 CTCTAGCAATTGAGCTCATCAGG + Intergenic
1053330204 9:37199012-37199034 CAATAGAAAAGGAGCTCAGTGGG - Intronic
1053804208 9:41784633-41784655 CTAAAGGAAAAGAGCTCATCTGG + Intergenic
1054141073 9:61530826-61530848 CTAAAGGAAAAGAGCTCATCTGG - Intergenic
1054192516 9:61996129-61996151 CTAAAGGAAAAGAGCTCATCTGG + Intergenic
1054460761 9:65461269-65461291 CTAAAGGAAAAGAGCTCATCTGG - Intergenic
1054645889 9:67592562-67592584 CTAAAGGAAAAGAGCTCATCTGG - Intergenic
1055088621 9:72339524-72339546 CTGTTGAAAACGAGCTCAAAGGG + Intergenic
1059946769 9:119417169-119417191 CTGTAGACAAGGAGATTATCTGG + Intergenic
1060533997 9:124368445-124368467 CTGTAGTAGAGGAATTCATCAGG - Intronic
1062070725 9:134553745-134553767 CTGGGGAATAGCAGCTCATCAGG + Intergenic
1186303730 X:8230433-8230455 ATGTAGAACAGGAGCCCATTTGG - Intergenic
1186908031 X:14132247-14132269 CTATAGAGAAGGAGCTCAGTTGG - Intergenic
1187000456 X:15171463-15171485 CTGTGGAAAGGTAGCTCAACTGG - Intergenic
1187032923 X:15506623-15506645 ATGTAGAAAATAAGCTTATCTGG + Intronic
1187804486 X:23103902-23103924 ATGTTGATAAGGAGCTCAGCAGG - Intergenic
1188773516 X:34184872-34184894 CTGTAGTCAAGGTGCTCACCAGG - Intergenic
1190827183 X:54028425-54028447 CAGGAGAAAAAGAGTTCATCGGG - Intronic
1192573114 X:72222333-72222355 CTGATGAAAAGGAGAGCATCTGG + Intronic
1193775975 X:85642075-85642097 CTGGGGAAAAGGAGAGCATCAGG - Intergenic
1196501696 X:116390864-116390886 CAGTAGGAAAGGAGGACATCAGG - Intergenic
1197699596 X:129588809-129588831 CTTGAGGAAAGGAGCTCGTCGGG + Intronic
1198459249 X:136847451-136847473 CTGTAGCTAAGGAGGTCTTCCGG - Intergenic