ID: 992869298

View in Genome Browser
Species Human (GRCh38)
Location 5:80990425-80990447
Sequence CAGTGAAAGGAGTCGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992869288_992869298 14 Left 992869288 5:80990388-80990410 CCTGAGAATTTTCCAAATACTCT 0: 1
1: 0
2: 2
3: 27
4: 331
Right 992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG No data
992869289_992869298 2 Left 992869289 5:80990400-80990422 CCAAATACTCTTGTCATCCTCTT 0: 1
1: 0
2: 0
3: 24
4: 255
Right 992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG No data
992869287_992869298 28 Left 992869287 5:80990374-80990396 CCAATACTTGGAATCCTGAGAAT 0: 1
1: 0
2: 0
3: 15
4: 140
Right 992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992869298 Original CRISPR CAGTGAAAGGAGTCGGGAGG GGG Intronic
No off target data available for this crispr