ID: 992874285

View in Genome Browser
Species Human (GRCh38)
Location 5:81037396-81037418
Sequence TAGGATAGCATTGAAGTTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992874285_992874287 -1 Left 992874285 5:81037396-81037418 CCGGCAACTTCAATGCTATCCTA 0: 1
1: 0
2: 0
3: 4
4: 116
Right 992874287 5:81037418-81037440 AATTTCACATCCTTTTTATGTGG 0: 1
1: 0
2: 3
3: 38
4: 412
992874285_992874289 25 Left 992874285 5:81037396-81037418 CCGGCAACTTCAATGCTATCCTA 0: 1
1: 0
2: 0
3: 4
4: 116
Right 992874289 5:81037444-81037466 CTTTATTTTCTGTCTCTCTCTGG 0: 1
1: 0
2: 4
3: 91
4: 752

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992874285 Original CRISPR TAGGATAGCATTGAAGTTGC CGG (reversed) Intronic
902156575 1:14492427-14492449 TAGGATGCCATTGTAGGTGCTGG + Intergenic
909331020 1:74411082-74411104 TACCATAAAATTGAAGTTGCTGG + Intronic
911592562 1:99765254-99765276 TGGGATAGAACTGAAGTTGGGGG - Intronic
912029152 1:105217370-105217392 TAGGTTATGATTGAATTTGCTGG + Intergenic
912883250 1:113440402-113440424 TAGGATATCTGTGAAGTTGCAGG + Intronic
913680238 1:121183565-121183587 TAGGCTAAAATTCAAGTTGCGGG + Exonic
920082097 1:203382311-203382333 TAGGATAGCACAGAATTTTCTGG + Intergenic
1066798753 10:39158554-39158576 TAGGAGAGCATTGAGGTTTATGG + Intergenic
1068133819 10:52930034-52930056 TAGGTTAGCATTAAAGATGGTGG + Intergenic
1068344670 10:55759180-55759202 TTGGATAGGAGTGAAGTTACTGG - Intergenic
1070861872 10:79675120-79675142 TTGGATAGGAGTGAAGTTACTGG + Intergenic
1070875272 10:79799470-79799492 TTGGATAGGAGTGAAGTTACTGG - Intergenic
1071304316 10:84284526-84284548 TAGGATTGCCTTGGAGATGCGGG - Intergenic
1071323339 10:84487205-84487227 TAGGATAGTCTTGAAAATGCGGG + Intronic
1071382829 10:85086302-85086324 GAAGATAGCATTGAAGGTGAGGG + Intergenic
1074356881 10:112793835-112793857 TACGACATCATTGCAGTTGCAGG + Intronic
1075415751 10:122261938-122261960 TAGGATTGCATTAAATCTGCAGG + Intergenic
1081504521 11:43701790-43701812 TAGGATAGCTTTGACTTTTCTGG + Intronic
1081517697 11:43849330-43849352 TAGCATAGCAGTGAAGTAACTGG - Intronic
1082314388 11:50699122-50699144 TAGGATTGCCTTGATGATGCGGG - Intergenic
1086650415 11:89281649-89281671 CATGAGAGAATTGAAGTTGCGGG - Intronic
1087157036 11:94915035-94915057 TATGATAGCAGTGATGATGCTGG - Intergenic
1088322371 11:108567400-108567422 GAGGCTGGCATTGAAGTGGCAGG - Intronic
1089082014 11:115784590-115784612 TAGGCTAGCATAGAAGTTAAGGG - Intergenic
1090231358 11:125108005-125108027 TAGGATTGCATTGAATTTATAGG - Intronic
1093876178 12:24352141-24352163 TAGGATAGCAATGAATGGGCAGG + Intergenic
1095858696 12:46890597-46890619 TAGGACAGCCTTGAAGTATCTGG + Intergenic
1096085286 12:48861520-48861542 TAGCATAGTATAGAAGATGCTGG - Intronic
1098187637 12:67914752-67914774 TAGGATAGGTTTGAAGTTCAGGG - Intergenic
1101240002 12:102828640-102828662 TAGGATTGACTTGAAGATGCGGG + Intergenic
1106642056 13:31595007-31595029 TATAATAGCATTGAATGTGCGGG - Intergenic
1112602566 13:100870699-100870721 CCAGATAGCATTGAAATTGCAGG - Intergenic
1114584776 14:23800814-23800836 TGGGATTGCATTGAATTTGTAGG - Intergenic
1116964907 14:51004038-51004060 AAGGATAGCATTACAGTTTCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1127936234 15:63641559-63641581 TAGGACAGCATTGAAACAGCAGG - Exonic
1128063065 15:64747430-64747452 AAGGAGAGAATTGAGGTTGCTGG - Intronic
1133497683 16:6335253-6335275 TAGGATGGCTTTGAAGGTGGTGG + Intronic
1133658812 16:7894146-7894168 TAAGTTAGCAATGAAGTTGATGG - Intergenic
1134333975 16:13277475-13277497 GAGGATTGCATTGAATTTGTAGG + Intergenic
1135541955 16:23336953-23336975 AAGGAAAGCATTGAATTAGCAGG + Intronic
1137312490 16:47278582-47278604 CAGAATAGCAGTGAAATTGCTGG - Intronic
1140664845 16:77217862-77217884 GAGGATGGCATTGCAGTTGGGGG - Intergenic
1148183477 17:45623762-45623784 GAGGATAGCATTGAGTTTGTGGG + Intergenic
1148265374 17:46221929-46221951 GAGGATAGCATTGAGTTTGTGGG - Intronic
1149042238 17:52203796-52203818 TAGGATAGCAGTGGAGTTTGAGG - Intergenic
1149669168 17:58390461-58390483 AAGGTGAGCATCGAAGTTGCAGG - Intronic
1150245516 17:63671875-63671897 TAGTATTGGATTGAATTTGCAGG + Intronic
1155079686 18:22396659-22396681 TAGTATAGCATTCATGTTTCGGG - Intergenic
1155980350 18:32173249-32173271 TAGGGCAGAATTGAACTTGCAGG + Intronic
1155993605 18:32306258-32306280 TAGGATAGCAGTGAGGTAGAAGG - Intronic
1159187869 18:65001923-65001945 TAGGATAACATTGAATTCCCAGG + Intergenic
926623642 2:15071055-15071077 TGGGATTGTATTGAAGTGGCTGG - Intergenic
926651742 2:15353900-15353922 TAGAGTAGCATTGAACTTTCTGG - Intronic
928734090 2:34265572-34265594 GGGGATAGCATTGAATTTGTAGG - Intergenic
935492576 2:103738426-103738448 TAGGAGATCATTGAAGTTAGAGG + Intergenic
936084002 2:109454042-109454064 TACGATAGTATTTAAGTTACAGG - Intronic
936950348 2:117971880-117971902 TAGTATAGCATTAAAGCTGATGG - Intronic
939650965 2:144761506-144761528 GGGGATAGTATTGAATTTGCAGG - Intergenic
942618716 2:177824149-177824171 GAGGATAACATTGAGGTTTCTGG + Intronic
943259707 2:185643574-185643596 TAGGATAGCATTATAGCTGTGGG + Intergenic
943733462 2:191328135-191328157 GAGGCTAGCATTTAATTTGCAGG + Intronic
1175369321 20:58476669-58476691 TGGGAAATCATTGAAGTTGTTGG - Intronic
1176041653 20:63068868-63068890 CAGGATAGCATTGAGGGTGAGGG + Intergenic
1178726004 21:35052239-35052261 CAGCATAGCATGGAAGTTTCTGG - Intronic
1178934234 21:36847461-36847483 TAGGATAGTAAATAAGTTGCTGG - Intronic
1183756309 22:39769522-39769544 CAGGGTAGCCTGGAAGTTGCAGG - Intronic
1183862188 22:40678400-40678422 GAAGATTGCATTCAAGTTGCGGG - Intergenic
949353953 3:3157734-3157756 TAGAATAGGATTGGAGTGGCGGG - Intronic
952116500 3:30188079-30188101 AAGGATGGCATTGAAACTGCTGG - Intergenic
954335833 3:49916928-49916950 TAGGATAGCTTTGGAATTACTGG - Exonic
957894052 3:86397169-86397191 TAACATAGAATTGAAGTTCCTGG - Intergenic
960185255 3:114630334-114630356 TTGGATGGCAGAGAAGTTGCTGG + Intronic
960815614 3:121668825-121668847 GAGTACAGCATTGAAGTTGGAGG - Intronic
962207667 3:133448173-133448195 CAGGATAGCGATGAAGATGCCGG + Intronic
962987011 3:140545205-140545227 AAGAATAGCAGAGAAGTTGCAGG + Intronic
965149851 3:164958274-164958296 TAGTATAGAAGAGAAGTTGCTGG - Intergenic
966560496 3:181314715-181314737 GAGGATGGCATTGTATTTGCTGG - Intergenic
967454029 3:189660523-189660545 TAGGATTGCTTTGAATTTTCAGG + Intronic
967759829 3:193211163-193211185 AAGGAGAGCATTAAATTTGCAGG - Intergenic
969529940 4:7725052-7725074 GATGATAGCAATGAAGTTGCTGG + Intronic
972109369 4:35537742-35537764 AAGTATAACATTGAATTTGCAGG - Intergenic
972982275 4:44720420-44720442 AAGAATAGGCTTGAAGTTGCTGG - Intronic
973838427 4:54835474-54835496 TATGAAAGCATTTAAGTTGTGGG + Intergenic
983377827 4:166952613-166952635 TAGGATTGCCTTGACGATGCGGG - Intronic
985121323 4:186645550-186645572 TAGCAAAGTATTGAAGTTGGGGG + Intronic
992605669 5:78453647-78453669 TAGGATAGCCTTGGCGATGCGGG + Intronic
992874285 5:81037396-81037418 TAGGATAGCATTGAAGTTGCCGG - Intronic
993567341 5:89491496-89491518 AAGGATGTCACTGAAGTTGCAGG - Intergenic
1005884071 6:30082063-30082085 TAGGATAGACTTGACGATGCGGG + Intergenic
1008781097 6:55106353-55106375 TAGGTTGGCAGGGAAGTTGCTGG - Intergenic
1010408150 6:75529011-75529033 TTGTCTAGCAGTGAAGTTGCAGG - Intergenic
1019167146 6:170105030-170105052 TAGGATTGCACTGAATTTACAGG + Intergenic
1022010347 7:26303239-26303261 TAAGTTAGCATTGGAGTTGGGGG + Intronic
1022234679 7:28449579-28449601 GAAGATATCATTGAGGTTGCAGG - Intronic
1023594119 7:41810790-41810812 CTGGGTAGCATTGAAGTTGCTGG - Intergenic
1028935481 7:96459275-96459297 AAGGAGAGAATTGAAGTTCCAGG + Intergenic
1030940710 7:115645684-115645706 TAGGATTGCACTGAACTTGCAGG - Intergenic
1031359429 7:120830232-120830254 TGGGATTGCATTGAATTTGTAGG - Intronic
1038177634 8:25195459-25195481 TGGGATGGCACTGAAGTTCCTGG + Intronic
1040321542 8:46310767-46310789 TAGGATTGAATTGATGATGCGGG + Intergenic
1043473895 8:80587816-80587838 CAGGATAGCACTGACGTCGCGGG - Intergenic
1046976195 8:120280728-120280750 AAGGATGGCATTGATCTTGCAGG + Exonic
1051169255 9:14302512-14302534 CAGGATAGCAATGAGGTTTCTGG + Intronic
1051747625 9:20309837-20309859 TAGAGGGGCATTGAAGTTGCAGG - Intergenic
1053611066 9:39713525-39713547 TATTATAACATTTAAGTTGCAGG + Intergenic
1054087188 9:60757633-60757655 TATTATAACATTTAAGTTGCAGG - Intergenic
1054242455 9:62628870-62628892 TATTATAACATTTAAGTTGCAGG - Intergenic
1054556581 9:66663388-66663410 TATTATAACATTTAAGTTGCAGG - Intergenic
1058596812 9:106623650-106623672 TGGGAGAAAATTGAAGTTGCTGG + Intergenic
1060445361 9:123682126-123682148 TAGGATAGCAAAGTAGATGCTGG - Intronic
1186890280 X:13953042-13953064 CAGGAAAGCAATGAAGTTGAGGG + Intergenic
1189013086 X:37066292-37066314 AAGGATAGCATTGAATCTGTAGG + Intergenic
1189019978 X:37325296-37325318 AAGGATTGCATTAAAGTTGTAGG - Intergenic
1189075825 X:37913146-37913168 TAAGCTAGCATTAAAGATGCTGG + Intronic
1189890499 X:45597263-45597285 TGAGATAGCATTTAACTTGCAGG + Intergenic
1190119197 X:47646774-47646796 TAGGATAGGATTGCAGGGGCAGG - Intronic
1192082523 X:68062149-68062171 TAGGATAGCAAGGAAATGGCAGG - Intronic
1194379044 X:93171938-93171960 TAGGATAGCTTTGAATATTCTGG - Intergenic
1196472828 X:116048367-116048389 TAGGATTGAATTGGAGATGCAGG + Intergenic
1197092387 X:122554840-122554862 CAGTTCAGCATTGAAGTTGCTGG - Intergenic