ID: 992877736

View in Genome Browser
Species Human (GRCh38)
Location 5:81074480-81074502
Sequence TATTACGTATAGAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992877736 Original CRISPR TATTACGTATAGAAAGTGGG GGG (reversed) Intronic
901278152 1:8009296-8009318 TCCTTCCTATAGAAAGTGGGAGG + Intronic
907941991 1:59096806-59096828 TTTTACAAATAAAAAGTGGGGGG - Intergenic
912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG + Intronic
912830724 1:112951223-112951245 TATTACAAATGAAAAGTGGGGGG + Intronic
912863974 1:113240343-113240365 AATTACCTATAGAAAAGGGGTGG - Intergenic
913133864 1:115868210-115868232 GATTACTTACAGAAAGTGGATGG - Intergenic
917223623 1:172758504-172758526 AATTACAGAAAGAAAGTGGGAGG - Intergenic
917867060 1:179206325-179206347 AATTGCTTATAGAAAGGGGGTGG - Intronic
918005975 1:180542593-180542615 TTTTAGGTAAAGAAAGAGGGAGG - Intergenic
921460602 1:215421685-215421707 TATTACAGTTAGAAAGTTGGGGG - Intergenic
922627522 1:227064591-227064613 TATTACCTAGAGAAAGAGGCTGG + Intronic
1068414383 10:56698583-56698605 TATTATGTATTGAAATTAGGTGG + Intergenic
1068789660 10:61013681-61013703 TATGAGTTAGAGAAAGTGGGAGG + Intergenic
1069417747 10:68216135-68216157 TTTTACGAATTGAAAGTCGGTGG + Intergenic
1075234190 10:120711615-120711637 TATTACTTATAGAAAATGAGTGG - Intergenic
1075572131 10:123553758-123553780 TATTAAGTGTTGGAAGTGGGTGG - Intergenic
1079229435 11:18636923-18636945 TATTAGGGATACAAAGTGTGGGG + Intergenic
1081628795 11:44673352-44673374 TATTTTGTTTAGAAAGGGGGGGG - Intergenic
1082754110 11:57055646-57055668 TATTATTTACAGAAAGTGTGGGG - Intergenic
1084848201 11:71917518-71917540 TATTAGGTGTAGACTGTGGGAGG - Intronic
1091890613 12:4051184-4051206 GTTTACGTAAAGAAAGTGGCAGG - Intergenic
1097639344 12:62160748-62160770 TAATGGGTATAGAACGTGGGAGG - Intronic
1105122427 13:16802871-16802893 GATTACGTATAAAAAGTAGACGG + Intergenic
1105128605 13:16903649-16903671 GATTACGTATAAAAAGTAGACGG + Intergenic
1105138583 13:17067030-17067052 GATTACGTATAAAAAGTAGACGG + Intergenic
1106879237 13:34111381-34111403 TATAACATATGGAAAGGGGGTGG - Intergenic
1120266092 14:82252562-82252584 TATTAAGTTATGAAAGTGGGTGG + Intergenic
1120738384 14:88080427-88080449 CATTATGTATACAAATTGGGAGG - Intergenic
1121170957 14:91854279-91854301 TATTTCCTATAGAAACTGGAAGG + Intronic
1124173092 15:27394998-27395020 TATTATGTTTAGAAAGTATGAGG + Intronic
1132007133 15:98237639-98237661 GATTACGTATACAAAACGGGGGG - Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1133974523 16:10591153-10591175 TTTTAAGCATGGAAAGTGGGTGG + Intergenic
1138142891 16:54583648-54583670 TATTAAGAAAAGAAAGTGGTGGG + Intergenic
1141026977 16:80558012-80558034 TTATAAGTATAGACAGTGGGAGG - Intergenic
1145221175 17:21090271-21090293 TTTTACATAAGGAAAGTGGGTGG + Intergenic
1153191493 18:2545437-2545459 TAATAAGGATAGAAAGTGGGTGG + Intronic
1159595174 18:70376260-70376282 TATGACGTTTAGATAGTGTGTGG - Intergenic
1165597786 19:37025160-37025182 TATGATGTACAGAAAGTTGGCGG + Intronic
929372052 2:41237188-41237210 TATTACTTATAGTAACTGGAAGG + Intergenic
929617193 2:43320895-43320917 TTTTAAGTATAGAAATTTGGGGG + Intronic
930055287 2:47247272-47247294 TATTAGGTATACAAAGGGGAGGG - Intergenic
933360658 2:81279452-81279474 TTTTATGTATAGAAAGTGAAAGG + Intergenic
934705733 2:96478233-96478255 TACAAAGGATAGAAAGTGGGAGG - Intergenic
935509455 2:103953048-103953070 TATTTCATAAAGAAAGTGGTAGG - Intergenic
937382490 2:121392697-121392719 TATTACTGATAGAAAGAAGGTGG - Intronic
937464123 2:122114956-122114978 TATAACCTAAAGAAAGAGGGAGG - Intergenic
938000405 2:127730189-127730211 GATTACCTCTGGAAAGTGGGTGG + Intronic
941958239 2:171227109-171227131 TTTTACCAATAGAAAGAGGGTGG - Intronic
942093638 2:172517778-172517800 TATAACTTATACACAGTGGGAGG - Intergenic
942306705 2:174615271-174615293 TATTTTGTATAGGAAGTGGGAGG - Intronic
943071719 2:183148965-183148987 GATTATCTATAGAAGGTGGGGGG - Intronic
946115239 2:217455570-217455592 TCTTAGGTATAGAAAGGAGGAGG + Intronic
946512442 2:220373461-220373483 TAAAAAGTATAAAAAGTGGGGGG - Intergenic
1169714612 20:8601120-8601142 TATTTTGTATAGACAGGGGGAGG - Intronic
1172634441 20:36400688-36400710 TTGTTCGTATGGAAAGTGGGAGG + Intronic
1179188858 21:39106757-39106779 TATTAAGTAAAGTAAGTGCGAGG - Intergenic
1181782915 22:25206032-25206054 TATTAAGCCTAGAAAGAGGGAGG - Intronic
1182871423 22:33650988-33651010 AATTATGAATACAAAGTGGGCGG + Intronic
953520937 3:43642675-43642697 AATTACCTATAGGAGGTGGGGGG - Intronic
954142368 3:48615068-48615090 TATTCATTATTGAAAGTGGGGGG + Intergenic
955241384 3:57181557-57181579 GATTACTTATAGAGAGTGAGTGG - Intergenic
961985192 3:131124502-131124524 TGTTAGGTAAAGGAAGTGGGGGG - Intronic
963080465 3:141388379-141388401 TATTATGTATATAATTTGGGGGG + Intronic
963299278 3:143580908-143580930 TAATAGGTATAGGAAGTGGGAGG + Intronic
966509631 3:180747482-180747504 TATTATGTGTAGTAAGTGGTAGG - Intronic
972698312 4:41469355-41469377 TATTACTGATTGAAAGAGGGAGG - Intronic
975031442 4:69622948-69622970 TATGACCCATAGCAAGTGGGTGG - Intronic
976123638 4:81809865-81809887 AAATATGTATAGAAAATGGGCGG - Intronic
990147439 5:52778558-52778580 TATAACCTAAACAAAGTGGGGGG - Intergenic
990795982 5:59541582-59541604 TATTCCCTATATAAAGGGGGAGG - Intronic
992510420 5:77427490-77427512 TATTACGTATAGATGGTGCATGG - Exonic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994854311 5:105097722-105097744 TATTACTGTTAGAAAGTGTGAGG - Intergenic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
999396737 5:151234261-151234283 TTTTACATTTAAAAAGTGGGGGG - Intronic
1001003178 5:168026949-168026971 TATTTCATGTAGAAATTGGGAGG - Intronic
1002567043 5:180118109-180118131 TATTACGTTTAGAATCAGGGAGG + Intronic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1009437888 6:63638239-63638261 TATTACTTATAAAAGTTGGGAGG + Intronic
1010626207 6:78138761-78138783 TATAACTTATACACAGTGGGAGG - Intergenic
1011704981 6:89992114-89992136 GATTACCTATAGAAAGTAGGTGG - Intronic
1012747188 6:103106478-103106500 TATATGGTATAGAAAGTGGAAGG - Intergenic
1016469581 6:144361206-144361228 TATGGTGTAAAGAAAGTGGGTGG - Intronic
1022565562 7:31397159-31397181 AATTAAGTATGGAAAGTAGGAGG - Intergenic
1023396479 7:39756536-39756558 TAATAGATATAGAAAGTAGGAGG + Intergenic
1024293078 7:47820361-47820383 TACTACTTATAGAAAGAAGGAGG + Intronic
1028715906 7:93968009-93968031 TATTACGTTAAGAAAATGGAAGG - Intronic
1033187253 7:139239166-139239188 TAATATGTATAAAAAGGGGGTGG - Intronic
1034678948 7:152913488-152913510 CATTATGTATAGAAAGGGGCAGG + Intergenic
1040406001 8:47102799-47102821 TATTACGTTTAGAAAGTTTCTGG - Intergenic
1041527262 8:58821296-58821318 TAGTAGGTATAGAAAGGAGGGGG - Intronic
1042036300 8:64538162-64538184 TATTAGGTAAAGAAAGAGAGGGG - Intergenic
1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG + Intronic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045584196 8:103513025-103513047 TATAAGATATAGAAAGTGGCAGG + Intronic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1048739034 8:137533652-137533674 TTTTATGTATAGAAAGTGTTTGG + Intergenic
1048799552 8:138183320-138183342 GATTACAGATAGTAAGTGGGAGG + Intronic
1048936273 8:139359786-139359808 TACTACTTATATAAAGTGTGTGG + Intergenic
1050117118 9:2274681-2274703 TATTATATTTAAAAAGTGGGTGG + Intergenic
1051171238 9:14319719-14319741 TATTAAGTATAAAAAGTGCATGG + Intronic
1051566552 9:18505723-18505745 TGTTATGTATAGCAAGTAGGAGG + Intronic
1053099202 9:35355595-35355617 TATTAAGAATAGAAAGTGCAAGG - Intronic
1055344380 9:75319294-75319316 TATTACCTATATAAGATGGGTGG - Intergenic
1055694366 9:78867794-78867816 TTTTACATATGTAAAGTGGGTGG - Intergenic
1190170963 X:48111273-48111295 TATTACGCATGAAAAGTGAGAGG - Intergenic
1190181190 X:48194189-48194211 TATTACGCATGAAAGGTGGGAGG + Exonic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic