ID: 992877796

View in Genome Browser
Species Human (GRCh38)
Location 5:81075119-81075141
Sequence TACTGAAATAGCTACCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992877796_992877801 29 Left 992877796 5:81075119-81075141 CCTGTTAGGTAGCTATTTCAGTA 0: 1
1: 0
2: 4
3: 52
4: 279
Right 992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 95
992877796_992877800 22 Left 992877796 5:81075119-81075141 CCTGTTAGGTAGCTATTTCAGTA 0: 1
1: 0
2: 4
3: 52
4: 279
Right 992877800 5:81075164-81075186 ATGGAGGCAGTATAAGTAGTTGG No data
992877796_992877798 3 Left 992877796 5:81075119-81075141 CCTGTTAGGTAGCTATTTCAGTA 0: 1
1: 0
2: 4
3: 52
4: 279
Right 992877798 5:81075145-81075167 CAAGTAAGAGATGATTATAATGG 0: 1
1: 0
2: 3
3: 16
4: 286
992877796_992877802 30 Left 992877796 5:81075119-81075141 CCTGTTAGGTAGCTATTTCAGTA 0: 1
1: 0
2: 4
3: 52
4: 279
Right 992877802 5:81075172-81075194 AGTATAAGTAGTTGGATTCTGGG 0: 1
1: 0
2: 3
3: 7
4: 129
992877796_992877799 6 Left 992877796 5:81075119-81075141 CCTGTTAGGTAGCTATTTCAGTA 0: 1
1: 0
2: 4
3: 52
4: 279
Right 992877799 5:81075148-81075170 GTAAGAGATGATTATAATGGAGG 0: 1
1: 0
2: 0
3: 18
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992877796 Original CRISPR TACTGAAATAGCTACCTAAC AGG (reversed) Intronic
901223128 1:7595389-7595411 AACTGAAATAGCTTTCTAAAAGG - Intronic
902903212 1:19534531-19534553 TACTGCAGTAGCTTCCTAACTGG + Intergenic
903511584 1:23879771-23879793 TATTGCAATAGCTTCCTAACTGG + Intronic
904989412 1:34579581-34579603 AACTGCAATAGCCTCCTAACTGG + Intergenic
905000272 1:34662544-34662566 TACTGCAACAGCCCCCTAACAGG + Intergenic
906112706 1:43335055-43335077 TACTGTAATAGCTTCCTAACTGG - Intergenic
906300211 1:44676017-44676039 TACTGAAACAACCTCCTAACTGG - Intronic
906812108 1:48838019-48838041 TACTGTAATAGCTGCCTACTTGG - Intronic
906844688 1:49179214-49179236 TACTGCAATAGCCTCCTTACTGG - Intronic
907006035 1:50914924-50914946 TTCTGCAATAGTTTCCTAACTGG + Intronic
909387713 1:75078849-75078871 TATTGAAACAGCTTTCTAACTGG + Intergenic
909575357 1:77170027-77170049 TGCTGGAATAGCTCCCTACCTGG + Intronic
909669576 1:78172937-78172959 CACTGTAATAGCGTCCTAACTGG + Intergenic
909818890 1:80033123-80033145 TACTGCAATAGCTTCCAAACTGG + Intergenic
910402379 1:86850172-86850194 TACTGAAATAGCCTCCAAACTGG + Intergenic
911601012 1:99848511-99848533 AACTAAAATAGCTTTCTAACTGG + Intergenic
911674108 1:100639320-100639342 TACTGCACCAGCTTCCTAACTGG - Intergenic
911870174 1:103087320-103087342 TACTAAAATAGCCACTTAACTGG + Intronic
911886157 1:103302168-103302190 TACTGAAGTCACTTCCTAACTGG + Intergenic
914238022 1:145830323-145830345 TACTACAATAGCCTCCTAACTGG - Intronic
914699679 1:150120267-150120289 TGCTAAAATTGCTACCTGACGGG - Intronic
915538557 1:156552691-156552713 TACTCCAATAGCTGTCTAACAGG + Intronic
915958348 1:160242440-160242462 GACTGAAACACCAACCTAACAGG + Intronic
915960790 1:160264850-160264872 TTCTGCAATAGCTTCCTAACTGG - Intergenic
916129736 1:161602327-161602349 TACTGCAATAGCCTCCTGACTGG + Intronic
916560610 1:165931435-165931457 TTCTGTAATAGCTTCATAACTGG + Intergenic
917127140 1:171697000-171697022 TACTGCAGTAGCTTTCTAACTGG - Intergenic
917704526 1:177618606-177618628 TAGTGCAATAACTTCCTAACTGG - Intergenic
917880956 1:179335321-179335343 TTCAGAAACAGCTACCTAAAAGG - Intronic
918326165 1:183412587-183412609 TATTGCAATAGCTTCTTAACTGG - Intronic
918425685 1:184407365-184407387 AAATGAAATAGGTACCTAAATGG + Intronic
919116626 1:193287922-193287944 CATTGCAATAGCTACCTTACTGG + Intergenic
919873681 1:201844801-201844823 TACTGAAATAGCCATCCAAAGGG - Intronic
920293698 1:204942680-204942702 TACTGCAACAGCTTCCTAAGTGG - Intronic
921881634 1:220261449-220261471 TACTGCAATAGCCTCCTAACTGG + Intronic
922087271 1:222362847-222362869 TACTGCAAGAGCCTCCTAACAGG - Intergenic
922883105 1:228997499-228997521 TACTGCAATACCCTCCTAACTGG + Intergenic
923428209 1:233892752-233892774 TACTGAAGTAGAATCCTAACTGG - Intergenic
924358316 1:243208244-243208266 TACTGCAATAGCCTCCTAACTGG + Intronic
1065348250 10:24770111-24770133 CACAGAAATAGGAACCTAACAGG + Intergenic
1065388900 10:25162026-25162048 TACTTCAACAGCTTCCTAACTGG + Intergenic
1066020114 10:31290130-31290152 TACTGAAATAAGTAACTAGCAGG + Intergenic
1066600521 10:37101127-37101149 TACTGCATTAGATTCCTAACTGG - Intergenic
1067740021 10:48888459-48888481 CACTGAAATAGCAACACAACGGG + Intronic
1068696494 10:59973018-59973040 TGCTGCAATAGCCTCCTAACTGG - Intergenic
1068960619 10:62863203-62863225 TATTGCAATAGCTGCCCAACTGG + Intronic
1071411969 10:85406026-85406048 TACTGCAATAGCTTCCTAATTGG + Intergenic
1072776156 10:98196705-98196727 TGCTGCAATAACTTCCTAACAGG + Intronic
1072835405 10:98706073-98706095 TACAGAAATATCTACCTTACTGG - Intronic
1072968394 10:99994831-99994853 TCCTGCAATAGCTTCCTAAATGG + Intronic
1073018410 10:100420492-100420514 TACCGAAATACCTTCCTAACTGG - Intergenic
1075884439 10:125885840-125885862 TACTGCAATAGCCTCCTAACCGG + Intronic
1077976848 11:7255498-7255520 TTCTGAAATAGCTTCCTAAGTGG - Intronic
1078118906 11:8486068-8486090 TACTGCAAGAGTTTCCTAACTGG + Intronic
1079546054 11:21633207-21633229 TACTGCAACAGCCTCCTAACTGG + Intergenic
1079638725 11:22777913-22777935 AACTGAAATAGCCTCCTAATTGG - Intronic
1079884595 11:25971323-25971345 TACCAAAAGATCTACCTAACTGG - Intergenic
1079992920 11:27265811-27265833 CACTGCAATAGCCTCCTAACAGG - Intergenic
1080682694 11:34491000-34491022 TACTGCAATACCTACCGAGCTGG + Intronic
1082757625 11:57093375-57093397 TACTGAAACAGCCTCCTAACTGG + Intergenic
1082770520 11:57204118-57204140 CACTGCAATAGCCTCCTAACTGG + Intergenic
1082773110 11:57224079-57224101 CTCTGAAGTAGCTTCCTAACCGG + Intergenic
1085376865 11:76071655-76071677 TTCTGAAATAGCCTTCTAACTGG - Intronic
1086773502 11:90799120-90799142 CAATGAAATAGCTTCCTAAATGG - Intergenic
1087849504 11:103011863-103011885 TATTGCAATAGATTCCTAACTGG + Intergenic
1088964376 11:114703215-114703237 TACAGAAAAAGCTCCCTAACTGG - Intronic
1090214852 11:124952995-124953017 TATTGCAATAGCCACCTAATTGG + Intergenic
1091072798 11:132584548-132584570 TACAGAACTAGCTAGTTAACTGG + Intronic
1091089117 11:132752957-132752979 TACTGCAATAGCTGCCTTACTGG + Intronic
1092116758 12:6014405-6014427 TATTGAAATAGCTGTCTAACTGG - Intronic
1092955403 12:13544828-13544850 TATTGCAAGAGCTTCCTAACCGG + Exonic
1093264665 12:16988880-16988902 TACTGCAATAGCATCCTAACTGG - Intergenic
1093314613 12:17632782-17632804 CACTGTAATAGCCTCCTAACTGG + Intergenic
1093551025 12:20411591-20411613 TACTGAAATAATGTCCTAACAGG + Intronic
1094055525 12:26265611-26265633 TACTGCAATAGCATCTTAACTGG - Intronic
1094564490 12:31587859-31587881 TACTGAAAGAGCTCCCTAACTGG + Intronic
1095335971 12:41026854-41026876 TGCTGAAATAGTCTCCTAACTGG - Intronic
1095619574 12:44234669-44234691 TACTGAAATAATTACTTCACAGG + Intronic
1097516274 12:60610983-60611005 TAATGAACTAACTATCTAACTGG - Intergenic
1098720527 12:73891977-73891999 GACTGCAATAGCCACCTAACTGG + Intergenic
1098846579 12:75544416-75544438 TATTAAAACAGCTTCCTAACTGG - Intergenic
1100004027 12:89872598-89872620 TCCTGCAATAGCCTCCTAACTGG - Intergenic
1100012798 12:89973411-89973433 TATTTAAATAGATACCTAATTGG - Intergenic
1100321164 12:93494299-93494321 TGTTGAAATAACTTCCTAACTGG - Intronic
1100411946 12:94327805-94327827 TACTATAACAGCTTCCTAACTGG + Intronic
1100609632 12:96180628-96180650 TCCTGGAATAGCTACTTCACTGG + Intergenic
1101451328 12:104781671-104781693 TATTGCAATAGCCACCTCACTGG - Intergenic
1101714796 12:107301327-107301349 TATTGAAGTAGCCTCCTAACTGG + Intergenic
1101796749 12:107982133-107982155 GACTGAAACAGCATCCTAACTGG + Intergenic
1105057467 12:133115703-133115725 TATTGCAATAGCCTCCTAACTGG - Exonic
1107140737 13:36996189-36996211 TACTGAAGTATCTAACTTACAGG + Intronic
1107761885 13:43688305-43688327 TACTGAAATAGCATCCTAAGTGG - Intronic
1107898270 13:44987741-44987763 AACTACAATAGCTTCCTAACCGG + Intronic
1108867399 13:54939656-54939678 GACCGAACTAGCTACCTAATGGG + Intergenic
1109213776 13:59564418-59564440 TACTTAAAGAGCTACATAATCGG - Intergenic
1110211530 13:72979525-72979547 TACTGGAATAGCTTCCTAAGAGG - Intronic
1110361358 13:74629341-74629363 AACTGAAATGGCATCCTAACTGG - Intergenic
1111685712 13:91498699-91498721 AACTGCAATAGCTTTCTAACTGG - Intronic
1114953227 14:27783336-27783358 TACAGTAAAAGCTACCTAAGTGG + Intergenic
1114963865 14:27931822-27931844 TACTACAACATCTACCTAACTGG + Intergenic
1115365307 14:32550878-32550900 TACTGCAGTAGCCTCCTAACTGG + Intronic
1116427186 14:44805673-44805695 AACTGAAATAGCTTCCTAACTGG - Intergenic
1118033156 14:61838196-61838218 TATTGAATTAACTACCTGACTGG + Intergenic
1118353430 14:64990794-64990816 TACTGCAATAGCCTCCTAACTGG - Intronic
1123475557 15:20590511-20590533 TGCTGAAATATCTATATAACAGG - Intergenic
1123642454 15:22409852-22409874 TGCTGAAATATCTATATAACAGG + Intergenic
1123737284 15:23197700-23197722 TATTGCAAAAGCTCCCTAACTGG - Intergenic
1124288501 15:28426362-28426384 TATTGCAAAAGCTCCCTAACTGG - Intergenic
1124294725 15:28490952-28490974 TATTGCAAAAGCTCCCTAACTGG + Intergenic
1125729421 15:41884544-41884566 TACTGCAATAGCTTTGTAACTGG + Intronic
1126804100 15:52328570-52328592 TGCTGCAATAGCTCCCTAACTGG + Intronic
1129569757 15:76668242-76668264 TACTGCAATAGCCTCTTAACTGG + Intronic
1130747862 15:86675338-86675360 CACTGCAACAGCCACCTAACAGG - Intronic
1130920118 15:88336713-88336735 CACTGAAATGGCCTCCTAACTGG - Intergenic
1134353903 16:13463247-13463269 TATTGCAATAGCTTCCTCACGGG - Intergenic
1135209800 16:20515309-20515331 TAGGGAATTAGCTACATAACAGG - Intergenic
1135744208 16:25002393-25002415 TACTGCAGTAGCTTCCTATCTGG + Intronic
1135752415 16:25067519-25067541 TACTGCAGTAGCTTCCTATCTGG - Intergenic
1135802352 16:25509681-25509703 TACTGCAACAGCTTCCTATCTGG + Intergenic
1138058817 16:53865703-53865725 TACTGCAACAGCTTCCTGACTGG + Intronic
1139790416 16:69429593-69429615 TACTAAAACAGCCTCCTAACTGG - Intronic
1140711669 16:77684307-77684329 TACTGAAAAAGCCAGCAAACAGG - Intergenic
1140833364 16:78771288-78771310 CACTGTGATAGCTTCCTAACTGG - Intronic
1140981735 16:80116541-80116563 CACAGAAAAAGATACCTAACAGG - Intergenic
1144285060 17:13766119-13766141 AACTGTAATAGCTGCCCAACAGG - Intergenic
1146318996 17:31831836-31831858 TACTGGAATAGCTTCCTATTTGG - Intergenic
1146418105 17:32655825-32655847 TTCGGAAATAGCCATCTAACAGG - Intronic
1148250365 17:46073528-46073550 TACTGAAATTGCTAACCTACAGG + Intronic
1149068289 17:52506784-52506806 TATTCCATTAGCTACCTAACTGG + Intergenic
1151659519 17:75511509-75511531 TATTGAAATACCTATCTCACAGG + Intronic
1153121678 18:1735423-1735445 TACTCAAATATCTACCTAGATGG + Intergenic
1154069011 18:11135925-11135947 TACTGGAATAGATAACCAACTGG + Intronic
1156226914 18:35118579-35118601 TACTGCAGTAGCCACCTAGCTGG + Intronic
1157086775 18:44588545-44588567 TAATGAAATAGTCTCCTAACTGG + Intergenic
1158191352 18:54832149-54832171 TACTGGAATAGCCTCCTAACTGG - Intronic
1159500456 18:69262266-69262288 TACTGGGTTAGCTTCCTAACTGG + Intergenic
1159615355 18:70573381-70573403 TATTGAAATAGCCTCCTCACAGG + Intergenic
1162810165 19:13159374-13159396 CACTGCAATATCTTCCTAACAGG + Intergenic
1164935868 19:32211325-32211347 TACTGAAAGAACTGCCTACCCGG + Intergenic
1167530246 19:50011445-50011467 TACTGGAATGGCCTCCTAACTGG + Intronic
925842871 2:8008809-8008831 TAATGAAATAGGTAACTACCAGG - Intergenic
926283418 2:11468513-11468535 TCTTGAAATAGCTGCCTCACAGG - Intergenic
927777356 2:25912515-25912537 TACTGCAAGAGCCTCCTAACTGG - Intergenic
928753674 2:34498833-34498855 TATTGCAATAGCCACTTAACTGG - Intergenic
929424161 2:41826998-41827020 ATCTGCAATAGCTACCTAACTGG + Intergenic
929642284 2:43594117-43594139 TCCTGAAACAGCTCCCTAACTGG + Intronic
932048312 2:68372770-68372792 AAGTGAAATAGCTAGCTAAGTGG + Intronic
932230374 2:70078895-70078917 TACTGGAATAGCTTTCTAAGTGG - Intergenic
934883023 2:97999643-97999665 TTCTGCAAGAGCTTCCTAACAGG + Intergenic
935034657 2:99357989-99358011 TACTACAAAAGCTTCCTAACTGG + Intronic
936341848 2:111640713-111640735 GACAGCAATAGTTACCTAACAGG - Intergenic
936803995 2:116303394-116303416 TACTGAAATTTCTGCCTAAAAGG - Intergenic
939429508 2:142084707-142084729 TACTGTAATAGTTACCTAATTGG + Intronic
940247444 2:151634817-151634839 AACTGACATAGCAACCCAACTGG + Intronic
942087330 2:172455619-172455641 TACTGAAATAGTTTCCTTCCAGG + Intronic
942442724 2:176052790-176052812 TAAGGGAATAGCTACCAAACTGG + Intergenic
942897054 2:181069810-181069832 TACTGCATTAGCCTCCTAACTGG - Intronic
945712511 2:213316401-213316423 TACTGCAATAGCCTGCTAACTGG + Intronic
946211402 2:218150169-218150191 GACTGAAATAACCTCCTAACTGG + Intergenic
947981649 2:234415527-234415549 TACTGAAGTGGCTTCCTACCCGG - Intergenic
1169265757 20:4166557-4166579 TACTCAACTAGAAACCTAACTGG - Intronic
1169735204 20:8830452-8830474 TACAGAAGTAGCCTCCTAACAGG - Intronic
1169774145 20:9233974-9233996 TAATCCAATAGCTACCTAACTGG - Intronic
1172473427 20:35218575-35218597 TATTGTAATAGCCTCCTAACTGG + Intergenic
1174565840 20:51463927-51463949 GATTGAAATAGTTACCTACCCGG - Intronic
1174888849 20:54367603-54367625 TAAAGAAATAGATAACTAACAGG + Intergenic
1175047190 20:56118207-56118229 AACTGCAACAGCTTCCTAACTGG - Intergenic
1177660544 21:24077196-24077218 TACTTCAATAGCTGTCTAACTGG + Intergenic
1178824794 21:36005900-36005922 TATAGAAAGAGCAACCTAACAGG + Intergenic
1178926385 21:36778789-36778811 TACTCAAATAGCCACATATCTGG + Intronic
1179315497 21:40240327-40240349 TACTGCAGTAGCTTCCTCACTGG + Intronic
1180568180 22:16692894-16692916 TATTGAAATAGCTGTCTAACTGG - Intergenic
1182390522 22:29991048-29991070 TATTGAAATTACTACCTAACTGG + Intronic
1183566576 22:38619741-38619763 TACTGCAGTAGGCACCTAACTGG - Intronic
1184986984 22:48142450-48142472 TAGTGGAATAGTTACCTAAGTGG + Intergenic
950828784 3:15854002-15854024 TACAGCAGTAGCTACCTAACTGG + Intronic
950913425 3:16618134-16618156 TACTGAAATGGCTACCAGAGGGG - Intronic
951179738 3:19645107-19645129 TACTACATTAGCTTCCTAACTGG - Intergenic
951303339 3:21026039-21026061 TATTGCAATAGCTTCCTAATTGG + Intergenic
955841516 3:63117762-63117784 TCTTGAAATAGCTTCCTAACTGG - Intergenic
955962681 3:64357164-64357186 TAATGATATACCTACCTCACAGG + Intronic
956107235 3:65832738-65832760 TACTGAAATGACTACCCATCAGG + Intronic
956450666 3:69371570-69371592 TGTTGCAATAGCTTCCTAACTGG - Intronic
957627769 3:82676793-82676815 TATAGAAATAGCCATCTAACTGG + Intergenic
958144463 3:89605879-89605901 TACTGAAACAGTATCCTAACAGG - Intergenic
959055984 3:101568088-101568110 TACTGCAATAGCCTCCTAACTGG - Intergenic
959610172 3:108285110-108285132 AACTGAAATGGCTAGCAAACTGG + Intergenic
959659614 3:108852002-108852024 AATTGTAATAGCTGCCTAACTGG - Intronic
959755184 3:109888783-109888805 GATTGCAATATCTACCTAACTGG + Intergenic
960173699 3:114492603-114492625 TACTGGAATAGCTCCCTCACTGG + Intronic
960611035 3:119554879-119554901 TACTGAAATAACCTCCTAATAGG + Intronic
960649120 3:119926497-119926519 TACTGTAATATCTTCCTAAATGG + Intronic
960676288 3:120198561-120198583 TATTGCAATAGCCTCCTAACTGG + Intronic
961014186 3:123454784-123454806 TTCTGCAATAGCTTCCTGACTGG - Intergenic
962886168 3:139629912-139629934 AACTGATATAGGTACCTAGCAGG - Intronic
963492071 3:146015013-146015035 TAGTTAAATAGCTATGTAACTGG - Intergenic
964507671 3:157417395-157417417 AGCTGAAAAAGCTACCAAACTGG + Intronic
964631208 3:158812621-158812643 TATTGCTATAGCTCCCTAACTGG + Intronic
965056083 3:163718186-163718208 GACTGAAATATCTACCACACTGG + Intergenic
965540448 3:169866213-169866235 CACAGCAATAGCTTCCTAACTGG - Intronic
965676737 3:171205602-171205624 TACTAAAACAGTTTCCTAACTGG + Intronic
965824279 3:172714857-172714879 TACTGCAAAAGCCACCTGACAGG - Intergenic
967069189 3:185947160-185947182 AAATGCAATAGCTTCCTAACTGG - Intergenic
967501827 3:190206369-190206391 GACTGAAACAGCCTCCTAACTGG + Intergenic
968769763 4:2497269-2497291 TTCTGAAATAGCTTCTCAACTGG + Intronic
970232982 4:13929754-13929776 TTTTGAAATAGGTTCCTAACTGG + Intergenic
971813373 4:31456600-31456622 TACTGAAAAAGCCTCCTAATTGG - Intergenic
972724270 4:41732574-41732596 TACTGTAATACTTACCAAACGGG + Intergenic
972732903 4:41812719-41812741 CACTGCCATAGCTCCCTAACTGG + Intergenic
972797878 4:42440237-42440259 TACTGGAATAGCCTCCTAAGCGG + Intronic
973037882 4:45429644-45429666 TACTTAAGTATCTACCTGACAGG - Intergenic
973958657 4:56088268-56088290 GACTGAAAAAACTACCTATCAGG - Intergenic
973994185 4:56439944-56439966 TACTGCAACAGCATCCTAACTGG + Intronic
974551553 4:63381192-63381214 TACTGCAATAGTCACTTAACTGG + Intergenic
974700965 4:65445989-65446011 TCCTGAAATAACATCCTAACTGG + Intronic
975365706 4:73525011-73525033 TACTGAAATAGGTACTGAAAAGG - Intergenic
977152482 4:93530167-93530189 TACAGAAATAACTAACTAATTGG + Intronic
979099205 4:116593876-116593898 TATTGATATAGCTACCTACATGG + Intergenic
979243500 4:118471274-118471296 TACTGCAATAGCCTCCTAACTGG - Intergenic
979819670 4:125155112-125155134 CACTGAAATAGCATCCTAACTGG + Intergenic
980868766 4:138586077-138586099 TATTGCAGTAGCTTCCTAACTGG - Intergenic
981065027 4:140474294-140474316 GACAGTAATAGCTACCTCACAGG + Intronic
981105130 4:140872541-140872563 TTCTGTAATAGTTTCCTAACTGG - Intronic
984979354 4:185263343-185263365 TATTGAAATATCAACCTAGCTGG + Intronic
985019696 4:185674445-185674467 GACTGCAGTAGTTACCTAACTGG + Intronic
986763389 5:10900328-10900350 AACTGAACTAGCTTCCTAATTGG - Intergenic
988206222 5:28138914-28138936 TAATGAAATAGATAAATAACTGG - Intergenic
988417614 5:30965984-30966006 TTCTGAAATAGCTATATATCTGG - Intergenic
989165274 5:38427458-38427480 TTCTCAAATAACTACCCAACAGG + Intronic
990509627 5:56478750-56478772 TGCTAAAATAGCTACCTATCAGG - Intronic
990816072 5:59786427-59786449 TCCTGAAACAGCTAATTAACAGG + Intronic
991080637 5:62595238-62595260 TACTTTAACAGCTACCTAAATGG - Intronic
992040391 5:72825158-72825180 TACTGAAATAGGTTACTACCTGG + Intronic
992877796 5:81075119-81075141 TACTGAAATAGCTACCTAACAGG - Intronic
993316664 5:86415908-86415930 TACTGAAATAGCTACAGATATGG + Intergenic
993645841 5:90460294-90460316 TACTGAAGTCGCTATTTAACAGG + Exonic
994260742 5:97655681-97655703 TATTGCAATAACTTCCTAACTGG + Intergenic
996518838 5:124403423-124403445 TATTGCAGTAGCTTCCTAACTGG + Intergenic
996932683 5:128909078-128909100 TAGTGCAATAGCTTCCTAACTGG + Intronic
997091299 5:130861998-130862020 TACTTAAATAGCTAACAAATCGG + Intergenic
997488658 5:134253932-134253954 TACTGCAATAGCCACCCAACTGG + Intergenic
998050052 5:139024666-139024688 TACTGCAATAGCCTCCTATCTGG + Intronic
998635438 5:143949528-143949550 TACTGCAATAGCATCCTCACTGG + Intergenic
998900391 5:146847132-146847154 GACTGAAGTAACTTCCTAACTGG + Intronic
999536416 5:152522532-152522554 TACTGCAATAGCTTTCTAACAGG + Intergenic
1000875306 5:166630206-166630228 TACTGAAATAATTAATTAACAGG - Intergenic
1001136969 5:169110751-169110773 TATTGTAATAGCTTCCTAACGGG + Intronic
1003983135 6:11408323-11408345 TACTGCAGTAGCATCCTAACTGG - Intergenic
1004311505 6:14549875-14549897 TACAGAAACAGCTACCCACCTGG - Intergenic
1005049712 6:21673503-21673525 AACTGAAACAGCTTCCTAAATGG - Intergenic
1005131308 6:22511610-22511632 TACTGAAATAACCATGTAACTGG + Intergenic
1005210234 6:23452312-23452334 TACTAGAGTAGCTTCCTAACTGG + Intergenic
1006604746 6:35248188-35248210 TACTGTAGTAGCCTCCTAACTGG - Intronic
1007333759 6:41136283-41136305 TACTGCATTAGCCTCCTAACTGG - Intergenic
1008021863 6:46588014-46588036 TACTGAAAGAGATAACTTACAGG + Exonic
1008374963 6:50781093-50781115 TACTGCAGTAGCCTCCTAACTGG + Intergenic
1008744148 6:54648044-54648066 TAATGGAATAACTATCTAACAGG + Intergenic
1008854523 6:56065903-56065925 TACTGCAATATCTTCCTAACTGG - Intronic
1011013380 6:82727076-82727098 TGTTGTAATAGCGACCTAACTGG - Intergenic
1011423505 6:87200916-87200938 TACTGAAATAACTACTGCACTGG + Intronic
1011765738 6:90617545-90617567 TACTGAAATAGCTTCTTGAGTGG + Intergenic
1012290335 6:97447820-97447842 TACTGAACCAGCCTCCTAACTGG + Intergenic
1012581465 6:100875119-100875141 TATTGAAATAACTTCCCAACTGG - Intronic
1012594321 6:101022840-101022862 AACTGCAATAGATACCTAGCTGG - Intergenic
1013854026 6:114550265-114550287 TACTGAAAAATCTACTTAACCGG + Intergenic
1014855059 6:126390223-126390245 TACTGCAATAGCTTGCTAACTGG + Intergenic
1018604194 6:165579604-165579626 TACTCCAATAGCTTTCTAACTGG + Intronic
1019265083 7:110670-110692 TAATGAAGTGGCTACCTTACTGG - Intergenic
1020801549 7:12738823-12738845 TACTGCAAAAGCTACCTGACTGG + Intergenic
1022371636 7:29777087-29777109 TACTGCAATAGCCTCCCAACTGG - Intergenic
1022551584 7:31245052-31245074 TATTGCACTAGCTTCCTAACTGG + Intergenic
1023704703 7:42929588-42929610 AACTGAAATAGCCTTCTAACTGG + Intronic
1023972954 7:45005110-45005132 CACTGCAATAGCTACCCAAGAGG - Intronic
1027447913 7:78296064-78296086 TACTCTAATAGCTTCCTAACTGG + Intronic
1028573660 7:92320720-92320742 TACTGTAATAGTTTCCTTACTGG + Intronic
1029970359 7:104782550-104782572 TACTGCAATGCCTTCCTAACTGG + Intronic
1030136187 7:106252261-106252283 TACTCAAATAATTGCCTAACAGG + Intronic
1030945244 7:115711284-115711306 CACTGCAATAGCTTTCTAACCGG + Intergenic
1031052937 7:116963439-116963461 TACTGCTACAGCTAACTAACTGG - Intronic
1031271509 7:119655568-119655590 TCTCTAAATAGCTACCTAACTGG - Intergenic
1031530611 7:122871772-122871794 TAATGAAAGAGCTACTTAACAGG - Intronic
1032661511 7:133989029-133989051 TACTGCAATAGTTACCTGACTGG - Intronic
1033297949 7:140158290-140158312 TATTGAAGTAGCCTCCTAACTGG - Intronic
1033667349 7:143454257-143454279 TATTGCAATGGCTTCCTAACTGG + Intergenic
1033932212 7:146538065-146538087 TACTCTAATAGCCTCCTAACTGG - Intronic
1034609715 7:152354992-152355014 TGCTGCAATAGCTTCCTAACTGG - Intronic
1036036570 8:5026823-5026845 TACTGCAATAGTTTTCTAACTGG + Intergenic
1036467437 8:9013938-9013960 TACTGCATTCGCCACCTAACTGG + Intronic
1037323926 8:17669954-17669976 TACTGCAACAGCTACCCAATGGG - Intronic
1037500157 8:19477747-19477769 TAATACAATAGCTACCTCACAGG + Intronic
1037647321 8:20804357-20804379 CACTGCAACAGCTTCCTAACTGG - Intergenic
1037924058 8:22830828-22830850 TACTGGAATAGCCTCCTAACTGG + Intronic
1042617529 8:70666656-70666678 TACTGTAATAGCCTCCTAATTGG - Intronic
1042795001 8:72652378-72652400 TACTGCAAGAGCTATCTACCTGG + Intronic
1042960288 8:74295994-74296016 TACTGAGATTGCTACATACCAGG - Intronic
1043230218 8:77790746-77790768 TACAGAAATAGGTACTTAAGTGG - Intergenic
1043538219 8:81229600-81229622 GACTGCAATAGCTTCCTAACTGG + Intergenic
1044435473 8:92157491-92157513 TACTGCAATAGCTTCCTAACTGG + Intergenic
1044747957 8:95389401-95389423 TTCTGTAACAGCTTCCTAACTGG - Intergenic
1045566102 8:103317454-103317476 TACTAAAATGGCCTCCTAACAGG - Intronic
1046455864 8:114460169-114460191 AACTGAAAAAGCTTCCAAACTGG - Intergenic
1047689618 8:127338436-127338458 TCCTGAAATAGCTTCATATCTGG - Intergenic
1053650570 9:40164620-40164642 TACTGCTATAGCCGCCTAACTGG + Intergenic
1053755168 9:41299304-41299326 TACTGCTATAGCCGCCTAACTGG - Intergenic
1054331080 9:63756391-63756413 TACTGCTATAGCCGCCTAACTGG + Intergenic
1054534013 9:66211582-66211604 TACTGCTATAGCCGCCTAACTGG - Intergenic
1054891445 9:70256839-70256861 TACTGCAATAGCTTTCTAAGTGG + Intergenic
1055391112 9:75822710-75822732 CACTGCAATAGCCTCCTAACTGG + Intergenic
1055760137 9:79598289-79598311 TAATGCAATAGCCTCCTAACTGG + Intronic
1056021587 9:82443579-82443601 TTCTTAAATAGTTACATAACTGG - Intergenic
1058445454 9:105050940-105050962 TGCTGAAACAGTCACCTAACTGG + Intergenic
1058648645 9:107154511-107154533 GACTGCAATTCCTACCTAACGGG - Intergenic
1058957711 9:109964398-109964420 TCCTGCAATAGCTCCCTCACTGG - Intronic
1060702275 9:125766290-125766312 AACTGCCATAGCTACCTACCTGG + Intronic
1202798454 9_KI270719v1_random:149311-149333 TACTGCTATAGCCGCCTAACTGG + Intergenic
1187731786 X:22262905-22262927 TACTGCAATGGCCTCCTAACTGG - Intergenic
1189771183 X:44429379-44429401 GATTGCAATAGGTACCTAACTGG + Intergenic
1191645111 X:63471644-63471666 TACTGAAATTGCAACATAATTGG + Intergenic
1192656422 X:72999615-72999637 TACTGCAAGAGCCTCCTAACTGG + Intergenic
1192665698 X:73083386-73083408 TACTGCAAGAGCCTCCTAACTGG - Intergenic
1192743199 X:73913375-73913397 AACTGAAATAGCTGCCTGAGTGG + Intergenic
1193213496 X:78836075-78836097 TACTGTAAAATCGACCTAACAGG - Intergenic
1193961834 X:87935784-87935806 TACCGCAATAGCTTCCTAATTGG - Intergenic
1195573026 X:106417642-106417664 TATTGCAGTAGCTTCCTAACTGG - Intergenic
1195940424 X:110163022-110163044 TATTGCAACAGCCACCTAACTGG + Intronic
1196380937 X:115088629-115088651 TGCTGCAATAGCCTCCTAACTGG - Intergenic
1196768122 X:119268126-119268148 TACTGCAACAGCCTCCTAACTGG + Intergenic
1197622273 X:128764015-128764037 TACTAGCATAGCTTCCTAACTGG + Intergenic
1197632786 X:128881415-128881437 TACTGAAATAGCCTCTTAAATGG + Intergenic
1198486458 X:137092361-137092383 AACTGCAATCGCTTCCTAACTGG + Intergenic
1198568541 X:137931356-137931378 TACTGAAATAATTTCCTAACTGG + Intergenic
1199222591 X:145334567-145334589 TACTGCAATAGGCTCCTAACTGG - Intergenic
1199903405 X:152199987-152200009 TACTATAATAGCTTTCTAACTGG + Intronic
1200312298 X:155089910-155089932 TACAGCAATATCTTCCTAACAGG - Intronic
1200356776 X:155560952-155560974 TACTGTAATAGCCTACTAACAGG - Intronic
1201940754 Y:19456936-19456958 TATTGAAAAAGCTACCTTATAGG + Intergenic