ID: 992877797

View in Genome Browser
Species Human (GRCh38)
Location 5:81075144-81075166
Sequence CATTATAATCATCTCTTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992877797_992877800 -3 Left 992877797 5:81075144-81075166 CCAAGTAAGAGATGATTATAATG 0: 1
1: 0
2: 1
3: 16
4: 202
Right 992877800 5:81075164-81075186 ATGGAGGCAGTATAAGTAGTTGG No data
992877797_992877802 5 Left 992877797 5:81075144-81075166 CCAAGTAAGAGATGATTATAATG 0: 1
1: 0
2: 1
3: 16
4: 202
Right 992877802 5:81075172-81075194 AGTATAAGTAGTTGGATTCTGGG 0: 1
1: 0
2: 3
3: 7
4: 129
992877797_992877801 4 Left 992877797 5:81075144-81075166 CCAAGTAAGAGATGATTATAATG 0: 1
1: 0
2: 1
3: 16
4: 202
Right 992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992877797 Original CRISPR CATTATAATCATCTCTTACT TGG (reversed) Intronic
904670411 1:32160710-32160732 AATTATAATCATCTGTACCTGGG + Intronic
907996895 1:59642104-59642126 CATTCTAAGCATCTGTTAATGGG + Intronic
909070490 1:70987549-70987571 CAATCAAATCAGCTCTTACTTGG - Intronic
909667014 1:78145955-78145977 TATTATCATCTGCTCTTACTTGG + Intergenic
909822341 1:80081947-80081969 AATTTTAATCATCTTTTTCTTGG + Intergenic
910485808 1:87712025-87712047 CATTGTCATCATCTCCTACCTGG - Intergenic
910594360 1:88963074-88963096 CATTATAAGCCTCTCTCAGTAGG - Intronic
911118493 1:94271495-94271517 CCTAATAATCTTCTCTTACGGGG - Intronic
911609023 1:99940189-99940211 CATTATAATGAGCTCTCATTAGG - Intergenic
912891459 1:113536894-113536916 AATCAAAATCATCTCTTACCTGG + Intronic
913245844 1:116869352-116869374 CATTATATGCATCTCAAACTGGG + Intergenic
915189639 1:154138156-154138178 CATGATATTTATCTCTTAGTAGG - Exonic
919460211 1:197868050-197868072 CAATATAATTATCTATTAATAGG - Intergenic
921206778 1:212856270-212856292 CATTATTATAATGTCTTCCTTGG - Intergenic
921491155 1:215777842-215777864 TATTAAAAACATCTCTTACAAGG + Intronic
921662751 1:217826318-217826340 CATTATTATCATCTCTTTGTAGG + Intronic
923444511 1:234055809-234055831 GATTTTACTCATCTTTTACTAGG + Intronic
924555290 1:245113230-245113252 CATTTTCATCATGTCTTACTTGG - Intronic
1063530522 10:6826610-6826632 CAGTAGAATCATTTCTTACATGG - Intergenic
1065541331 10:26771387-26771409 TTTTAAAATCATCTGTTACTCGG - Intronic
1066628967 10:37439913-37439935 CATTTGAATACTCTCTTACTTGG + Intergenic
1066642957 10:37574596-37574618 TGTTTTAATCATCTCTTACTAGG - Intergenic
1067898548 10:50213091-50213113 CCTTAAAATAATTTCTTACTTGG - Intronic
1068645174 10:59458029-59458051 TGTTACCATCATCTCTTACTTGG - Intergenic
1069061042 10:63894725-63894747 GATTATAATTATTTCTTAATGGG + Intergenic
1069442689 10:68443126-68443148 GTTTATAAGCATCTCTAACTTGG - Intronic
1069769613 10:70888831-70888853 CTTTATAAAAATCTCTTATTTGG + Intergenic
1071863391 10:89699575-89699597 CATTATCATTATCTTTTCCTGGG + Intergenic
1074519938 10:114210407-114210429 TATTATAAACATTTATTACTGGG + Intronic
1075866457 10:125725177-125725199 CATTAAAAACATATCTTTCTGGG - Intronic
1080703905 11:34669949-34669971 CATTATTATCATCTTTCCCTGGG + Intergenic
1080842972 11:36001849-36001871 CATTAAAAGCATTTCTAACTTGG + Intronic
1081354540 11:42096075-42096097 CAATTCAATCACCTCTTACTGGG - Intergenic
1081598854 11:44477888-44477910 GATTCAAATTATCTCTTACTGGG - Intergenic
1081954121 11:47074688-47074710 CATTGTAATTATCACTTACATGG - Intronic
1082834816 11:57643974-57643996 CCTTATTATCATCTTCTACTGGG + Intergenic
1085330924 11:75650210-75650232 CATTGTCCTCATCTGTTACTAGG - Intronic
1088724803 11:112624537-112624559 CATTATAATAAACTCCCACTTGG + Intergenic
1088802764 11:113321236-113321258 CATTCTTATCATCACTTGCTGGG - Intronic
1089202676 11:116733770-116733792 CACAATAATCCTCTCCTACTTGG - Intergenic
1092513683 12:9185468-9185490 CATTATGCTCATCTCTTTCAAGG - Intronic
1092667112 12:10814505-10814527 CATCATAATCATCTCCTAAAAGG - Intergenic
1094236302 12:28170628-28170650 TTTTATAATCATATCTTTCTTGG - Intronic
1094822329 12:34235884-34235906 TATTATAATCATTACTGACTAGG - Intergenic
1095094239 12:38137102-38137124 CTTTTTAAACATCTCTTTCTAGG - Intergenic
1096278228 12:50229137-50229159 CATTATAATTGTCTCTTAATTGG + Intronic
1099030645 12:77522304-77522326 CATTTTAATCATCTCTTTCCTGG + Intergenic
1099504211 12:83452262-83452284 GATTATATTCATATATTACTTGG + Intergenic
1100618031 12:96246870-96246892 CATTATCATGAGCTCTTACATGG + Intronic
1102489367 12:113280065-113280087 AATTATTATTATCTCTTTCTGGG - Intronic
1104144558 12:126020081-126020103 CATTAAAGTCATGTCTTACATGG + Intergenic
1109399256 13:61804407-61804429 GATTATATTCATCTATTACTGGG - Intergenic
1110543711 13:76733762-76733784 CATTATAATTAGCTTTTCCTGGG + Intergenic
1112088959 13:96062090-96062112 TATTTTAATCATCTTTTACCTGG - Intergenic
1115583241 14:34783743-34783765 TATTACAATTATCTCTTACCTGG + Exonic
1115793375 14:36904981-36905003 CATTCTAATCATATCTAAATAGG - Intronic
1117621239 14:57589174-57589196 CATTTCAATGATCTCTTATTGGG + Intronic
1120157857 14:81114083-81114105 CAGTACTCTCATCTCTTACTTGG - Intronic
1120441000 14:84539419-84539441 CAGTATAATTATTTTTTACTGGG + Intergenic
1126257648 15:46646660-46646682 CATTTTAATCACCTCAGACTTGG + Intergenic
1126416543 15:48423679-48423701 CATTCTACCCATCTCTCACTGGG + Intronic
1127282994 15:57508060-57508082 CATTGGAATCAACTCTTCCTTGG + Intronic
1127356625 15:58207079-58207101 GATTCAAATCATCTCTTACTGGG - Intronic
1127552545 15:60055325-60055347 CATTAAAATCATCTCTGGGTTGG + Intronic
1128479983 15:68028923-68028945 AATCATTATCATCTCTCACTTGG - Intergenic
1128827948 15:70738237-70738259 TATTATAATAATCTATTAATTGG + Intronic
1133094233 16:3430288-3430310 CATCATAATCATCTGGTACCTGG + Intronic
1133586275 16:7198756-7198778 TAATCTAATCACCTCTTACTGGG + Intronic
1137746625 16:50825413-50825435 CATTATATCCATCTATTAATGGG + Intergenic
1143371463 17:6443478-6443500 CATTATCATCATCCTTTCCTTGG + Intergenic
1146460886 17:33045330-33045352 CATTATAATCACATCTTCATCGG + Intronic
1146596061 17:34170066-34170088 AGTTACAATCATCTATTACTGGG - Intronic
1147221656 17:38936484-38936506 CAATCAAATCATCTTTTACTGGG - Exonic
1149070165 17:52532157-52532179 CATTATAATTCTCTCTTAACTGG - Intergenic
1153126433 18:1797655-1797677 CTTTAACATCATGTCTTACTAGG - Intergenic
1153159146 18:2182828-2182850 CATTTTAATCATCTTTAAATTGG - Intergenic
1155273816 18:24166986-24167008 CATTAAAATCATTCCTTGCTGGG + Intronic
1155461401 18:26088859-26088881 AATCATAATCTTCACTTACTGGG + Intronic
1155752414 18:29442346-29442368 TATTATAATCATGTATTAATTGG - Intergenic
1156804183 18:41156593-41156615 AATTACAATCATCTCTTAATGGG - Intergenic
1159831196 18:73279940-73279962 CATTACAGTCAGCTCTTCCTGGG - Intergenic
1163280852 19:16316575-16316597 GATTACAATCTTCTTTTACTGGG - Intergenic
1167875423 19:52408133-52408155 CATTATAAACATATGTTAATGGG - Intronic
1168009512 19:53519452-53519474 CATTCTCATCATGTCCTACTGGG + Intergenic
927792881 2:26024235-26024257 CAATCTAAGCATCTATTACTAGG - Intergenic
928260117 2:29758854-29758876 CATTCTCACCATGTCTTACTGGG + Intronic
928866245 2:35920665-35920687 CATTTTTCTCATCTCTTACAAGG + Intergenic
929307714 2:40382887-40382909 TATTATAATTATGTCTTTCTTGG + Intronic
930445927 2:51472186-51472208 CATTATCAACTTCTCTTAGTTGG + Intergenic
931922985 2:67040984-67041006 CTTTACAATCATCTCTGCCTCGG - Intergenic
932146454 2:69323158-69323180 CAATGTAATAATCACTTACTGGG + Exonic
932319919 2:70814372-70814394 ATTTATACCCATCTCTTACTGGG - Intronic
933145038 2:78841661-78841683 AATTATCATCATCTCTTACCTGG - Intergenic
935827354 2:106964809-106964831 CATTATCATCACCTCTTGCTGGG - Intergenic
936284543 2:111172109-111172131 TATTATAATCATGCCTTCCTGGG - Intergenic
936853093 2:116925198-116925220 CATTTGCATCATCTCTAACTTGG - Intergenic
937624832 2:124032483-124032505 TATTGTAATCATCTCTTAACTGG - Intronic
937734019 2:125267626-125267648 TATTATAATCAACTATTTCTTGG + Intergenic
938718359 2:134041963-134041985 CAATAATATCATCTTTTACTAGG + Intergenic
939416270 2:141902268-141902290 AATTCTAATCATCTTTTAGTAGG - Intronic
940992632 2:160113522-160113544 CATTAGAAACATCTATTACATGG + Intronic
943917380 2:193653408-193653430 CATTATTATGATTTCTTCCTAGG + Intergenic
944074034 2:195706782-195706804 CATTAAAAACATTTCTTACATGG - Exonic
947124807 2:226856645-226856667 CATTATAGTCATCTTTCTCTAGG - Intronic
947253974 2:228141008-228141030 CAATATAATCTTGTCTTATTAGG - Intronic
1170981336 20:21216864-21216886 CTTTACAATCATCCCTTGCTGGG + Intronic
1173141354 20:40487080-40487102 CATTTTAATCATGTCATATTAGG - Intergenic
1175215050 20:57387855-57387877 CATCGTAGTCATCTCTTCCTAGG + Intergenic
1177511802 21:22096434-22096456 CTTTAAAATGATCACTTACTAGG - Intergenic
953641475 3:44712186-44712208 CAATATCAACATCTCTTATTTGG - Intergenic
955301588 3:57784801-57784823 CCTAATAATCACCTCTTATTAGG - Intronic
955840756 3:63110258-63110280 CATAATTATCATTTTTTACTTGG + Intergenic
956194208 3:66635896-66635918 CATTAAAAGCACCTCTTCCTGGG + Intergenic
956922398 3:73943849-73943871 GAGTATATTCATCTCTCACTGGG + Intergenic
956942203 3:74176150-74176172 CATTATAATTATATCTTCCATGG - Intergenic
957625968 3:82652037-82652059 CATTATTTTAATTTCTTACTTGG - Intergenic
958026262 3:88052795-88052817 CATTGTAATCATTTCTTACAAGG - Exonic
959514207 3:107247306-107247328 CATCATCATCCTCTCTTATTTGG + Intergenic
961539764 3:127591321-127591343 CATTATAGTCACCTTTTACAGGG + Intronic
962043121 3:131728286-131728308 TGTTATTATCCTCTCTTACTGGG + Intronic
962742042 3:138369038-138369060 CATTAGTCTCATCTCTTAGTAGG + Intronic
963470323 3:145732965-145732987 CATTCTAATGATATCTAACTTGG + Intergenic
963641861 3:147870539-147870561 CATTATAATTATGTCTTTGTAGG + Intergenic
963739800 3:149065909-149065931 CATTTTTACCATCTCTTTCTTGG - Intronic
965177333 3:165352300-165352322 CATGATACTAATCTTTTACTGGG - Intergenic
972124219 4:35742660-35742682 CATTCTCATCATCTCTTTCCTGG - Intergenic
973113847 4:46429666-46429688 CATTATAATCATTTCATCCTTGG + Intronic
973292967 4:48488405-48488427 CATTGTAATTTTCTATTACTAGG + Exonic
976553518 4:86423965-86423987 TATTATAATAATCTCCTAATTGG - Intronic
977692173 4:99925574-99925596 CCTTATTCTCATCTGTTACTTGG - Intronic
978543263 4:109842045-109842067 CATTATTATTTGCTCTTACTGGG - Intronic
979112194 4:116773800-116773822 CATTATAATTATTTCTAAATAGG + Intergenic
979814972 4:125088986-125089008 CAGTTTAATCATCTGTTAATTGG - Intergenic
980202444 4:129673965-129673987 TGTTGTAATCATCTCTTACAAGG - Intergenic
980743274 4:136979512-136979534 AATTATAATCATCTGTCACTTGG - Intergenic
980840078 4:138248406-138248428 AATTATAAACATTTCTTATTTGG - Intergenic
981146484 4:141331475-141331497 CATTATACTCTTCTATTAGTAGG - Intergenic
982507884 4:156242431-156242453 CATTAGAATAATCTATCACTTGG + Intergenic
983733843 4:171032429-171032451 CATTGTTATTATCACTTACTAGG - Intergenic
984094261 4:175413977-175413999 CACTATAATCACCTCTGATTTGG - Intergenic
985024703 4:185729305-185729327 CTTTCTACTCATCTCTTTCTGGG + Intronic
988446630 5:31293391-31293413 GATTATAATCATTTTTTTCTGGG - Intronic
988675973 5:33433528-33433550 CGACATAATCACCTCTTACTAGG + Intergenic
988876797 5:35455963-35455985 TATTATAATGATCTTTTAGTTGG - Intergenic
988969169 5:36448724-36448746 CATTATAGTCATGTATTTCTTGG - Intergenic
992877797 5:81075144-81075166 CATTATAATCATCTCTTACTTGG - Intronic
993734529 5:91460377-91460399 AATTTTATTCATCTCTGACTTGG - Intergenic
994064563 5:95523119-95523141 CATTTTAATTGTCTCTTACCAGG - Intronic
994600944 5:101904177-101904199 CATTATAAACATCTTATCCTCGG - Intergenic
995408537 5:111829395-111829417 TATGATAATCATCTCTCATTTGG - Intronic
995718836 5:115108034-115108056 CATTATGATAATCTATTACTTGG - Intergenic
997969673 5:138390946-138390968 CAATCTAATGATCTCTTTCTTGG - Intronic
998337485 5:141385829-141385851 CAGTATAATCATTTATTAATGGG + Intronic
998609359 5:143671231-143671253 CATTTGAATCATCTGTTTCTGGG - Intergenic
999609908 5:153357887-153357909 CACTGTCATCATCTCTTACCAGG - Intergenic
1000465785 5:161574385-161574407 CTCTAAAATAATCTCTTACTGGG - Intronic
1003811452 6:9786970-9786992 CATTATAATCATATTATATTAGG - Intronic
1004134521 6:12953720-12953742 CAATATGATCAGCACTTACTAGG - Intronic
1004218532 6:13724658-13724680 CATTAAAATCATCTGTATCTGGG - Intergenic
1006812791 6:36830924-36830946 CATCAGTATCATCTCTCACTTGG + Intronic
1008266450 6:49433200-49433222 AATAATAATCATCTCTAAATTGG + Intronic
1011940702 6:92838894-92838916 CATAATACACATTTCTTACTAGG + Intergenic
1012437569 6:99230630-99230652 CATTAAAACCATCTCTAATTTGG + Intergenic
1012526190 6:100180888-100180910 TAGTATAAACATCTCTTAATAGG + Intergenic
1013089857 6:106890557-106890579 CATTTTATTTTTCTCTTACTGGG + Intergenic
1014161217 6:118170776-118170798 GTTTATATTCATGTCTTACTTGG - Intronic
1014411403 6:121126260-121126282 CATCCTAACAATCTCTTACTTGG - Intronic
1015012967 6:128374648-128374670 AGTTATAATCTTCTCTGACTTGG + Intronic
1016614988 6:146037272-146037294 CATTTTAATCTTATATTACTAGG - Intronic
1021280752 7:18714881-18714903 CATTATATTAAGCGCTTACTAGG - Intronic
1023504344 7:40884669-40884691 CATGACAATCACCTCTTGCTTGG + Intergenic
1024248405 7:47488210-47488232 CATTATTATCATTTATTACAAGG + Intronic
1024736200 7:52307628-52307650 CTTTATGCTCATCTTTTACTGGG + Intergenic
1028149564 7:87356222-87356244 TATTATAAACATTTCTTAATTGG + Intronic
1028711299 7:93912066-93912088 CATTAAAATTATCTATTATTTGG + Intergenic
1028711647 7:93916262-93916284 CATTAAAATTATCTATTATTTGG + Intergenic
1030623569 7:111818592-111818614 CATCATCAACATCTCTTACCTGG + Intronic
1030744772 7:113151961-113151983 CATTAAAAGCATCTCTTCATGGG + Intergenic
1031023853 7:116658991-116659013 CATTCTTATCTTCTATTACTTGG - Intergenic
1031203947 7:118729521-118729543 CAATATAATCCTTTTTTACTTGG + Intergenic
1031352457 7:120751945-120751967 CATTAAAATCTTCTTTCACTAGG + Intergenic
1031377764 7:121048902-121048924 GATAATCATCATCTCTTACCTGG + Intronic
1031955993 7:127943198-127943220 CATTGTAATAATTTCTTACCTGG + Intronic
1032642371 7:133784176-133784198 CTTTATCATCATCTCTTACTAGG + Intronic
1035086104 7:156259699-156259721 CTTTAAAAACATCTCATACTTGG - Intergenic
1037225544 8:16585091-16585113 CATCCTAATCATCTCCTGCTCGG + Intergenic
1039438009 8:37574008-37574030 CAGTTTACTCATCTCTGACTTGG - Intergenic
1040355634 8:46615732-46615754 CATTATAATCATATATTATTTGG - Intergenic
1042354976 8:67817543-67817565 ATTTCTCATCATCTCTTACTTGG + Intergenic
1042767019 8:72333276-72333298 TATTATACTCATTTCTTTCTTGG - Intergenic
1043809547 8:84719757-84719779 CATTTTCATCATCTCTTTGTGGG + Intronic
1044771803 8:95643840-95643862 CATTATTATTATCTCTTCTTTGG + Intergenic
1045631357 8:104127416-104127438 CAATATAGTGAACTCTTACTAGG - Intronic
1050024602 9:1320863-1320885 CATAATATTCAGCTCTTAGTTGG - Intergenic
1050604236 9:7284015-7284037 CAATGTAATCATCTCTAAATTGG - Intergenic
1050841684 9:10157747-10157769 CATTATCCTCATCTCTTTCAGGG + Intronic
1051648891 9:19300463-19300485 GATTATATTCAACTTTTACTGGG - Intronic
1052107185 9:24533521-24533543 TATTATTATTATCTGTTACTAGG - Intergenic
1054344612 9:63901621-63901643 CATCATAATCATGTTTTCCTGGG + Intergenic
1057149369 9:92782758-92782780 CACTAGAATTATCTCTAACTAGG + Intergenic
1058398903 9:104590592-104590614 CATTATAATAATCTCATTCAAGG - Intergenic
1058949410 9:109889756-109889778 CATTATAATCATCTCATTATTGG + Intronic
1062512880 9:136917132-136917154 CATCATCCTCATCTCTCACTGGG + Intronic
1188180412 X:27048532-27048554 AATTAAAATCATCTCTCACCTGG + Intergenic
1188709404 X:33376165-33376187 TAATATAAACATCTTTTACTAGG - Intergenic
1189189437 X:39086753-39086775 CATCAGAATCATCTATTATTTGG - Intergenic
1192292029 X:69808235-69808257 TATTGTATTCATCTATTACTGGG + Intronic
1193402326 X:81060214-81060236 GATTCAAATTATCTCTTACTGGG - Intergenic
1193917884 X:87388393-87388415 CATTATCAGCATCACTTATTGGG - Intergenic
1194341196 X:92707808-92707830 TATTATTTTCATCTCTTATTAGG + Intergenic
1195299731 X:103516049-103516071 AATTATAATCATTGCTTTCTGGG + Intronic
1196292024 X:113953409-113953431 CACAATAATCATCTCTTTTTTGG - Intergenic
1197848855 X:130834910-130834932 CATTATAAGCCTCTGTTCCTAGG - Intronic
1198879001 X:141258457-141258479 CAATCTAATCATCTCTCTCTTGG - Intergenic
1199318257 X:146406602-146406624 CATTATTTTCATCTCTTCATTGG + Intergenic
1199814179 X:151382936-151382958 CATTATAATCATCACAGACAGGG - Intergenic
1199863552 X:151822957-151822979 GGTTATAATCATCTCTCACCTGG - Intergenic
1200649546 Y:5824524-5824546 TATTATTTTCATCTCTTATTAGG + Intergenic
1202334927 Y:23798927-23798949 CACTATAATCATCACCTCCTAGG + Intergenic
1202535840 Y:25871132-25871154 CACTATAATCATCACCTCCTAGG - Intergenic