ID: 992877801

View in Genome Browser
Species Human (GRCh38)
Location 5:81075171-81075193
Sequence CAGTATAAGTAGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992877797_992877801 4 Left 992877797 5:81075144-81075166 CCAAGTAAGAGATGATTATAATG 0: 1
1: 0
2: 1
3: 16
4: 202
Right 992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 95
992877796_992877801 29 Left 992877796 5:81075119-81075141 CCTGTTAGGTAGCTATTTCAGTA 0: 1
1: 0
2: 4
3: 52
4: 279
Right 992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG 0: 1
1: 0
2: 0
3: 7
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992877801 Original CRISPR CAGTATAAGTAGTTGGATTC TGG Intronic
903807934 1:26018692-26018714 GAATAGAAGTAGTTGGATTCTGG - Intergenic
909568060 1:77077755-77077777 CAGAATAAGTTTTTGGATTTTGG + Intergenic
919130129 1:193440835-193440857 CAGTAGGAGTAATTGGATCCTGG + Intergenic
919249712 1:195037568-195037590 CAGTATAAGTAGTGGGTGTATGG + Intergenic
919612370 1:199760936-199760958 CAGTATCTGTATTTGAATTCTGG - Intergenic
921669407 1:217909518-217909540 CAAAATAAGTATTTGGAATCAGG - Intergenic
923096699 1:230780729-230780751 CACTAAAAGAAGTGGGATTCTGG - Intronic
923967992 1:239165052-239165074 CAGTATAAGTAGGTGAATAGAGG - Intergenic
1064804830 10:19119064-19119086 CATAAGATGTAGTTGGATTCTGG + Intronic
1067843837 10:49702837-49702859 TAGTAGAGGTAGTTGGAGTCAGG - Intronic
1068816083 10:61314828-61314850 CAGTCTAAGGAGTTGGGATCTGG - Intergenic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1072839090 10:98750574-98750596 CGGTAGAAGTGGTTGGTTTCTGG + Intronic
1074013116 10:109504610-109504632 CAGGATGAGGAGTTGGATTGTGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1081095823 11:38933430-38933452 CAATATCAGAAGTTGTATTCTGG + Intergenic
1081417453 11:42833242-42833264 CAGAATAAGAAATTGTATTCTGG + Intergenic
1087058463 11:93956058-93956080 CAGATTAAGTAGTTAGATTATGG - Intergenic
1087558277 11:99750638-99750660 CAGTATATTTAGTTAGATTCTGG - Intronic
1087946553 11:104166637-104166659 CAGAATAATTGGTTGGGTTCAGG - Intergenic
1087996345 11:104814009-104814031 TATGATAAGTAGTTGTATTCTGG + Intergenic
1088126171 11:106426379-106426401 GGGTATAAGAAGTTGAATTCTGG + Intergenic
1093779912 12:23123030-23123052 AGGTGGAAGTAGTTGGATTCTGG + Intergenic
1095041121 12:37442107-37442129 CAGTAAAAGTATTTTGAGTCTGG - Intergenic
1095267958 12:40181936-40181958 GAGGATAAGCAGGTGGATTCTGG - Intergenic
1095355908 12:41274951-41274973 CAGTATAATTAGGTAGATTCAGG + Intronic
1099080965 12:78179916-78179938 CTGTACTAGTAATTGGATTCAGG + Intronic
1107292040 13:38865775-38865797 CAGTATAAGATGGTGGAATCTGG + Intronic
1114757587 14:25277670-25277692 AAGTATAAGTAGTTTGACCCAGG + Intergenic
1115602148 14:34965719-34965741 GGGTATAAGTAATTGCATTCTGG + Intergenic
1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG + Intergenic
1124417750 15:29487783-29487805 CAGGATAATTAGTTGAATCCAGG - Intronic
1125753443 15:42046075-42046097 CAGTAGGAGTGGATGGATTCTGG - Intronic
1128378806 15:67096172-67096194 CAATATAAGTGGTTGGTGTCAGG - Intronic
1130436666 15:83906547-83906569 CAGTAAATGTGGTTGAATTCTGG + Intronic
1144145659 17:12395583-12395605 CTGAAAAGGTAGTTGGATTCTGG + Intergenic
1149921710 17:60666591-60666613 CAGTATTAGTGGTTGCATTAGGG + Intergenic
1156666866 18:39419463-39419485 CTGTTTTAGTAGTTGGACTCAGG + Intergenic
926594537 2:14776005-14776027 AAATATAAGTAGTTGGGATCAGG + Intergenic
933792974 2:85897854-85897876 CAGTATTAGCAGGTGGCTTCAGG - Intergenic
936856395 2:116963145-116963167 GGGTATAAATAGTTGGATTACGG + Intergenic
938154639 2:128923920-128923942 CATTATAAGGAGTTGGATGTTGG + Intergenic
938644280 2:133315260-133315282 CATGCTAAGTTGTTGGATTCAGG + Intronic
942945714 2:181670388-181670410 CAGTATACGTAGTTGGTATCGGG - Intronic
946540586 2:220680248-220680270 CAGAATAAGAAGTTGTATTTAGG - Intergenic
948617671 2:239211765-239211787 CAGTTTAAGATGCTGGATTCTGG - Intronic
1170290006 20:14758435-14758457 CATACTAAGTAGCTGGATTCAGG + Intronic
1171535712 20:25887016-25887038 CAGTAAAAGTATTTTGAGTCTGG - Intergenic
1171572147 20:26262882-26262904 CAGTAAAAGTATTTTGAGTCTGG + Intergenic
1171805376 20:29674168-29674190 CAGTAAAAGTATTTTGAGTCTGG + Intergenic
1171838676 20:30182263-30182285 CAGTAAAAGTACTTTGAGTCTGG - Intergenic
1172954978 20:38749734-38749756 CATTAGAAGCAGTTGGATTCTGG + Intronic
953423683 3:42774484-42774506 CAGGATAAAGAGTAGGATTCAGG + Intronic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
957294592 3:78321105-78321127 CAGTAAAAGTTGTTTGGTTCTGG + Intergenic
959460698 3:106622268-106622290 CAGTCTAAGGCGTTGCATTCAGG - Intergenic
963927495 3:150966382-150966404 CAGTTTAAGAAGTTAGATTTAGG + Intronic
964261014 3:154836889-154836911 CAGTAGAATTACTTGAATTCAGG - Intergenic
965572793 3:170188503-170188525 TAGTAAAAGTATTTGGAGTCGGG - Intergenic
965710408 3:171551213-171551235 AAGTATAAATAGTTGAACTCTGG - Intergenic
971656561 4:29354140-29354162 GAGTATTAGGAGTTGGACTCTGG - Intergenic
972504629 4:39708812-39708834 CATAATAAGTAGTTGGTTTTTGG + Intronic
972746709 4:41940512-41940534 CAGTATAAGAACTTGAATTTAGG + Intronic
975080483 4:70273629-70273651 TGGTATAAGGAGTTGGATTTTGG - Intergenic
977473903 4:97478943-97478965 CAATATAAGTAATTGGATGATGG + Intronic
979567890 4:122177296-122177318 GGGGAGAAGTAGTTGGATTCTGG - Intronic
981602154 4:146501891-146501913 CAGTAAACGTGATTGGATTCAGG - Intronic
982999261 4:162391286-162391308 CAGTATAAGTAATTAAATTTTGG - Intergenic
986858250 5:11897450-11897472 CAGTATAAATAATTAGATTTTGG - Intronic
989475871 5:41871775-41871797 CATTTTAAGAAGTTGGATTGGGG + Intergenic
991188900 5:63845409-63845431 GAGAAGAAGTAGTGGGATTCTGG - Intergenic
991540900 5:67726982-67727004 AAGTATAAGTTCTTGAATTCTGG + Intergenic
991772122 5:70050132-70050154 GAGTGAAAGTATTTGGATTCTGG + Intronic
991851415 5:70925550-70925572 GAGTGAAAGTATTTGGATTCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
998101977 5:139442057-139442079 CAGTTTTAGTGGCTGGATTCAGG - Intronic
998476615 5:142427516-142427538 CAGTAAAAGTAGCAGTATTCTGG - Intergenic
999377807 5:151098980-151099002 CAGTTAAGGTAGTTGCATTCTGG - Intergenic
1000106323 5:158062500-158062522 AAGAATAAGTATTTGGAATCTGG - Intergenic
1007683217 6:43648759-43648781 CTGTGGAAGTGGTTGGATTCTGG + Intronic
1016272936 6:142311200-142311222 AAGTGTAAGTACTTTGATTCTGG - Intronic
1016502751 6:144740471-144740493 AAGTATAAGTAATTGCTTTCAGG + Intronic
1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG + Intronic
1023072979 7:36456099-36456121 GAGTGTAAGTATGTGGATTCTGG - Intergenic
1024973722 7:55094232-55094254 CAGGATAAGAAGCTGGATGCTGG - Intronic
1025287179 7:57673717-57673739 CAGTAAAAGTATTTTGAGTCTGG - Intergenic
1028781239 7:94738951-94738973 CAGTATCAGTAGTAGGTTACTGG + Intergenic
1033781884 7:144680705-144680727 CAGTCAAACTAGTTGGATTCAGG - Intronic
1039341913 8:36659743-36659765 TAGTATAATTAGTAGTATTCTGG + Intergenic
1040561750 8:48528704-48528726 CTGTATAAGCAGTTAAATTCTGG + Intergenic
1042970550 8:74403612-74403634 CAGTAAAAGTATATGGATTATGG + Intronic
1043836059 8:85047851-85047873 CTTTATAAGTAGTAGGATACTGG - Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1056334512 9:85553824-85553846 CAGAATCAGGAGTTGGATTGAGG - Intronic
1187037194 X:15553157-15553179 CAGTGTAGTTAGTTGGATTTTGG + Intronic
1188273071 X:28166479-28166501 CAGTTTAAGTACCTAGATTCTGG + Intergenic
1189537955 X:41955969-41955991 GAGAAGAAGTAGCTGGATTCTGG - Intergenic
1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG + Intronic
1192360779 X:70437727-70437749 GATGATAAGTGGTTGGATTCTGG - Intergenic
1192789759 X:74369821-74369843 CAGATTAAGTAGCTGGCTTCTGG + Intergenic
1193873325 X:86829147-86829169 AAGCATAAGCATTTGGATTCTGG + Intronic
1195040317 X:101008167-101008189 CCTTATAGGTAGTTGGATACAGG + Intergenic
1195372615 X:104193885-104193907 CATTATAAGTAGTTATGTTCCGG - Exonic