ID: 992879039

View in Genome Browser
Species Human (GRCh38)
Location 5:81087055-81087077
Sequence GTGCCCGAAGGACCCCCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992879034_992879039 11 Left 992879034 5:81087021-81087043 CCGGAAGGCGTTCTGAACAGGCG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 992879039 5:81087055-81087077 GTGCCCGAAGGACCCCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 68
992879031_992879039 13 Left 992879031 5:81087019-81087041 CCCCGGAAGGCGTTCTGAACAGG 0: 1
1: 0
2: 1
3: 5
4: 49
Right 992879039 5:81087055-81087077 GTGCCCGAAGGACCCCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 68
992879033_992879039 12 Left 992879033 5:81087020-81087042 CCCGGAAGGCGTTCTGAACAGGC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 992879039 5:81087055-81087077 GTGCCCGAAGGACCCCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992879039 Original CRISPR GTGCCCGAAGGACCCCCCCA CGG Intronic
900791810 1:4685719-4685741 GTCCCCCATGGACCCCCCAACGG - Intronic
1063206262 10:3833903-3833925 GTGCCCCAAGGATGCTCCCAGGG + Intergenic
1065737614 10:28768484-28768506 CTGCCCGAAGTACTCCCCCCTGG - Intergenic
1069901998 10:71711558-71711580 GTTCCCACAGGACCCTCCCAGGG - Intronic
1072692863 10:97583208-97583230 GAGCCCGAGGGACTCTCCCATGG - Intronic
1084691117 11:70727385-70727407 ATCCCCGAAGGAACCCCTCAGGG - Intronic
1086643269 11:89186552-89186574 TTGCACCAAGGACCCCACCAGGG - Intronic
1089502723 11:118941724-118941746 GTGCCTGAAGGACACCCGGATGG - Intronic
1090395486 11:126415546-126415568 TGGCCCCAAGGACCCTCCCAGGG + Intronic
1091776419 12:3187828-3187850 GTGCCCCGAGGACCTGCCCAGGG - Intronic
1096487644 12:51994484-51994506 GTCCCCGAAGGAAACCCTCAGGG - Intronic
1103561373 12:121794769-121794791 GTGGCAGAGGGACCCCCCCCTGG + Intronic
1110251752 13:73388012-73388034 GTCCCCGAAGGACCCCTTGAAGG - Intergenic
1123025513 14:105421864-105421886 GTGCCCGCAGGCCCGTCCCAGGG + Intronic
1138591442 16:58001395-58001417 GTGCCGGAAGCGCCCTCCCAGGG - Exonic
1141656862 16:85421257-85421279 GGGCCCGAGAGACCCCCCCAGGG - Intergenic
1141883348 16:86874428-86874450 GTGACCCAAGGAAACCCCCAAGG - Intergenic
1147456546 17:40541750-40541772 GTGCGGGCAGGGCCCCCCCATGG + Intergenic
1148911962 17:50947588-50947610 GTGTGCGAAGGGCCTCCCCAAGG - Intergenic
1155159697 18:23185573-23185595 CTGCCCGAAGAGCCCACCCAGGG + Intronic
1156489872 18:37489699-37489721 GTTCCCAAAGGGCCCCGCCAGGG - Intronic
1160873274 19:1286436-1286458 GTTCCCGCGGGAGCCCCCCAGGG + Intronic
1162552465 19:11365262-11365284 GTACCCCAAGGACCCTGCCATGG - Exonic
1162783629 19:13020669-13020691 GAGCCCCAAGCACCCCCTCAAGG - Intronic
1163548136 19:17951221-17951243 GTGGCTGAAGGTCCCCACCAAGG + Intergenic
1165313982 19:35043790-35043812 CTGCCGGAAGGACAGCCCCAGGG + Intronic
1165414511 19:35684084-35684106 CTGCAGGAAGGACGCCCCCAGGG - Intergenic
1166288757 19:41848489-41848511 GTGCCAGCAGGACTGCCCCATGG - Exonic
1166852162 19:45766210-45766232 GTGCCCCAAGGCCCACCACAAGG - Intronic
1168062102 19:53898781-53898803 GCCCCCCAAGGACCCCCCCCCGG - Intronic
928300830 2:30122414-30122436 GTGCCCCAAGCCCCCTCCCAGGG + Intergenic
932771488 2:74503077-74503099 GTGGCGGCAGGACCACCCCAGGG - Intronic
942249304 2:174034087-174034109 TTGCCTGAAGGACCCCCAAATGG + Intergenic
942695890 2:178644967-178644989 GTGCCAGAAGGTCCCCCTAATGG + Intronic
943769999 2:191705729-191705751 GTGCCTGAAGGAGCCCTCCATGG + Intergenic
948040309 2:234896312-234896334 GTGCTAGAAGGACCTCTCCATGG + Intergenic
948860642 2:240751093-240751115 GAGCCCTGAGGACACCCCCAGGG + Intronic
1169059509 20:2651780-2651802 GTGCCCAAAAGACGCCCTCAAGG + Intergenic
1170791922 20:19515680-19515702 GAGCTCGAAGGACCCCCACCAGG - Intronic
1172942517 20:38664149-38664171 GTGCAGGCAGGAACCCCCCAGGG + Intergenic
1179656697 21:42850358-42850380 GTCCCAGAAGGCGCCCCCCACGG - Intronic
1179953390 21:44724122-44724144 CTTCCAGAAGGACCCACCCAGGG + Intergenic
1183428334 22:37751331-37751353 GTGCCCCACGGACCCTCCCATGG - Intronic
1184243209 22:43222406-43222428 GAGCCGGAAGGGCCCTCCCACGG + Intronic
1184741354 22:46430614-46430636 GTGGCCCAAGGTCACCCCCAAGG + Intronic
949546825 3:5079990-5080012 CTCCCTGGAGGACCCCCCCAGGG + Intergenic
950179221 3:10899338-10899360 ATGCCCCAAGGAGCCTCCCAGGG - Intronic
950747047 3:15099034-15099056 GTGCCCGCAGGAGCCCGGCAGGG - Exonic
953221203 3:40973411-40973433 GTGCCCCAGGGACCACCCCTTGG + Intergenic
968954392 4:3710836-3710858 GTGTCTGAAGGCCCCCCGCAAGG - Intergenic
969599856 4:8169906-8169928 GTGCTAGAATGACCCACCCAAGG + Intergenic
969677164 4:8620492-8620514 GTGCCAGAAGGAGCCCGCCCTGG - Intergenic
969678117 4:8626131-8626153 GTGCCAGAAGGAGCCCGCCCTGG - Intergenic
969679072 4:8631768-8631790 GTGCCAGAAGGAGCCCGCCCTGG - Intergenic
979771196 4:124526691-124526713 TTGCCCCAAGGTCACCCCCAGGG - Intergenic
983982776 4:174019227-174019249 GTGCCTGAACGACCCACCCCTGG + Intergenic
985754293 5:1703947-1703969 GTGGCCGAATGAGCTCCCCATGG + Intergenic
987491095 5:18581212-18581234 GTGCCCTATGGAACCCCCCCAGG + Intergenic
991270076 5:64768965-64768987 CTGCCCAAAGGAGCCCCTCACGG - Exonic
992879039 5:81087055-81087077 GTGCCCGAAGGACCCCCCCACGG + Intronic
997519207 5:134511876-134511898 GTGCCTGAAGGAGGCTCCCAAGG + Intergenic
1001402144 5:171451769-171451791 GTGCCCGAAGGCCCCGTCCATGG - Intronic
1003493316 6:6642331-6642353 GTCCCGGGAGGACCCCTCCAGGG + Intronic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1012628309 6:101431296-101431318 GAGCCAGAAGGACTCCCACATGG - Intronic
1027386868 7:77667438-77667460 GTTCCAGATGGACGCCCCCATGG - Intergenic
1039043142 8:33426836-33426858 GGCCCTGAAGGACCCTCCCAGGG + Intronic
1053351145 9:37414159-37414181 CTGCCTGAAGGACCTGCCCAAGG - Intergenic
1056854310 9:90112365-90112387 CTGCCAGAACGACCCTCCCAAGG + Intergenic
1058993702 9:110279056-110279078 GTGCCCAAAGGAACTCTCCATGG + Intergenic
1059390732 9:113998267-113998289 GCGCCCGAAGGCAGCCCCCACGG + Intronic
1059483766 9:114611709-114611731 GCGCACGAAGGACCCCCCGCAGG - Intronic
1196277224 X:113780778-113780800 GTGTCCAAAGCACTCCCCCAAGG + Intergenic
1197562938 X:128047098-128047120 CTGCCCCAAGGAACCCCCCAGGG - Intergenic