ID: 992879979

View in Genome Browser
Species Human (GRCh38)
Location 5:81098150-81098172
Sequence ATGTGAGAGTAAAAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992879976_992879979 9 Left 992879976 5:81098118-81098140 CCAGCAGAGTTTGATTGTGGATT 0: 1
1: 0
2: 0
3: 10
4: 149
Right 992879979 5:81098150-81098172 ATGTGAGAGTAAAAGGGTGAAGG 0: 1
1: 0
2: 1
3: 35
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992879979 Original CRISPR ATGTGAGAGTAAAAGGGTGA AGG Intronic
901179771 1:7333587-7333609 TTGTGAAAGGAAAAGGCTGAGGG + Intronic
903586855 1:24422514-24422536 ACGAGGGGGTAAAAGGGTGAAGG - Intronic
903709679 1:25313719-25313741 GTGGGAGAGTAACTGGGTGAGGG + Intronic
903717439 1:25378670-25378692 GTGGGAGAGTAACTGGGTGAGGG - Intronic
904452459 1:30622739-30622761 ACCTGAGAGCAAAGGGGTGAAGG + Intergenic
904966202 1:34376105-34376127 ATACGAGAGGAAAAGTGTGATGG - Intergenic
906571462 1:46845186-46845208 ACCTGAGAGTGAAAGGGAGAGGG - Intergenic
906599810 1:47116049-47116071 ACCTGAGAGTGAAAGGGAGAGGG + Intronic
906612777 1:47214710-47214732 GTTTCAGAGGAAAAGGGTGAGGG - Intergenic
907119089 1:51992806-51992828 TTGTGAGAGAAAGAGAGTGAGGG - Intergenic
907361099 1:53915881-53915903 ATGAGAGTTTAAAAAGGTGAGGG + Intergenic
908631193 1:66109832-66109854 TAATGAGAGGAAAAGGGTGAGGG - Intronic
909376052 1:74943570-74943592 ATGTGAAAGGCAAAGGGTGCAGG - Intergenic
909508317 1:76420508-76420530 ATCTGAGAATAAAATGGAGATGG - Intronic
909611096 1:77552557-77552579 CTGTGATAGTAAAAGGCAGAAGG + Intronic
910212629 1:84809097-84809119 ATATGAAAGAAAAAGGGGGAGGG - Intergenic
911188068 1:94923376-94923398 ATCAGAGAGTAAAAGGGCCAGGG - Intronic
911486991 1:98514958-98514980 GTGTGAAAGAAAAAGGGTTAAGG - Intergenic
911581655 1:99641097-99641119 ATGTGAGAGAATAAGGGTCAAGG + Intergenic
912053422 1:105562461-105562483 ATGTGGGAGTAAAATTGGGAAGG + Intergenic
912348190 1:108985450-108985472 CTGTGAGAATAAAATGGGGATGG - Intronic
912920480 1:113861878-113861900 ATATGAGATCTAAAGGGTGAAGG + Intronic
913521126 1:119647224-119647246 GTGGGTGAGTAAAAGGTTGAGGG - Intronic
914914043 1:151807384-151807406 ATGGGAAAGGAAAAGGGTGAGGG + Exonic
918965749 1:191345070-191345092 ATGTGAGAGGAAAAGGGGGAGGG - Intergenic
919017136 1:192053005-192053027 ATGTGAGGGTCAAAGGGAAAGGG + Intergenic
919413714 1:197279779-197279801 ATATGAGAATAAAAGGGTAGGGG - Intronic
920423886 1:205857954-205857976 ATGTGGGGGTAAAGAGGTGAGGG - Intergenic
921109992 1:212026458-212026480 TTGTGTGTGTAAGAGGGTGAAGG - Intronic
921738367 1:218654911-218654933 AAGTGAGAGGAAGAGTGTGAGGG + Intergenic
921782433 1:219181603-219181625 TTGTGGGAGCAAAAGTGTGAGGG + Intronic
922457924 1:225791662-225791684 ACGTGAGGGTAAACAGGTGAGGG + Intergenic
923670100 1:236033009-236033031 ATTTGAGAGTAAAAGGAGGATGG + Intronic
923931814 1:238708827-238708849 ATATGAGAGTAAAAAGCAGAAGG + Intergenic
924437122 1:244051246-244051268 GTGTTAGAATAAAAGGCTGAGGG - Intronic
1063022119 10:2139669-2139691 ATTTCAGAGTAAGAGGGTGAAGG + Intergenic
1064091238 10:12387273-12387295 ATGTGAGTGTCAAAGCGTGAAGG - Intronic
1064505212 10:16021669-16021691 TTTTGAGAGTAAAAGGGACAAGG + Intergenic
1066024629 10:31342431-31342453 ATCAGAGAGTAAAATGGTGGAGG + Intronic
1067035048 10:42908771-42908793 ATGTGGAAGGAAAAGGGTCATGG - Intergenic
1067838861 10:49660107-49660129 ATGGGAGAGTAGAAGTGTGCTGG + Intronic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1071193484 10:83129378-83129400 ATTGGAGAATAAAAGGGAGATGG + Intergenic
1071270760 10:84005186-84005208 ATGTGAGGGGAAAAGGAAGAGGG + Intergenic
1071952230 10:90716995-90717017 ATGTGGGAGTAACTGTGTGAGGG + Intergenic
1072681718 10:97512350-97512372 ATATGAGAGTATAGGGGAGAAGG - Intronic
1073052563 10:100677563-100677585 ATGTGAGAATAAGAGGGTATGGG - Intergenic
1073233743 10:101995211-101995233 ATGAGACAGTAATGGGGTGAGGG + Intronic
1073638961 10:105230169-105230191 ATCTGAGAGTACAAGGGTCTCGG - Intronic
1073780189 10:106829373-106829395 CTGTGAATGTAAGAGGGTGAGGG - Intronic
1074010688 10:109476110-109476132 TTGGGAGAGTAAAACGGGGAAGG + Intergenic
1074405759 10:113179101-113179123 ATGTGAGGGTCTAAGGGGGATGG - Intergenic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1077921083 11:6642116-6642138 AGGAGAGAGGAAAAGGTTGACGG - Intronic
1078252274 11:9626015-9626037 AGGTGAGAGCAATAGGGTGCAGG - Intergenic
1081025636 11:38010452-38010474 ATGTTAGATTACAAGGGGGATGG + Intergenic
1081106369 11:39075037-39075059 ATGTGAGAGAGAGAGGGGGAGGG - Intergenic
1081206952 11:40286885-40286907 ATATGTGGGTAAAAAGGTGAAGG - Intronic
1081518960 11:43862892-43862914 ATGTGAGATTAAAAGGGAATGGG - Intergenic
1081746670 11:45477912-45477934 ATGTGAGTGTTAAGGGGTCAGGG + Intergenic
1083807231 11:65081993-65082015 ATGTGACAGCAATAGGGTAAGGG + Intronic
1083997441 11:66279193-66279215 ATGTGAGAGACAAAGGGGAAGGG - Intronic
1084267731 11:68013476-68013498 AGGTGAGAGTAGAATGGAGAAGG + Intronic
1086374746 11:86188736-86188758 ATGTGATAGTAAAAGGTACAGGG - Intergenic
1086973967 11:93112594-93112616 ATGTGAGTGGAAAAAGGAGATGG + Intergenic
1087538897 11:99489824-99489846 AAGTGAGAGTGAAAGTGAGAGGG + Intronic
1088559838 11:111102827-111102849 ATTTGTGTGTAAAAGGGCGAGGG - Intergenic
1089511536 11:119000886-119000908 ATGTGGAAAAAAAAGGGTGAGGG - Intronic
1089588397 11:119524321-119524343 AGGAGAAAGCAAAAGGGTGAGGG + Intergenic
1095339209 12:41068425-41068447 AAGTGAGGGTCAAAAGGTGAGGG - Intronic
1095464707 12:42478108-42478130 ATGAGAGAGAAAGAGGGAGAGGG - Intronic
1095716930 12:45356259-45356281 ATGTGAGAATGAAAGAGGGAAGG - Intronic
1095796368 12:46223429-46223451 ATGTGAGAGAGAAAGAGAGATGG - Intronic
1096685851 12:53287946-53287968 AGATCAGAGTGAAAGGGTGAAGG - Intronic
1099157710 12:79200102-79200124 AAGAGAGATGAAAAGGGTGAAGG + Intronic
1099341364 12:81439094-81439116 ATGTCAGAGAAAAAGAGAGATGG + Intronic
1099460858 12:82919191-82919213 ATATGAGAGAAAAAGCATGAGGG + Intronic
1099586392 12:84522249-84522271 ATGTGAGACAAAAAGGCTGAGGG + Intergenic
1099661171 12:85564942-85564964 ATCTGAAAGCAAAAGCGTGATGG - Intergenic
1099662464 12:85581875-85581897 ATGTGTAAGTGAAAGGGGGAAGG - Intergenic
1100055102 12:90499808-90499830 ATGTGAGAGTTAAAAGGAGGGGG - Intergenic
1100120201 12:91360655-91360677 ATGTAAGAGTAGAAAGGTGTGGG + Intergenic
1100328652 12:93565839-93565861 ATGTCAGAATAAAAGGGAGAAGG - Intergenic
1100683151 12:96952161-96952183 AAGTAAGAGTAAAAGGATGATGG + Exonic
1104816311 12:131647797-131647819 ATGTGAGTGTATATGTGTGAGGG - Intergenic
1106863229 13:33934393-33934415 ATGAGACAGTAAGAGGGAGAAGG + Intronic
1107832614 13:44387769-44387791 CTCTGAGAGTCAAAGGATGATGG - Intronic
1107965913 13:45598130-45598152 AGGAGAGAGTAACAGGGTGGGGG - Intronic
1108178633 13:47819562-47819584 AGGAGAGAGAAAAAGAGTGAAGG - Intergenic
1108184541 13:47875423-47875445 ATGTAAGAGGAAGAGAGTGAAGG + Intergenic
1108378217 13:49833369-49833391 ATGGGAGAGGAAAGGGGAGAGGG + Intergenic
1108955603 13:56153461-56153483 ATGTGAGAGGAAAAGAGTCAAGG - Intergenic
1109218974 13:59621822-59621844 ATGTCAGAGCAAATGGGGGAAGG + Intergenic
1110026963 13:70552655-70552677 ATGTGAGGGTTAAAGAGAGAAGG + Intergenic
1110168982 13:72477246-72477268 ATGTGAGGATAAAAGTGTGGAGG + Intergenic
1110721948 13:78772023-78772045 GTGTGAGAGCAAAAGGGAGAGGG + Intergenic
1112450803 13:99507791-99507813 ATGTGACTGTACAAGGGTCATGG - Intronic
1112827380 13:103407579-103407601 ATCTGGGTGTAAAAGGGAGAAGG - Intergenic
1112896020 13:104301818-104301840 ATCTGAGAGGTAAAGGGTAATGG + Intergenic
1115000566 14:28416224-28416246 ATGGCAGGGCAAAAGGGTGATGG - Intergenic
1115437163 14:33387953-33387975 ATGGTAGAGTCAAAGAGTGAAGG + Intronic
1115967127 14:38903051-38903073 ATGTGAGTGGTAAAGGGAGAGGG + Intergenic
1117062789 14:51980388-51980410 AACTGAGATTCAAAGGGTGATGG + Intergenic
1117294954 14:54370754-54370776 AGGTGAGAGTTAGAGAGTGAGGG + Intergenic
1117610027 14:57473659-57473681 AGGGGAAAGTAAAAGGATGAAGG - Intronic
1118466333 14:66034508-66034530 ATGTGGGAGGAATAGGGAGATGG + Intergenic
1118524471 14:66623697-66623719 ATGTCAGGGTAAAGGGGGGATGG - Intronic
1118994633 14:70824536-70824558 ATGGCAGAGTAAAGTGGTGAGGG - Intergenic
1120389642 14:83889162-83889184 AGGTGAGAGAAAATGTGTGAAGG - Intergenic
1120623807 14:86799327-86799349 ATGTAAGAGTCATAGGGTGAGGG + Intergenic
1202845927 14_GL000009v2_random:175200-175222 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
1202915385 14_GL000194v1_random:165797-165819 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
1202877351 14_KI270722v1_random:17248-17270 ATGTCAGGGGAGAAGGGTGAAGG + Intergenic
1124693755 15:31846426-31846448 ATATCAGAGTAAAATTGTGAAGG + Intronic
1125041185 15:35189239-35189261 ATGTGAGAAAAATAGGGTAAAGG - Intergenic
1126391058 15:48152760-48152782 GTGTGAGAGTCTAAGGGTAAGGG + Intronic
1127642730 15:60930972-60930994 CTCTGAGGGTAAAAGGGTGTAGG + Intronic
1128296469 15:66524866-66524888 ATGTGAGGGCAAAAGTATGATGG - Intronic
1128865874 15:71115173-71115195 AAGTGAGAGGAAAAGGGAGAGGG - Exonic
1129623008 15:77166577-77166599 TTGTGAGACTTAAAGGGGGATGG - Intronic
1129965139 15:79728400-79728422 GTCAGAGAGTAAAAGTGTGATGG - Intergenic
1130187188 15:81695504-81695526 AGGTGAGAGTAAAAGGATAGGGG + Intergenic
1130584652 15:85171830-85171852 ATGTGGGGGTAAACAGGTGAGGG - Intergenic
1131097715 15:89666627-89666649 AGTTGAGAGCAAAGGGGTGAAGG + Intronic
1132719303 16:1308129-1308151 ATGAGAGAGGAAATGAGTGAGGG + Intergenic
1133728997 16:8562800-8562822 ATGAGTGAGTAAATGAGTGAGGG + Intergenic
1133729003 16:8562860-8562882 ATGAGTGAGTAAATGAGTGAGGG + Intergenic
1133978590 16:10617576-10617598 CTGTGAGAGTGTAGGGGTGAAGG - Intergenic
1135231939 16:20716657-20716679 ACGTGAGGGTAAACAGGTGAGGG - Intronic
1135716216 16:24770434-24770456 TTGTGAGAGTAAATTGTTGAGGG + Intronic
1136612533 16:31375352-31375374 ATGTGAGAGTGAGAGGGAAAGGG - Intronic
1137254099 16:46760888-46760910 ATGTGAGAGAGAATGGGTAAGGG + Intronic
1138174972 16:54888843-54888865 AGGAGAGAGTCAAAGGGAGAGGG + Intergenic
1140247606 16:73265442-73265464 ATTTCAGAGTTCAAGGGTGATGG - Intergenic
1140812664 16:78593397-78593419 ATGGGATAGTACAAGGGTGATGG - Intronic
1142226824 16:88881605-88881627 CCGTGAGAGTAAGGGGGTGAGGG + Intronic
1145413855 17:22695996-22696018 ATGTGGGTGTGAGAGGGTGAGGG - Intergenic
1145414311 17:22702769-22702791 ATGTGGGTGTGAGAGGGTGAGGG + Intergenic
1147882052 17:43660509-43660531 ATGGGAGAATCAAGGGGTGAGGG - Intronic
1148679573 17:49465978-49466000 ATGTGAGACTGAAAGGGAGAAGG - Intronic
1149340274 17:55678724-55678746 ATGTGAAATTAAAAGGGAGATGG - Intergenic
1149470664 17:56913236-56913258 ATGTCAGAGTAGAAAGGGGATGG - Intronic
1150872828 17:68932328-68932350 AAGAGAGAGGAAAAGGATGAAGG - Exonic
1150911163 17:69389096-69389118 ATGAGAATGTAAAAGGGTGTAGG - Intergenic
1152136764 17:78508699-78508721 ATGTGAGAGGAAAGGGGTAGGGG + Intronic
1152364579 17:79848014-79848036 ATGTCAAAGTAACAGGGAGAAGG + Intergenic
1153372949 18:4340708-4340730 TTGTGAGAGAGAAAGGGTGCTGG - Intronic
1153455814 18:5280940-5280962 ATGGTAGAGGAAAAGGTTGAAGG + Intergenic
1154124808 18:11681708-11681730 ATGTTAAATTAAAAGGTTGAGGG + Intergenic
1155043584 18:22085149-22085171 CTGTCAGAGTAACAGGTTGAGGG + Intergenic
1155172142 18:23274761-23274783 ATGTGAGACTGAGAGGGAGATGG - Intronic
1156549655 18:38002378-38002400 ATATTACATTAAAAGGGTGAAGG - Intergenic
1157693712 18:49703922-49703944 ATTTGACAGCAAAAGGGTAAAGG - Intergenic
1157696342 18:49726661-49726683 ATGTGACTGAAAAAGTGTGAAGG + Intergenic
1158082503 18:53609692-53609714 ATCAGAGACTAAAAGGGTCATGG - Intergenic
1158722877 18:59941593-59941615 ATTTGAGATTAAAAGGGTCCAGG + Intergenic
1161563451 19:4986355-4986377 ATGGCGGAGTAAACGGGTGATGG + Intronic
1161615831 19:5269619-5269641 AGGAGAGAGAAAAAGGGTGTGGG + Intronic
1161898738 19:7101804-7101826 ATGTGAGGATAAACAGGTGAGGG - Intergenic
1162966747 19:14159822-14159844 ATGTGACAGTATTAGGGTGAGGG - Intronic
1165408640 19:35644995-35645017 ATGTGAGAGGAAAGAGATGAAGG - Intergenic
1166887748 19:45972326-45972348 ATGTGACAAGAAAAGGGTGTGGG - Intronic
1202673328 1_KI270710v1_random:15694-15716 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
924970143 2:118705-118727 ATGTTACAGTGAAAAGGTGAGGG + Intergenic
926591705 2:14747125-14747147 ATGTGAGAGTGTAAGTGTGCAGG - Intergenic
926804006 2:16687913-16687935 ATATTAGAGGAAAAGGGTGTAGG + Intergenic
928714253 2:34042472-34042494 ATGTGAGAGCAACTGAGTGAAGG - Intergenic
929009122 2:37423802-37423824 ATGTCAGATGATAAGGGTGATGG + Intergenic
929057694 2:37892514-37892536 AAGTGAGAGGAAAGGGGTGGTGG - Intergenic
929457235 2:42074663-42074685 TTGTGAGACTGAGAGGGTGAAGG - Intergenic
929803898 2:45127946-45127968 AGGTGAGAGTTAAGGGGTAAAGG - Intergenic
930328703 2:49954569-49954591 AAGAGAGAGAAAAAGGGAGAGGG + Intronic
930479834 2:51933772-51933794 AGGGGAGTATAAAAGGGTGAGGG - Intergenic
930619171 2:53626335-53626357 CTCTGAGAAGAAAAGGGTGAAGG - Intronic
931232580 2:60387211-60387233 ATGTGAGAGGAAAAGTGAGCAGG + Intergenic
932461109 2:71882631-71882653 ATGTGAGCCTAAAAGGAAGATGG + Intergenic
933366900 2:81364363-81364385 ATGTGAAAGTGAATAGGTGAAGG - Intergenic
934853478 2:97715421-97715443 CTGTGACTGTAAAAGGGAGATGG - Intronic
935900803 2:107790655-107790677 AGGTGAGAGAAAAAGTGTGAAGG + Intergenic
937672861 2:124557408-124557430 AGGTAATAGTAAATGGGTGAAGG + Intronic
941020607 2:160404848-160404870 TTCTGAGATTAGAAGGGTGATGG + Intronic
941378379 2:164759947-164759969 ATGTGAATGCAAAACGGTGAAGG + Intronic
941536843 2:166733605-166733627 ATGTGAGAATAATAGGTTCAAGG - Intergenic
941721313 2:168816159-168816181 CTGTCAGAGTAAAAGGCTTAAGG - Intronic
942248852 2:174031133-174031155 ATGGGAGAGGGAAAGGGGGAAGG - Intergenic
942394737 2:175535329-175535351 ATCTGAGAGTGAAAGGGACAGGG + Intergenic
942490607 2:176485942-176485964 TAGGGAGAGTAAAAGGGAGAAGG + Intergenic
942657803 2:178232284-178232306 ATTTGAGAGTCAGAGGATGAGGG - Intronic
943321970 2:186455734-186455756 ATGTGAGGCAGAAAGGGTGATGG - Intergenic
943389654 2:187248848-187248870 CTTTGAGAGTAAAAGGGGCATGG - Intergenic
943948266 2:194094925-194094947 ATGTCAGTCCAAAAGGGTGAAGG - Intergenic
944762108 2:202826852-202826874 ATCTGACAATAAAAGGGTTAGGG - Intronic
945559291 2:211318969-211318991 ATGAGAGAGTAACTGGGTAAAGG - Intergenic
1169858916 20:10131876-10131898 AAGTGGGAGTAAAAGGGGCAGGG + Intergenic
1170358423 20:15518109-15518131 ATGAGGGAGAAAAAAGGTGATGG + Intronic
1171322440 20:24258253-24258275 AGGTCAGAGGTAAAGGGTGAGGG - Intergenic
1173092562 20:39987078-39987100 TTGAAAGAGTAAGAGGGTGATGG + Intergenic
1174098699 20:48109996-48110018 GTGAGTGAGTAGAAGGGTGAAGG - Intergenic
1174142472 20:48425545-48425567 ATGGGTGAGTAAATGAGTGAAGG + Intergenic
1174145313 20:48449173-48449195 ATGTGAGTGGGAAGGGGTGAGGG - Intergenic
1176634735 21:9180441-9180463 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
1176638632 21:9274680-9274702 ATGTCAGGGGAGAAGGGTGAAGG + Intergenic
1177636913 21:23799165-23799187 ATCTGAGAGCAAAAGGAAGAGGG + Intergenic
1177941104 21:27412170-27412192 ATGTAAGAGTAGAAGAGTGCCGG - Intergenic
1178705911 21:34872620-34872642 ATGTCAGAATAAAAGGGGCAAGG + Intronic
1179057568 21:37950169-37950191 ATGTGAGAGAATATGGGGGATGG - Intergenic
1180370423 22:12029743-12029765 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
1180371934 22:12047523-12047545 ATGTCAGGGGAGAAGGGTGAAGG + Intergenic
1180422672 22:12882187-12882209 ATGTCAGCGGAGAAGGGTGAAGG + Intergenic
1181388558 22:22561876-22561898 ATGGGAGAGGAACAGTGTGAGGG + Intronic
1181597867 22:23928996-23929018 ATGTGAGGGTAAACAGGTGAGGG - Intergenic
1181620064 22:24084978-24085000 AGGTGAGAGGAAAAGTATGAGGG - Intronic
1182030367 22:27154763-27154785 ATAGGAGAGGAAAAGGGTCAAGG - Intergenic
1182100223 22:27652579-27652601 ATGTGAGAATAGAAGGGAAAAGG + Intergenic
1182182044 22:28359845-28359867 ATGTGAGAGTGGCAGGGTCAGGG + Intronic
1182354489 22:29716366-29716388 ATGTGAGGGAAACAGAGTGAAGG - Intergenic
950684035 3:14603611-14603633 ATAAGTGAGTAAATGGGTGAAGG + Intergenic
950748181 3:15107588-15107610 GTGTGAGAGCCCAAGGGTGAGGG + Intergenic
953068888 3:39500315-39500337 ATGTTAAATTAAATGGGTGAAGG + Intronic
953456309 3:43045022-43045044 ATGTGGGGGTAAACAGGTGAGGG + Intronic
954571473 3:51644578-51644600 AGGTGACTGTAAAAGGCTGATGG + Intronic
954629702 3:52041183-52041205 CTGTGAGAGCAAAAGGGTGGAGG - Intergenic
954764208 3:52899009-52899031 ATGTGGGAGCAAGAGGGAGAGGG - Intergenic
955110893 3:55948962-55948984 TTGTGAGAGTTAAAGAGTCAAGG - Intronic
955551067 3:60086140-60086162 GAGAGAGAGTAAAAGGGTGGGGG + Intronic
956145080 3:66183999-66184021 AGGTGAGTGTGAAAGGGTAAGGG - Intronic
957440389 3:80238863-80238885 ATGTGTGTGTAGTAGGGTGAAGG - Intergenic
957540816 3:81566661-81566683 ATTTGAGAGCAAAAGGAGGAAGG - Intronic
959099047 3:101989775-101989797 AGGTGACAGTAAAAAGGGGAAGG - Intergenic
959340463 3:105123197-105123219 AAGGGAAAATAAAAGGGTGAGGG + Intergenic
960637682 3:119800031-119800053 ATGTGACACCAAAAGCGTGAAGG - Intronic
962039871 3:131695421-131695443 ATGTTATAGTAAAAGGGGGCGGG - Intronic
962163380 3:133023044-133023066 ATGTGAGAGAGAAAGGGCAAAGG + Intergenic
964296747 3:155241357-155241379 ATGTGAGAGAGAGAGGGTGGGGG + Intergenic
965179858 3:165388442-165388464 ATGTGAGGGTAAACAGGTGAGGG + Intergenic
967199645 3:187060698-187060720 ATGTGAGAAGTAAAGGGAGAGGG + Intronic
1202748263 3_GL000221v1_random:130339-130361 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
968676239 4:1882016-1882038 ATGTGAGGTTTTAAGGGTGATGG + Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
971894189 4:32569352-32569374 ATGTCTGGGTAAAAAGGTGAAGG + Intergenic
973089735 4:46120324-46120346 ATGTAAGAATATAAGGATGAAGG - Intronic
973272049 4:48271317-48271339 AATTGAGAGTGAAAGGGAGAGGG + Intergenic
973916053 4:55635990-55636012 AGGTGAGAGAAAGAGGGTGGAGG + Intronic
974447985 4:62011554-62011576 ATTTCAGAGGAGAAGGGTGAGGG + Intronic
974695397 4:65362180-65362202 ATGTGATAGTGAAAAGATGAAGG + Intronic
974848476 4:67380169-67380191 ATGGGAGAGGAAGAGGGAGAGGG - Intergenic
975519751 4:75287712-75287734 CTGTGAAAGTAAAAAGGTGGAGG - Intergenic
976133702 4:81912265-81912287 ATGTGAGAGTTAAAGGGTCCAGG - Intronic
976337127 4:83902100-83902122 ATGAGAAAGTGAAAGGGTGAAGG - Intergenic
977643410 4:99383451-99383473 ATGGGAGGGAAAAAGGGAGAAGG - Intergenic
978277495 4:106969262-106969284 ATGAGAGAGGAAAAGGGAGAGGG - Intronic
979428319 4:120595331-120595353 ATGGGAGAGTGCAAAGGTGATGG + Intergenic
979559822 4:122089268-122089290 GAGTGAGAGGAAAAGGGGGAGGG - Intergenic
980395316 4:132206518-132206540 TTGAGGGAGTAAAAGGGTAATGG - Intergenic
981210240 4:142094707-142094729 AAGTCAGAGAAAAAGGGAGATGG + Intronic
981215477 4:142160820-142160842 TTGTGAAACTAAAAGGGAGAAGG - Intronic
981813557 4:148803098-148803120 ATTTGAGAGTAATGGGGTGGAGG - Intergenic
982079383 4:151772939-151772961 ATGTGAGAGTGATGGAGTGATGG + Intergenic
982260535 4:153490390-153490412 ATGTGAGAGTGAGATGGAGAAGG + Intronic
982983275 4:162169455-162169477 AAGTGTAAGTAAAATGGTGACGG - Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
984347328 4:178546276-178546298 ATATGAGAGTAAAAGCAAGAGGG + Intergenic
1202753520 4_GL000008v2_random:33091-33113 ATGTCAGGGGAGAAGGGTGAAGG + Intergenic
985674143 5:1221610-1221632 AGGTGAGAGTCATGGGGTGAGGG + Intronic
986054800 5:4126124-4126146 GTATGAGAGTAAAAGAATGAAGG + Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986995346 5:13601524-13601546 ATCTGAGTGTAAAGGGGTCAGGG - Intergenic
987827792 5:23055912-23055934 GTGGAAGAGTAAAAGGGTTAGGG + Intergenic
988282337 5:29166079-29166101 ATGATAGAGAAAAGGGGTGAGGG - Intergenic
988383560 5:30531719-30531741 ATGTGAGAGTGAGAAAGTGATGG - Intergenic
988518708 5:31927273-31927295 ATGGGAGAGAAAAAAAGTGAGGG + Intronic
989199882 5:38752589-38752611 ATGTGAGAGCAGAAGGGAAAAGG - Intergenic
989304235 5:39933223-39933245 ATGTGAGAGTTTAAGGCAGAAGG + Intergenic
989438942 5:41447439-41447461 ATGTGGGATTAAAAGAGAGAAGG + Intronic
989611930 5:43302305-43302327 ATTTGAGAGTAAAGGGTAGAGGG - Intronic
989826894 5:45867483-45867505 GTGTGAGAGTAATAGTTTGAAGG - Intergenic
990478363 5:56184142-56184164 ATGGGCAAGCAAAAGGGTGAGGG - Intronic
991130733 5:63119837-63119859 ATGTGAGAGTAATGGGATGGAGG + Intergenic
991645498 5:68796694-68796716 ATGTGAGAGTAAGAGGGGAAAGG - Intergenic
992829045 5:80576684-80576706 ATGGGAAAGTAAAATGGTGCAGG + Intergenic
992879979 5:81098150-81098172 ATGTGAGAGTAAAAGGGTGAAGG + Intronic
993459565 5:88166282-88166304 ATGTTAGAGAAAATGGATGAAGG - Intergenic
994355989 5:98794242-98794264 AAGTGAGGGCAGAAGGGTGAGGG - Exonic
994852122 5:105069048-105069070 AGAAGAGAGTAAAAGGGGGAGGG + Intergenic
995294735 5:110506389-110506411 ATTGGGGAGTAAAATGGTGAAGG - Intronic
995495790 5:112741483-112741505 GTGTGAGAATAAAGGGGAGAAGG - Intronic
996439709 5:123476175-123476197 ATCTGAAAGTAGAAGGGTCAGGG - Intergenic
996538128 5:124600342-124600364 ATTTGAGAATAAAAATGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998650097 5:144109176-144109198 ATCTGAGAATAAAAGAGTGACGG + Intergenic
999049815 5:148510190-148510212 ATGGGAGAATAAAAGAGTAAAGG + Intronic
999082411 5:148856728-148856750 ATGTGGGAGTAAAAGGTGAAAGG + Intergenic
999733271 5:154492347-154492369 ATGGGAAGGTAAGAGGGTGAAGG + Intergenic
999773878 5:154795600-154795622 ATGTGAGAATAAACAGATGAGGG - Intronic
1000555277 5:162718221-162718243 ATGTAAGAGTTAAAGAGTTAAGG - Intergenic
1000809108 5:165838549-165838571 GTGTGAGAGAGAAAGGGAGAAGG - Intergenic
1000875436 5:166632174-166632196 ATGTGGGAGTAAATGTGTGGAGG - Intergenic
1001532545 5:172473910-172473932 ATGTTAGAGTAAAAGGGAAAAGG + Intergenic
1002862013 6:1087752-1087774 ATGTTAAAATAAAAGGATGATGG - Intergenic
1003171057 6:3722498-3722520 ATGTGACAGGAAGAGGGGGAGGG + Intergenic
1005451955 6:25982358-25982380 ACGTGAGGGTAAACAGGTGAGGG - Intronic
1005840389 6:29741387-29741409 ATGAGAGTGTGACAGGGTGAGGG + Intergenic
1006403355 6:33830470-33830492 GTGTGAGAGTAAATGGGTGGTGG + Intergenic
1007039648 6:38710190-38710212 ATGTGGGGGTAAACAGGTGAGGG - Intergenic
1007964856 6:45994852-45994874 GTGAGAGAGTGAATGGGTGAGGG - Intronic
1008199150 6:48564808-48564830 ATATGAGAGTAAAAGAGTCGTGG + Intergenic
1008475355 6:51930406-51930428 ATGTGAGTGTATAAGGGTGTGGG + Intronic
1010291777 6:74146091-74146113 AAGTTAGAGTGAAAGGGTGTGGG - Intergenic
1010766512 6:79781806-79781828 AGGTGGGAGAAGAAGGGTGAAGG + Intergenic
1012445867 6:99306573-99306595 ATGTGAGATGAACAGGGTGGGGG + Intronic
1012629124 6:101441780-101441802 ATTTGAGGGTAAAAGTTTGAAGG - Intronic
1013669988 6:112390445-112390467 TTTTCAGAGTAAAAGAGTGAAGG - Intergenic
1014117313 6:117679983-117680005 ATTTGAGAGCAAAGGGGTGTAGG - Intronic
1014647110 6:123987780-123987802 ATATGAGAGAAGAAGGGGGAGGG - Intronic
1015734857 6:136388232-136388254 ATTTGAGGATAAGAGGGTGATGG - Intronic
1015813872 6:137187579-137187601 AAATGAGAGTAAAAGAGTGTTGG - Intergenic
1016936489 6:149452026-149452048 TTCTGAGAGTGAAAGGGGGAAGG + Intronic
1016977835 6:149826296-149826318 ATATTTGAGTCAAAGGGTGATGG - Exonic
1018235251 6:161717439-161717461 ATGAGAGAGTCAAAGGGTGGGGG + Intronic
1020573517 7:9896382-9896404 ATGTGGGAGTAAGAGAGAGAGGG - Intergenic
1020798651 7:12706247-12706269 AAGTTAGACTAAAAGTGTGATGG + Intergenic
1020930721 7:14389929-14389951 TTGTTAAAGTTAAAGGGTGAGGG + Intronic
1020943774 7:14574794-14574816 AGGTGAGGGTAAGAGAGTGATGG - Intronic
1022791477 7:33693468-33693490 ATGGGAGAGTAGGGGGGTGATGG + Intergenic
1024435443 7:49348272-49348294 ATTTGAGAGTGAAGGGGAGAAGG - Intergenic
1026082552 7:67235037-67235059 ATGTTAGAGTTTGAGGGTGAAGG + Intronic
1026176647 7:68003423-68003445 ATGTAATAGTAATAGTGTGATGG - Intergenic
1026694518 7:72578964-72578986 ATGTTAGAGTTTGAGGGTGAAGG - Intronic
1026929679 7:74216947-74216969 AGGTGTGAGTGAAGGGGTGAAGG - Intronic
1027850234 7:83442450-83442472 ATGTGAGAGTATAAAAGTAAAGG - Intronic
1027907186 7:84200044-84200066 GTGGGAGAGTCAAAGGGAGAGGG - Intronic
1028468708 7:91181204-91181226 AAGGGAGAGAAAAAGGGAGACGG - Intronic
1029088297 7:98028565-98028587 AGGTGAGTGCAGAAGGGTGAAGG + Intergenic
1029984134 7:104906147-104906169 AAGAGAGAGAAAAAGGGTGGGGG - Intronic
1030849783 7:114469316-114469338 ATATGAGATTAAAAGAGTAAGGG + Intronic
1031961331 7:127992816-127992838 ATGGGAGAGTAAAAGAGTTTTGG - Intronic
1032989028 7:137370439-137370461 CTTTGAGAGGAAAAGGGTGAGGG - Intergenic
1033981925 7:147175728-147175750 GTGTGGGAGTAGAAGGTTGATGG + Intronic
1034720290 7:153285791-153285813 ATGTGATATTATAAGGGGGAGGG - Intergenic
1035453188 7:158992406-158992428 ATGTGAGACTCAAAGGGCCAGGG - Intergenic
1036530040 8:9576610-9576632 ATGTGACAGCACTAGGGTGATGG + Intronic
1037307367 8:17519661-17519683 AAGTTAGAGAAAAAGTGTGAAGG - Intronic
1037843263 8:22260681-22260703 ATGTGTGGGTAAGTGGGTGAGGG - Intergenic
1039089430 8:33812690-33812712 TTGTCAGAGGAAAAGGGGGATGG + Intergenic
1039261833 8:35780241-35780263 ATTTGAGAGTTAATGGGTTATGG + Intronic
1040421061 8:47241010-47241032 ACATCAGAGTCAAAGGGTGAGGG + Intergenic
1040791554 8:51236328-51236350 ATGAGACAGTACAAGGGGGATGG - Intergenic
1041671841 8:60499707-60499729 ATGTGGGGGTAAACAGGTGAGGG - Intergenic
1041721073 8:60975868-60975890 ATGTGAAAGTTAAATGGTCAAGG + Intergenic
1042050953 8:64706226-64706248 ATTTTAGAGTACAAAGGTGAAGG + Intronic
1042501031 8:69509221-69509243 ATGAGAGAGAAATAAGGTGATGG - Intronic
1043603864 8:81975318-81975340 CGGTGAGAATAAAATGGTGATGG + Intergenic
1044020902 8:87104602-87104624 ATGGGAGAGTAAAGGACTGATGG + Intronic
1044235929 8:89829780-89829802 CTATGAGAGTAAAATGGAGATGG - Intergenic
1044809723 8:96046354-96046376 ATGTAAGGGTAAAATGTTGATGG + Intergenic
1044942585 8:97358440-97358462 CTGGGAGAGTAAAAGGGTACAGG + Intergenic
1045245437 8:100438130-100438152 ATCTGAGAGTGAAATGGGGAAGG - Intergenic
1045760990 8:105607430-105607452 GTGTGAGAGTGAAAGTGAGAGGG - Intronic
1046104997 8:109654516-109654538 ATGAAAGAATAAAAGGGTGAGGG - Intronic
1046583058 8:116117024-116117046 ATGATAGAGTGAAAGGGGGAGGG + Intergenic
1047796973 8:128267648-128267670 ATGTGTGAGTAACAGAATGAAGG + Intergenic
1047797033 8:128268015-128268037 AAGAGAGAGTAAAAGAGAGAGGG - Intergenic
1047873654 8:129112005-129112027 AGGAGAGAGAAAAAGAGTGAGGG + Intergenic
1048082411 8:131142958-131142980 ATGTGTGAACAAAAGAGTGAGGG - Intergenic
1048329905 8:133464392-133464414 ATGTGAGCGTGGCAGGGTGAGGG - Intronic
1048421438 8:134282250-134282272 ATCAGAGAAGAAAAGGGTGAAGG + Intergenic
1049401422 8:142429199-142429221 ATGCGGGAGTCAAAGGGTGAGGG + Intergenic
1051490516 9:17659031-17659053 ATGGGAGAAGAAAATGGTGATGG + Intronic
1052928136 9:34035094-34035116 CTGTTAGAGTGATAGGGTGATGG - Intronic
1057787413 9:98097315-98097337 AGGTGAGGGTATAAGGGTGGGGG - Intronic
1057877462 9:98768674-98768696 AAGGGAGAGTCAAAGGGTGAGGG - Intronic
1058661995 9:107275026-107275048 ATGTGAGAGAAAGAGGCTCATGG - Intergenic
1059401657 9:114074216-114074238 ATGTGTGAGTAAACAGGTGACGG - Intronic
1059713590 9:116892519-116892541 AGGTGAGAGCAAAAGAGAGAAGG + Intronic
1059795523 9:117692193-117692215 GAGTGAGAGTTAAAGGGTTAGGG + Intergenic
1060123136 9:121015162-121015184 ATGTGATTGTAAAAAGGTTATGG - Intronic
1203757515 Un_GL000218v1:147750-147772 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic
1203716904 Un_KI270742v1:160421-160443 ATGTCAGCGGAGAAGGGTGAAGG - Intergenic
1203534310 Un_KI270743v1:17814-17836 ATGTCAGGGGAGAAGGGTGAAGG + Intergenic
1186400889 X:9258397-9258419 ATGTTTGTGTAAAAGGGTCAGGG + Intergenic
1186943120 X:14534344-14534366 ATTGGAGAGTTAAAGGGAGAGGG - Intronic
1187445275 X:19355621-19355643 ATGTGAAAGTAAAATGGTTTGGG + Intronic
1189352232 X:40284401-40284423 ATGTCAGAGGAAAATGGTGGGGG - Intergenic
1189462058 X:41250849-41250871 ACAAGGGAGTAAAAGGGTGAGGG + Intergenic
1189928870 X:45986636-45986658 AGGTGGGACTAAAAGGGGGAAGG - Intergenic
1190057177 X:47187672-47187694 ATGGGAGAAAAAAAGGGTGAAGG + Intergenic
1191901537 X:66045805-66045827 ATGGGAACGGAAAAGGGTGAGGG + Intergenic
1192459498 X:71304784-71304806 ATGAGAGATGAAAAGGGAGAAGG - Intronic
1193863170 X:86696186-86696208 ATGGGAGAATAAAAGTGTCAGGG - Intronic
1195588809 X:106600145-106600167 AGGTGAGAGTAACAAGGAGAAGG - Intergenic
1195590775 X:106623044-106623066 AGGTGAGAAGAAAAGGTTGAAGG - Intronic
1196236611 X:113288724-113288746 ATGTGAATGTAAAATGGTCATGG + Intergenic
1196868100 X:120087471-120087493 ATCTGAGAGTGAAAGTGAGAGGG - Intergenic
1197273198 X:124448581-124448603 AAGTGAGGGTGAAATGGTGAAGG - Intronic
1198187176 X:134264836-134264858 ATCTGAGACTCAAATGGTGAAGG + Intergenic
1198395598 X:136215881-136215903 ATGTGAGAATTAAAGGGGCAAGG + Intronic
1198845654 X:140907613-140907635 ATGTGAGAGTAAGAGTAGGATGG - Intergenic
1200214390 X:154361141-154361163 AAGTGAGAGTAAAGGGGAGGAGG - Intronic
1201171090 Y:11265369-11265391 ATGTCAGGGGAGAAGGGTGAAGG - Intergenic