ID: 992880537

View in Genome Browser
Species Human (GRCh38)
Location 5:81105121-81105143
Sequence TCTTAAGATACCCTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992880535_992880537 -10 Left 992880535 5:81105108-81105130 CCAGAGAACTGCATCTTAAGATA 0: 1
1: 0
2: 4
3: 13
4: 158
Right 992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
992880533_992880537 -8 Left 992880533 5:81105106-81105128 CCCCAGAGAACTGCATCTTAAGA 0: 1
1: 0
2: 0
3: 17
4: 218
Right 992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
992880534_992880537 -9 Left 992880534 5:81105107-81105129 CCCAGAGAACTGCATCTTAAGAT 0: 1
1: 0
2: 1
3: 15
4: 190
Right 992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 87
992880532_992880537 -7 Left 992880532 5:81105105-81105127 CCCCCAGAGAACTGCATCTTAAG 0: 1
1: 0
2: 1
3: 11
4: 163
Right 992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992880537 Original CRISPR TCTTAAGATACCCTGATTGT GGG Intronic
900707365 1:4089073-4089095 TGTTAAGTCACCCTGTTTGTGGG - Intergenic
905089616 1:35418436-35418458 TCTCAAGATAAACTGACTGTTGG + Exonic
905702062 1:40024698-40024720 CCTTAAAATACCCTGTATGTTGG - Intergenic
911522816 1:98948621-98948643 TCTTAAGATACCCTGCAGCTTGG + Intronic
914692534 1:150043678-150043700 TCTTAAGATTCTCTAATTTTAGG + Intergenic
916128784 1:161593429-161593451 TCTCAGGATACCCTGAGTGCAGG + Intronic
918992129 1:191710336-191710358 TCTTAAGAATCCCTGAATGCAGG - Intergenic
923299005 1:232623249-232623271 TTTTAACATACCCTGATCCTGGG + Intergenic
1067066688 10:43107828-43107850 TTTTAAGATACCCTGCATTTTGG - Intronic
1068116592 10:52743134-52743156 TCATCACATTCCCTGATTGTGGG + Intergenic
1071806272 10:89124581-89124603 ACTTAAGAGACCTTTATTGTCGG + Intergenic
1073847997 10:107581389-107581411 TCTTAAGATATCCTAGGTGTTGG - Intergenic
1074676303 10:115855215-115855237 TCTTATGATTCTCTGAGTGTAGG + Intronic
1074760403 10:116663401-116663423 TCTTAAGCCACCCAGTTTGTGGG + Intergenic
1076422816 10:130343478-130343500 TCATAACATATCCTGATTATGGG - Intergenic
1084502524 11:69543326-69543348 TTTTAAGACACCCAGTTTGTGGG - Intergenic
1085726547 11:78960015-78960037 TTCTAAGGTACCCTGATTTTAGG - Intronic
1089136666 11:116254692-116254714 TCTTAAGATTCTCTCATTTTCGG - Intergenic
1089393341 11:118117009-118117031 TCTTAAAAAAGCCTGGTTGTTGG - Intronic
1098875995 12:75867061-75867083 TATTAAGAGACACTGAGTGTTGG - Intergenic
1101165021 12:102020445-102020467 TCCTAAAATACCATTATTGTTGG + Intronic
1107198893 13:37689562-37689584 TCTCAAGATTTCCTGACTGTAGG - Intronic
1109332584 13:60947750-60947772 CATTAAGATGCCTTGATTGTAGG + Intergenic
1111297102 13:86294004-86294026 TTATAATATACCCTTATTGTGGG + Intergenic
1112961372 13:105131513-105131535 TTTTAAGATTCCCCGATTATTGG + Intergenic
1120053796 14:79898666-79898688 TCTGAAGATATTCTGATTTTAGG - Intergenic
1134414223 16:14029959-14029981 TCCTCAGATACCCTGAGAGTTGG + Intergenic
1140759321 16:78097107-78097129 TCATAAGATCCCCTGATTGTGGG - Intergenic
1141578987 16:84984344-84984366 TGTTAAGATCCCTAGATTGTTGG - Intronic
1146776265 17:35620173-35620195 TCTTAAGAAACCCTATTTGTAGG + Intronic
1149418194 17:56482478-56482500 GGTTAAGAAACCCTGAGTGTGGG - Exonic
1153707339 18:7759272-7759294 TCTTTAAATACCCTTATTGTTGG - Intronic
1164194136 19:22939510-22939532 TCTTAAGATAAACTTATTGTTGG - Intergenic
1164502034 19:28828243-28828265 TCTTAAGATCAACTGATTTTTGG + Intergenic
925730428 2:6916834-6916856 TCTTAAGGTATCCAGCTTGTTGG - Intergenic
931860872 2:66353053-66353075 TGTTAAAATTACCTGATTGTCGG - Intergenic
933733916 2:85479791-85479813 TTTTAAGCCACCATGATTGTGGG + Intergenic
936268952 2:111033713-111033735 ACTTGAGACACCCTGATTGAAGG + Intronic
941222320 2:162798201-162798223 TCTTAAAATACTCTGCTTCTAGG - Intronic
941504720 2:166328033-166328055 GCTAAAGATACACTGCTTGTAGG - Intronic
943323023 2:186469395-186469417 ACTCAAGATACCCTTTTTGTTGG - Intergenic
944338473 2:198566097-198566119 TATTAAGAAATCCTGATAGTAGG - Intronic
945244686 2:207707328-207707350 TCATAAAATACCCTGATGTTTGG + Intergenic
948415768 2:237802217-237802239 TCTCAAAATATCCAGATTGTAGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1174003808 20:47394412-47394434 TCTTAAGATACCCTCTTGGCTGG - Intergenic
1174494961 20:50932334-50932356 TCTTATGCTACCCAGATTGTGGG - Intergenic
1179404415 21:41113413-41113435 TCTTAAGACACCCAATTTGTGGG - Intergenic
950986546 3:17375950-17375972 ACTTAAGATACCCTAACTTTGGG - Intronic
952673034 3:35994026-35994048 TCTTAGGAGTCCCTGAGTGTAGG + Intergenic
954584558 3:51722077-51722099 TCCTCAGATACCCTGATTGATGG - Intergenic
958108909 3:89114341-89114363 GGTTAAGACACCCTGATGGTGGG - Intronic
958731355 3:97963709-97963731 TCATTAGTTACCCTGATAGTTGG - Intronic
958921561 3:100111960-100111982 TCTCCAGATGCCCTGAGTGTAGG - Intronic
959617339 3:108363109-108363131 TCTTAAGATGCCATGATCATGGG + Intronic
965893255 3:173540945-173540967 TCTTAAGAAACTGTGATTGTGGG - Intronic
966242186 3:177766892-177766914 TCTGAAGATATCCTGTTTCTGGG - Intergenic
967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG + Exonic
972954167 4:44368566-44368588 GCTTTAGATCCCCTGACTGTTGG + Intronic
976883507 4:89959782-89959804 TCTTAAAATATCCTCATTCTGGG + Intergenic
978166871 4:105619846-105619868 CCATAAGATAAACTGATTGTTGG + Intronic
978838294 4:113179963-113179985 TCTTAAAATGCCCTGAATTTTGG + Intronic
992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG + Intronic
994666655 5:102713427-102713449 TCACAAGCTACCATGATTGTGGG - Intergenic
995250838 5:109991753-109991775 GCTTAAGCCACCCAGATTGTAGG - Intergenic
997051624 5:130388088-130388110 TCATCAGATACCCAGATTTTAGG + Intergenic
997584742 5:135037645-135037667 TCCTAAAATACCTTGATTCTGGG - Intronic
997779233 5:136640394-136640416 TCTTAGGAGACCCAGGTTGTAGG - Intergenic
1000004657 5:157172189-157172211 TCTTAAGAAACAATTATTGTTGG - Intronic
1004032007 6:11879792-11879814 TCTTAAGTTACCCTAATTTGAGG - Intergenic
1013766669 6:113582118-113582140 TCCTGAGATACCCTTATTTTTGG + Intergenic
1014038896 6:116800568-116800590 TCTTAAGGTAACCTTGTTGTAGG - Exonic
1018673823 6:166201961-166201983 TCTTTAGACACCCTGATTGATGG - Intergenic
1023363979 7:39444742-39444764 TCTGAAGAGACCCTGACTTTGGG - Intronic
1027347147 7:77272366-77272388 ACTGAAGATACCCTGATTCATGG + Intronic
1027477494 7:78651709-78651731 TCTTGAAATACCCTGATTCAAGG + Intronic
1028431870 7:90756989-90757011 GCTTAAGCCACCCAGATTGTGGG - Intronic
1029046335 7:97632863-97632885 GCTTAAGAAACCCAGATTCTGGG - Intergenic
1031082989 7:117276321-117276343 TCTTCAGTTACCCTGAAGGTTGG - Intergenic
1031901924 7:127420114-127420136 TGTTAAGTTACCCAGTTTGTGGG + Intronic
1036187291 8:6634831-6634853 TCTAAAGATACCCTGGTTACAGG - Intronic
1042251590 8:66761284-66761306 TCTTAAGTGAACCTGATTTTTGG + Intronic
1048122161 8:131594024-131594046 TCTTAAGATCCTCTTCTTGTAGG - Intergenic
1050386229 9:5094007-5094029 TCTTAAGAAACCCTGTTCTTGGG - Intronic
1188409864 X:29858627-29858649 TCTTGAGATACACAGATTTTAGG - Intronic
1189432768 X:40963640-40963662 TCTTAAGATAATCTCATAGTAGG + Intergenic
1192511051 X:71720595-71720617 TCCTAAGCTACCGGGATTGTGGG - Intergenic
1192515646 X:71760958-71760980 TCCTAAGCTACCGGGATTGTGGG + Intergenic
1192523630 X:71823485-71823507 TCTTAAGCTACCGGGATTGTGGG - Intergenic
1192528854 X:71869712-71869734 TCCTAAGCTACCGGGATTGTGGG + Intergenic
1192861027 X:75070507-75070529 TTTTAAGGTACCCTTACTGTTGG - Exonic
1193639729 X:83998157-83998179 TGTTAAGATACTTTGATTGAAGG + Intergenic
1195211413 X:102654684-102654706 TGTTAAGACACCCTGGTTCTGGG + Exonic
1195501786 X:105610265-105610287 TTAAAAGATACCCTGATTGAAGG - Intronic
1198421858 X:136476302-136476324 TCTCAAGTCACCCTCATTGTAGG + Intergenic
1202350012 Y:23979434-23979456 GCTTAACATCCCCTGAGTGTGGG - Intergenic
1202520767 Y:25690687-25690709 GCTTAACATCCCCTGAGTGTGGG + Intergenic