ID: 992884186

View in Genome Browser
Species Human (GRCh38)
Location 5:81141387-81141409
Sequence CTGTGCCCCTTCCATAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992884186_992884192 27 Left 992884186 5:81141387-81141409 CCCTCACTATGGAAGGGGCACAG 0: 1
1: 0
2: 3
3: 13
4: 124
Right 992884192 5:81141437-81141459 TATAGATTCTGAAGCAAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992884186 Original CRISPR CTGTGCCCCTTCCATAGTGA GGG (reversed) Intronic
901630776 1:10647141-10647163 CTGGGCCCCTTCCATGCTGTGGG + Intronic
903057932 1:20649277-20649299 CTGTTCTCGTTCCAGAGTGAAGG + Intronic
904475476 1:30762137-30762159 CTGGGCCCCTTCCACAGGCAGGG - Intergenic
908111027 1:60897462-60897484 CTATGCCCCTTCCTTAGTTCAGG + Intronic
908656484 1:66394258-66394280 CTCTGCCACATCTATAGTGATGG + Intergenic
910309718 1:85809610-85809632 CTGTGCCCCTTTTATTGTGATGG - Intronic
910712643 1:90197550-90197572 ATCTGCCCCTTCCATGGGGAAGG + Intergenic
916416764 1:164599578-164599600 CTGTGCCCCTCCCCTCCTGAGGG - Intronic
917001781 1:170368399-170368421 ATGAGCCCCTTCCACAGAGAAGG - Intergenic
917948302 1:180000706-180000728 CTGTTCCCTTTCCAGGGTGAAGG + Intronic
920972837 1:210757301-210757323 CTGTGCCCTGTCCATAATAAGGG + Intronic
922979165 1:229810644-229810666 CTGTGCCCCTTTCAATTTGAAGG - Intergenic
1064939277 10:20714502-20714524 CTGGGCCCCTTCCATAGGGAGGG - Intergenic
1065819435 10:29511397-29511419 CTCTGCACCTTCCAAAATGATGG + Intronic
1065953413 10:30673017-30673039 CTCTGCACCTTCCAAAGTGATGG - Intergenic
1067575118 10:47404041-47404063 CTGTCTCCCTCCCATAGAGAAGG - Intergenic
1070292332 10:75126010-75126032 CTGTGCCTTTTACATACTGATGG + Intronic
1074505321 10:114064906-114064928 CTATGGCCCTTCCAAAGTGGAGG - Intergenic
1078900804 11:15640661-15640683 CTGTGCCCCTGGCAAAGTGGGGG + Intergenic
1079402469 11:20116985-20117007 CTCTGCCTCTTCCCTAGTTATGG + Intronic
1083706518 11:64520167-64520189 CTGTGCCTTTTCCTTAGTGGTGG + Intergenic
1083742836 11:64720283-64720305 CCCTGCCCCTTCCACACTGATGG - Intronic
1085456328 11:76667502-76667524 CTGTGCGCCTTCAAGAGAGATGG - Intronic
1086993752 11:93333398-93333420 CTGTGCTCCTTCCATAGGGAAGG + Intronic
1087632714 11:100669683-100669705 ACATGCCCCTTCCATAGAGAAGG + Intergenic
1088996728 11:115007000-115007022 CTGTGCCCATATCATAGTGACGG - Intergenic
1091329283 11:134718105-134718127 TTCTGCCCATTCCTTAGTGAGGG + Intergenic
1091587212 12:1823063-1823085 CTGTGACTCTTCCATGCTGAGGG + Intronic
1091756457 12:3055669-3055691 CTGTGCCCCTTTCATCTTGACGG + Intergenic
1094674788 12:32609255-32609277 ATTGGCCCCTTCCATAGTGTAGG + Intronic
1096522049 12:52189881-52189903 CTGTGCCCCTGCCATGGGGATGG - Intronic
1100077334 12:90801850-90801872 TTGTGCCACTTCCCTAGAGAAGG + Intergenic
1102937962 12:116913132-116913154 CAGGGCCCCTTCCCTGGTGATGG - Intronic
1103933025 12:124460570-124460592 CTCTGCCCCCTCCATAGAGGTGG + Intronic
1104248886 12:127070587-127070609 CAGTGCCTCCTCCAAAGTGATGG + Intergenic
1108244620 13:48502237-48502259 CTCTGCCCCTGCCAAAGTGTTGG - Intronic
1111627049 13:90801628-90801650 CTGTGCCCTTTCCAAAGAAACGG + Intergenic
1111749428 13:92309259-92309281 CTGTGCCAGATCCCTAGTGAAGG - Intronic
1115568646 14:34647005-34647027 ATGTGCCCCTTCCAGAGTTCAGG - Intergenic
1116326689 14:43539315-43539337 CGGGACCCCTTCCAGAGTGAAGG + Intergenic
1116863241 14:50011021-50011043 CTGTTCTTCTTCCTTAGTGATGG - Intergenic
1121836403 14:97096427-97096449 CTGTCCCCCTTCCACATTTAAGG - Intergenic
1124622651 15:31284062-31284084 CTGTACCTCTTCCTTGGTGAGGG + Intergenic
1127130264 15:55855155-55855177 CTGTGTCCCTTTCTTAGTGCAGG + Intronic
1127356623 15:58207061-58207083 CTGGGTCCCTTCCATAATGTGGG - Intronic
1129801730 15:78420016-78420038 CTCCCCCCCTTCCAAAGTGATGG + Intergenic
1132718504 16:1304204-1304226 CTGTGCCGCTTCCTTGGTGGTGG - Intergenic
1132770080 16:1557108-1557130 CCGTGCCCCGGCCATATTGAAGG + Intronic
1137435481 16:48451290-48451312 CTGAGCCCCTTCCATTCTGCAGG + Intergenic
1137545815 16:49402466-49402488 CTGTTCCCAGTCCATGGTGAAGG - Intergenic
1146404687 17:32527114-32527136 CTGTCCCCCTTCACTGGTGATGG - Intronic
1148439972 17:47706955-47706977 CTGTCCCCATCCCATAGTGATGG - Intronic
1151697606 17:75725831-75725853 CTGAGCCCCTTCTAGGGTGAAGG - Intronic
1153070510 18:1099016-1099038 CTGGTCCCCTTCCAGAGTGTGGG + Intergenic
1153297880 18:3565032-3565054 CTGTGCCCCTTACTAACTGAGGG - Intronic
1153354171 18:4117719-4117741 CTGTGCCTTCTCCAGAGTGATGG - Intronic
1153382997 18:4458878-4458900 CTGCGCTTCTTCTATAGTGAGGG - Intergenic
1164497768 19:28784051-28784073 CAATCCCCCTTCCCTAGTGAAGG + Intergenic
928051433 2:28000570-28000592 GTGAGACCCTTCCATAGTAAAGG - Intronic
929431858 2:41893821-41893843 CTGGGCCCCTGGCTTAGTGATGG - Intergenic
929496599 2:42449972-42449994 CTGTGCTCTTTCCATTCTGAAGG + Intronic
931628775 2:64281026-64281048 CTGTGCCCCTTCACAAGTGGTGG + Intergenic
931975425 2:67638801-67638823 CTGTGATGCTTCCATAGTGACGG + Intergenic
939881687 2:147638902-147638924 ATGTGCCACTTCCAAAGTGAAGG - Intergenic
941698251 2:168576219-168576241 GTGTGCCCCTTTAATAGTAATGG + Intronic
942496908 2:176549477-176549499 CTTTCCTCCTTCCACAGTGAGGG - Intergenic
946977186 2:225166212-225166234 CTGTGCCTCTTTCTTAGTGGTGG + Intergenic
947332393 2:229043973-229043995 CTGGGCCCCTTCCATATTTCAGG + Intronic
947638632 2:231693697-231693719 CTGTTCCCCTTTCATCCTGAAGG + Intergenic
947929969 2:233956292-233956314 ATGTGCAACTTCCATATTGAAGG - Intronic
948437152 2:237961471-237961493 GTGTGCCCCACCCACAGTGAGGG + Intergenic
1169422155 20:5469483-5469505 CTTTGCCCTCCCCATAGTGAGGG - Intergenic
1169551520 20:6706365-6706387 CAGTGCCCCTTCCTTGGAGAAGG - Intergenic
1169573965 20:6937943-6937965 CTAAGCCCTTTCCATAGGGAAGG + Intergenic
1172152798 20:32802278-32802300 CCGTGCCTCATCCATAGTCAGGG + Intronic
1174178733 20:48661735-48661757 CTGTGCCCCTTTCATAGACGGGG + Intronic
1175274594 20:57759465-57759487 CTGTGGGCCTTCCAATGTGAGGG - Intergenic
1178622462 21:34188494-34188516 CTGTGGCCCTTGCAGAGTGTGGG - Intergenic
1179457947 21:41512556-41512578 TGCTGCCCCTTCCATACTGAAGG + Intronic
1179565402 21:42244807-42244829 GTGTGCCTCTCCCATAGGGAAGG - Intronic
1180246226 21:46549683-46549705 GTCTGCCTCTTCCATCGTGAGGG + Intronic
1182871743 22:33653684-33653706 CTGTGACCCTTTCTCAGTGAGGG + Intronic
1183833914 22:40436242-40436264 CTGTGCCCCTTCCTGTGTGCAGG - Intronic
1184737091 22:46405756-46405778 CTGTGCCCCTGCCACTGTGGTGG - Intronic
950081434 3:10224964-10224986 CTGTGCCCCTTTCACAGAGCAGG - Intronic
950872105 3:16238636-16238658 CTATGCAACTTCCAAAGTGATGG + Intergenic
951496533 3:23334382-23334404 CTGTGCCCCATCAATAGTGATGG - Intronic
952137207 3:30436653-30436675 CTGTGTCACTTGCAAAGTGAGGG - Intergenic
953253315 3:41265728-41265750 CTGTGGCCCTGCCTTAGGGAGGG - Intronic
954390300 3:50265017-50265039 CTGTTCCCCTTCCCTTCTGAGGG - Intergenic
957050237 3:75406141-75406163 CTGTGAACCCTCCATATTGATGG + Intergenic
960479743 3:118173049-118173071 CTTTGCCCCTTCCATCATGTGGG + Intergenic
961321770 3:126082067-126082089 CTGTGCCCCTTGCAGGGTGGGGG + Intronic
961365525 3:126396977-126396999 CAGTGCCCCTTCCTTAGAGATGG + Intronic
964376983 3:156057479-156057501 CTTCACTCCTTCCATAGTGAGGG - Intronic
964696856 3:159517994-159518016 TTTTGCCATTTCCATAGTGATGG - Intronic
971886795 4:32460569-32460591 CTTTCCCCCTTCCATTGTGCTGG + Intergenic
973650832 4:52995698-52995720 CTTTGCCCCTTTCCTTGTGATGG - Intronic
977045734 4:92066799-92066821 TTGTGCCCCTGCCCTAGAGAGGG + Intergenic
980453022 4:132999646-132999668 TTGTCCCCCTTCTATAGTCATGG - Intergenic
983184487 4:164685917-164685939 CAGTGCCTCTTCCAAAGAGAAGG + Intergenic
986483372 5:8211575-8211597 CAGTGCCCCTTCCATCATGGGGG - Intergenic
987367167 5:17159139-17159161 CTGTGCCCCACCTATTGTGATGG + Intronic
987719817 5:21618768-21618790 CTTTCCTGCTTCCATAGTGATGG + Intergenic
991249443 5:64543753-64543775 CTGTGCCCCAACAAAAGTGAAGG + Intronic
992884186 5:81141387-81141409 CTGTGCCCCTTCCATAGTGAGGG - Intronic
996679555 5:126216635-126216657 TTGTGCCCCTTCCTCTGTGAAGG - Intergenic
1006384904 6:33725319-33725341 CTGTGGCTCCTCCAGAGTGAAGG + Intronic
1009346301 6:62615801-62615823 CTATGGCCCTTCCAGAGTGCTGG - Intergenic
1017976225 6:159359770-159359792 ATGTGCCCATTCCATAGGGCAGG + Intergenic
1023126504 7:36959550-36959572 CTCTGCCTCTTCCTAAGTGAGGG + Intronic
1023703293 7:42913175-42913197 CTCTGCCCCTCCCATAATGCAGG + Intronic
1026933756 7:74239872-74239894 CCATGCCCCTTCCATGGGGAAGG - Intronic
1028281692 7:88937746-88937768 GTGTGCACCTTTCATATTGAAGG + Intronic
1029793841 7:102873298-102873320 CTGTGTCCCTTACACAGTCAGGG - Intronic
1032108441 7:129054756-129054778 CTTTGCTCCTTCCATGGTGGTGG + Exonic
1032265046 7:130364796-130364818 CTGTGCCCCTTGCATGGTTAGGG - Intronic
1034258695 7:149740101-149740123 CTGAGTCCCTTCCATAATGTGGG + Intergenic
1040546004 8:48398231-48398253 CTGGGCCCCTCCCATTGTCAGGG + Intergenic
1040607707 8:48951007-48951029 CTGTGCCCCTTCCATCCTGTGGG + Intergenic
1040871349 8:52102560-52102582 CTTTCCTCCTTCCATAGTGTAGG + Intergenic
1042693493 8:71529740-71529762 CTGTTCCCCTTGCACAGTGCTGG - Intronic
1043115470 8:76247796-76247818 CTGTGCTCCTTCCATAAGAAAGG - Intergenic
1043516617 8:81000753-81000775 CTGTGTTCATTCCAGAGTGAAGG - Intronic
1043993344 8:86782459-86782481 CTGTGCCTCTTTCCTAGTGTTGG + Intergenic
1046817112 8:118597067-118597089 CTGTGCCCCATGCATGCTGAGGG - Intronic
1048951171 8:139498088-139498110 CTGTGCCTCTCCCTTAGTGAGGG + Intergenic
1049523046 8:143104547-143104569 CTGTGCCCCTCTCTTAGTGATGG + Intergenic
1052981708 9:34454866-34454888 CTCTCCCCATCCCATAGTGATGG - Intronic
1053087199 9:35235680-35235702 CTGTGCACCTCCCAAAGTGCTGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1056528913 9:87469814-87469836 CTGTCCCCCACCCATGGTGAAGG + Intergenic
1056585854 9:87926679-87926701 CTGTAGCCTTTCCATACTGAGGG - Intergenic
1056611030 9:88126264-88126286 CTGTAGCCTTTCCATACTGAGGG + Intergenic
1057070431 9:92094290-92094312 CTGTTTCTCTTCCTTAGTGATGG - Intronic
1057161125 9:92889147-92889169 CTGTACCTTTTCCATACTGAGGG - Intergenic
1059774877 9:117464885-117464907 CTGTGCCCAGGACATAGTGAAGG - Intergenic
1062465317 9:136678251-136678273 CTGGGCCCCTGCCAGAGTGGGGG - Intronic
1062647246 9:137554689-137554711 CTCAGCCCCTTCCAAAGTGCTGG + Intergenic
1189099094 X:38170848-38170870 CTCTGCCCCTTCCAATATGAGGG + Intronic
1191588239 X:62852037-62852059 TTGTACCCCTTCCATTATGAAGG + Intergenic