ID: 992885398

View in Genome Browser
Species Human (GRCh38)
Location 5:81153972-81153994
Sequence GTGTTTTATAATGAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992885396_992885398 14 Left 992885396 5:81153935-81153957 CCAAAAAAAAAAAAAAACTTATT 0: 1
1: 56
2: 430
3: 2906
4: 12145
Right 992885398 5:81153972-81153994 GTGTTTTATAATGAAAACACAGG 0: 1
1: 0
2: 7
3: 46
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992885398 Original CRISPR GTGTTTTATAATGAAAACAC AGG Intronic
902463273 1:16596035-16596057 CTTTTTTTTAATGAAAATACTGG + Intronic
903158244 1:21464681-21464703 TTTTTTTTTAATGAAAATACTGG - Intronic
904223711 1:28995847-28995869 GTCATTTAGAATGAAAACATGGG + Intronic
904827989 1:33287929-33287951 GTGTTTTTTAACTAAAACAATGG - Intronic
905150629 1:35924263-35924285 GTGTTTTATAAAGACAACAGTGG + Exonic
906402958 1:45519271-45519293 CTGTTTTTAAATGAAAACAAAGG - Intronic
906727441 1:48054463-48054485 CTTTTTTCTAATGCAAACACTGG + Intergenic
906951357 1:50336578-50336600 GTGTTTTTGAAAGAAAACAAAGG - Intergenic
907669429 1:56461767-56461789 GTGTGGTTTACTGAAAACACAGG - Intergenic
908141586 1:61190475-61190497 CTGTTTTAGAAGGAAAATACTGG - Intronic
908379952 1:63588174-63588196 GGAGTTTATAATGAAAATACTGG - Intronic
908529544 1:65021243-65021265 GTATTTTAAAAGAAAAACACTGG - Intergenic
910446718 1:87305866-87305888 ATGTTTTGTTATGATAACACGGG + Intergenic
911121537 1:94301891-94301913 CTGTTTTATCATGAGAAAACTGG - Intergenic
911191847 1:94956217-94956239 GTGTTTTAGGATGATAACTCTGG + Intergenic
911224536 1:95290816-95290838 GTCTTTTAGAATGAAAAAAATGG - Intergenic
911427621 1:97740199-97740221 GTGATTTATCATGAAAATCCAGG - Intronic
912020274 1:105100129-105100151 TTGTTTTATAATGTTAATACAGG - Intergenic
912151914 1:106869978-106870000 GAGTTTTATTATAAAGACACAGG - Intergenic
912161000 1:106985142-106985164 GTGTTTTAGAATCAAGACAATGG + Intergenic
912221723 1:107685723-107685745 GTATTTTATATTGAAAAACCTGG + Intronic
912803970 1:112741581-112741603 GAGTTTTATCTTGAAAACAATGG + Intergenic
913543986 1:119848549-119848571 TTGTTTTTTAATGAAAATACAGG + Intergenic
913991380 1:143615494-143615516 TTTTTTTTTAATGAAAATACAGG + Intergenic
915501059 1:156318016-156318038 TTGTTTTATAATGATATAACTGG - Intronic
915742777 1:158131975-158131997 ATGTTTTAAAAAGAAGACACAGG - Intergenic
916458009 1:164991185-164991207 GTGTATTTAAATTAAAACACTGG + Intergenic
917128586 1:171715706-171715728 TTATTTTATAAAGAAAACACTGG + Intronic
917515884 1:175707898-175707920 GTGTTTTATAAAGAAAAAACAGG + Intronic
918851050 1:189691102-189691124 ATGTTGTATAATGAATACATTGG - Intergenic
918971808 1:191429487-191429509 GTGTATTATAATGAACACTCTGG + Intergenic
919546983 1:198935943-198935965 GACTTTTATAATTAGAACACAGG + Intergenic
919608479 1:199715884-199715906 CTGTTTTATAAAGAGGACACAGG - Intergenic
919998597 1:202777153-202777175 TTGTTTTAAAATTAAAACCCAGG + Intronic
921026718 1:211290728-211290750 GTGCTTTAAAAAGATAACACTGG - Intronic
921120792 1:212135144-212135166 GTGTTATAAAAGGCAAACACAGG + Intergenic
921245081 1:213229806-213229828 ATGTTTTAAAAAGAAAACCCTGG + Intronic
921371667 1:214429878-214429900 TTATTTTATAATGAACATACTGG + Intronic
921483835 1:215693540-215693562 GGGTCTTGAAATGAAAACACTGG - Intronic
921872912 1:220160465-220160487 TTATTTTATATTGAAGACACTGG - Intronic
922175510 1:223194132-223194154 GTGATTTATAAAGAAAATAAGGG + Intergenic
924357709 1:243200359-243200381 ATGTTTCCTAATGAAAGCACTGG + Intronic
924701197 1:246454824-246454846 CTGTTTAACAATGAAAAAACTGG + Intronic
924868607 1:248014790-248014812 GTATTTTATAATTACAACAGGGG - Intronic
1063068474 10:2634758-2634780 ATGTTTTATAAATAAAAGACTGG - Intergenic
1063175917 10:3550897-3550919 GAGTTGAACAATGAAAACACAGG + Intergenic
1063589718 10:7384496-7384518 GTTTTTAATAATGAAAATAACGG + Intronic
1063840516 10:10066438-10066460 GTGTGTTAAGATGAAAAGACAGG - Intergenic
1064329328 10:14379059-14379081 GTCTTTTATTGTGAAGACACAGG - Intronic
1064368858 10:14733257-14733279 CTGTTTTATTTTGAAAACGCAGG - Intronic
1064775415 10:18771733-18771755 GGGTTTTATAATGAAGAGAAGGG - Intergenic
1065165260 10:22970112-22970134 GTGATTAATGATGGAAACACAGG + Intronic
1067301572 10:45015242-45015264 GTATTTTCAAAGGAAAACACAGG - Intergenic
1067980613 10:51080230-51080252 GGGTCTTATAATGAAGATACTGG + Intronic
1068097699 10:52512444-52512466 ATGTTTTAGAATGAAAAATCTGG - Intergenic
1068195227 10:53707321-53707343 GAGTTGAATAATGAGAACACAGG - Intergenic
1068288208 10:54966840-54966862 GTAATTTATAAAGAAAACACAGG - Intronic
1068833463 10:61524681-61524703 ATGTTTTATATTGAAAACCCTGG - Intergenic
1069204055 10:65659649-65659671 TTGTTATATAAAGAGAACACAGG + Intergenic
1069229692 10:65994247-65994269 ATCTATTATCATGAAAACACAGG - Intronic
1069232191 10:66024648-66024670 CTGTTTGATAATGTAAACAATGG + Intronic
1069401367 10:68050426-68050448 TAGTTTTAAAATGAAAACAATGG - Intronic
1070259398 10:74839844-74839866 GTGTTTAGGAATGAAATCACTGG - Intronic
1071392307 10:85188197-85188219 GGGTTTTATGAGGAAAACAGAGG + Intergenic
1071832688 10:89387518-89387540 TTGTATTAAAATGAAAACAGTGG + Intronic
1072216344 10:93290478-93290500 GTGTTGGATGAAGAAAACACAGG + Intergenic
1074705275 10:116124529-116124551 GTGTTTAAAAAAGAAAAAACTGG - Intronic
1076211183 10:128646221-128646243 GTTTTATATAATGAAATCATAGG + Intergenic
1076216053 10:128694246-128694268 GTATTTTATAATGAGAACTGCGG + Intergenic
1076424384 10:130357166-130357188 TTGTTTTTTAATGTAAAAACAGG - Intergenic
1077738721 11:4820717-4820739 GTGCTTTATAAAGATAACATTGG + Intronic
1078228048 11:9411255-9411277 GTGCTTCACAACGAAAACACTGG - Intronic
1078562203 11:12382641-12382663 GTTTTTTCTTATGAAAACACAGG - Intronic
1078772409 11:14363381-14363403 GTCTTTTAAAATGAAGAAACTGG + Intronic
1079525762 11:21385724-21385746 GGTGTTTATAATGAAAGCACTGG - Intronic
1080329413 11:31118362-31118384 GTGTTTTATGATGAAAAAAATGG - Intronic
1080377193 11:31726152-31726174 TTTTTTTCTAATGAAAATACAGG + Intronic
1080499675 11:32857835-32857857 ATGTTTTAAAATGACCACACAGG - Exonic
1080614924 11:33937471-33937493 GTGTTTTCTCTTGATAACACTGG + Intergenic
1081283011 11:41233973-41233995 TTTTTTTTTAAGGAAAACACTGG + Intronic
1082212014 11:49517030-49517052 GTCTTTTATAATGAAAAAGTGGG - Intergenic
1083148555 11:60775894-60775916 GTCTTTTAGAAAGAAAGCACTGG - Exonic
1083701563 11:64482451-64482473 GGGTTTTATAATGATGACATGGG - Intergenic
1085380027 11:76107529-76107551 ATATGTTATAATGTAAACACTGG - Intronic
1086637572 11:89107489-89107511 GTCTTTTATAATGAAAAACTGGG + Intergenic
1086660719 11:89413147-89413169 ATGGCTTATATTGAAAACACAGG + Intronic
1088039619 11:105362692-105362714 GTGTTTTTAAATGAAGACAAGGG + Intergenic
1088586751 11:111366572-111366594 GTCTTTTAGAATGAGGACACAGG - Intronic
1089000559 11:115048659-115048681 GTGTTTTATTATAAAAATCCAGG + Intergenic
1090101427 11:123801160-123801182 GTGTTTGATATTGAAAAACCAGG + Intergenic
1090152084 11:124395669-124395691 AAGTTTTATAATGTAAACAATGG + Intergenic
1090468291 11:126955336-126955358 GTGGTTTTTAATTAATACACTGG + Intronic
1090917790 11:131181307-131181329 GTGTTTAATACAGAAAACAGAGG - Intergenic
1091074387 11:132601453-132601475 GTGCTTTCTAATCAAGACACAGG - Intronic
1091491144 12:933813-933835 ATGTGTTATAGTCAAAACACAGG + Intronic
1092008910 12:5093040-5093062 AAGTTTTACAATGAGAACACAGG - Intergenic
1093003612 12:14027626-14027648 GTGCTTCATAATGATGACACTGG + Intergenic
1093019345 12:14188671-14188693 GTGTTTCTTTATGAAAACACTGG + Intergenic
1093351198 12:18104849-18104871 GTGTGTTATAGTGGAAAGACTGG - Intronic
1093451571 12:19321838-19321860 ATGTTTCAAAATGAAAACACTGG - Intronic
1094388744 12:29924943-29924965 TCCTTTTATAATGAAAACAGTGG - Intergenic
1095254777 12:40022118-40022140 ATGTTTTAAAATGAACTCACAGG + Intronic
1095359427 12:41318635-41318657 CAGTTGTATAATGAAAACAGTGG + Intronic
1095674013 12:44895611-44895633 ATTTTTTATAATGGAAACATGGG - Intronic
1095701178 12:45192773-45192795 CTGTTTGATAATGAAGATACTGG + Intergenic
1096776487 12:53967394-53967416 GTTTTTTATGATGAAAACACAGG - Intergenic
1098766799 12:74500433-74500455 TTGTTTGAAAATGGAAACACTGG - Intergenic
1099126958 12:78773005-78773027 GTGTTTTATTATAAAAAGATTGG + Intergenic
1099415298 12:82377511-82377533 CTGTTTAATAATGAAAATACTGG + Intronic
1099557039 12:84122588-84122610 ATGGTTTATAAAGAAAACATTGG - Intergenic
1099611887 12:84883652-84883674 GTGTTTTATAGTGAAATCTAAGG - Intronic
1100396849 12:94193243-94193265 GTGTTTTAGAACGAGAACTCTGG + Intronic
1101023545 12:100577986-100578008 GGGCTTTATCCTGAAAACACTGG + Intronic
1101072529 12:101090824-101090846 GTGTTTTACTCTGACAACACTGG - Intronic
1101105628 12:101437192-101437214 GTGTATTATAATGATAACCTTGG + Intergenic
1103188303 12:118980458-118980480 TTTTTTTATAATGAAAACCCTGG + Intergenic
1104242015 12:126999435-126999457 GTGTTTGTTACTGAAAACACTGG - Intergenic
1104599238 12:130141385-130141407 GGGTTATATAATGAGAACACCGG + Intergenic
1105418848 13:20235299-20235321 GTAATTTATAAAGAAAAGACAGG + Intergenic
1106350902 13:28929895-28929917 GTGTTTTAAGAAGAAAACTCTGG + Intronic
1108235737 13:48403133-48403155 GTGTTTTTACATCAAAACACAGG - Intronic
1108771672 13:53709739-53709761 GTGTTATATAATGCAAGGACAGG + Intergenic
1109020141 13:57080532-57080554 GAGTTAAATAATGAGAACACAGG - Intergenic
1110922588 13:81107170-81107192 ATGTTTTATAAATAAAATACTGG + Intergenic
1111555506 13:89876129-89876151 CTTTTTTATACTGAAAAGACAGG - Intergenic
1111706826 13:91761018-91761040 TTGTTTTGTAATGAAGAGACAGG - Intronic
1111949068 13:94695535-94695557 GTATTTTATAAAGAAAAAATTGG - Intergenic
1112812886 13:103239384-103239406 GTGTTCTATAATGAAGTCATAGG + Intergenic
1113154516 13:107303599-107303621 GTTTGTAATAATGAAAACAGGGG - Intronic
1115297656 14:31847495-31847517 GTGTTAAATAAGCAAAACACAGG + Intronic
1115439792 14:33420499-33420521 GTGCTTTAAAAAAAAAACACAGG - Intronic
1115808523 14:37079535-37079557 GTGTTTTATGATGATCACTCCGG - Intronic
1116317856 14:43419673-43419695 GTGTATTATAATGAATACAATGG + Intergenic
1117385968 14:55213155-55213177 GTGGTTAACAATGAAAACAGAGG - Intergenic
1117817618 14:59613818-59613840 GGGTTTTATAAGGAAATCAGAGG - Intronic
1118338052 14:64871475-64871497 GTGTTATATGATGAACACAGTGG + Intronic
1119305504 14:73604938-73604960 GGGTTTCATAAGGAAAACAGAGG + Intergenic
1120027948 14:79607280-79607302 ATCTTTTCCAATGAAAACACAGG + Intronic
1120547941 14:85832921-85832943 GTATTTAATAAAGAAAACCCAGG - Intergenic
1120615466 14:86698627-86698649 GTGTTGGATAATGAGAAAACCGG + Intergenic
1122005027 14:98696147-98696169 GTGGATAATAATGTAAACACAGG + Intergenic
1202830607 14_GL000009v2_random:25399-25421 GTGTCTTTTAAAGATAACACAGG + Intergenic
1123927293 15:25128992-25129014 TTGTTTTACAATCAAAAGACCGG + Intergenic
1125171398 15:36770138-36770160 GTTTTTTAAAAAGAATACACAGG - Intronic
1125373321 15:39001119-39001141 GAATTTCATAATGCAAACACAGG + Intergenic
1126700601 15:51363404-51363426 GTGTTTGCTGATGAAAACATCGG + Intronic
1126820205 15:52495791-52495813 GAGTTTTTGAATGAAAACAAGGG - Intronic
1127245822 15:57173163-57173185 TTGTTTTAAAAAGAAACCACAGG + Intronic
1127523538 15:59769390-59769412 AAATTTTATAATGAAAAAACAGG + Intergenic
1128749020 15:70135222-70135244 GTGATTTATAAAGAAAAAAGAGG + Intergenic
1130457720 15:84129888-84129910 GTGTTTTATTATGCAACAACAGG - Intergenic
1131294570 15:91135891-91135913 GTGTTTTGTAATGAACAGAGAGG - Intronic
1131432913 15:92400982-92401004 GTGTTTTTATTTGAAAACACTGG + Intronic
1131458424 15:92601482-92601504 GTGTTTTAAAATGTAAGCTCTGG - Intergenic
1132107293 15:99072160-99072182 CTCTTCTATAATGAAAACAATGG - Intergenic
1133105335 16:3504304-3504326 GTGTTTTAAAATGTTAACAGTGG - Intronic
1134301872 16:12999133-12999155 GTGCCTTATAAAGAAAATACAGG - Intronic
1135420450 16:22302329-22302351 CTGTTTTATAATGAACAGACTGG - Intronic
1137050298 16:35705395-35705417 CTGTGTTTTAATCAAAACACAGG + Intergenic
1138108690 16:54306108-54306130 GTGTTTTACTCTGAAACCACTGG + Intergenic
1139082134 16:63535395-63535417 ATGTTTTATAGTGACAACTCAGG + Intergenic
1139104381 16:63809439-63809461 GTGTGCTCTAATGAAAACACTGG - Intergenic
1139252939 16:65513683-65513705 GTGATTTATAATGTAGACAAAGG + Intergenic
1147300947 17:39526936-39526958 GTGTATTATAAAGAAAAAAAAGG + Intronic
1147895296 17:43746767-43746789 GGGTTTGATGGTGAAAACACTGG + Intergenic
1149023034 17:51991975-51991997 ATGTTTTGTAATAAAAACAAAGG - Intronic
1149457905 17:56803379-56803401 GACTTTTATAATGAGATCACTGG + Intronic
1151111327 17:71681427-71681449 GTATTTTATATTGAAAAAAAAGG + Intergenic
1156145584 18:34173045-34173067 TTGTTGAATAATAAAAACACAGG - Intronic
1156671477 18:39474871-39474893 ATGTTTTATAGTGAAAGCAACGG - Intergenic
1156818433 18:41340653-41340675 CTGTTATTTCATGAAAACACAGG + Intergenic
1156901877 18:42309709-42309731 GGGCTTTATAATGAAAAGAGAGG + Intergenic
1156994946 18:43453830-43453852 GTGTTTTATATTGCAAGTACTGG + Intergenic
1158258745 18:55585706-55585728 TTGTTTTATATTGAAAACCTTGG + Intronic
1158806853 18:60983932-60983954 GGGTGTTTGAATGAAAACACAGG - Intergenic
1159696727 18:71567162-71567184 TTGTTTTTTATTGAAACCACTGG + Intergenic
1159765161 18:72480476-72480498 GAGTTTTAAAAGGAAAACAGAGG + Intergenic
1160032489 18:75274628-75274650 GTAGCTTATAATGAAAACAAAGG + Intronic
1160048858 18:75413034-75413056 GTGTCTCATAATCAGAACACAGG - Intronic
1160088761 18:75806137-75806159 GTGTTCTCAAAAGAAAACACTGG + Intergenic
1164245323 19:23423131-23423153 TTGTTTTATAAAGGAAACAAAGG + Intergenic
1164308737 19:24028410-24028432 TTGTTTTATAAAGGAAACAAAGG - Intergenic
1164451130 19:28365942-28365964 GAGTTTTGTAATGAACACAAAGG - Intergenic
1164784077 19:30915795-30915817 ATGTTTTATTATGAAAAAAGTGG - Intergenic
1165530116 19:36391775-36391797 CTGTTTTTTAATGAACAAACTGG + Intronic
1165945384 19:39438640-39438662 GTGTTTTCCAATGAAGACACAGG + Intronic
1167481852 19:49737362-49737384 CTGTTTTATAACAAACACACTGG - Intergenic
1202642090 1_KI270706v1_random:102379-102401 GTGTCTTTTAAAGATAACACAGG - Intergenic
1202678935 1_KI270711v1_random:33478-33500 CTTTTTTTTAATGAAAATACTGG + Intergenic
925308652 2:2866495-2866517 GTGTTTTATTAGGAAAAGAATGG + Intergenic
927065379 2:19465449-19465471 GTGTTTTGTTATGGAAACCCCGG - Intergenic
927240730 2:20917655-20917677 TTGCTTCGTAATGAAAACACAGG - Intergenic
928143031 2:28747186-28747208 GTCTTTTATATAGGAAACACTGG - Intergenic
928761896 2:34593821-34593843 TTTTTTTACAAAGAAAACACAGG + Intergenic
928829838 2:35467144-35467166 TTGTTTTATGATGCAAACAATGG + Intergenic
929167319 2:38895871-38895893 CTGTTTTCTAATAAGAACACAGG + Intronic
930886610 2:56333567-56333589 GCGTTTTAGAAAGAAAACCCTGG + Intronic
930890809 2:56384630-56384652 CTTATTTCTAATGAAAACACTGG - Exonic
931023750 2:58083391-58083413 TTGTTTTAAAATGTGAACACTGG + Intronic
931182210 2:59914403-59914425 TTATTTTATAATGAAAAAACAGG - Intergenic
932914459 2:75840321-75840343 GTGATTTCAAATCAAAACACTGG + Intergenic
933351977 2:81165007-81165029 CTGCTCTATAATGAAGACACTGG - Intergenic
933408028 2:81887643-81887665 GAGTTAAATAATGAAAACACAGG - Intergenic
933860089 2:86458021-86458043 GTTTTTGATAATTATAACACAGG - Intronic
933881489 2:86674221-86674243 CTGTTTTGTAAAGATAACACAGG + Intronic
936170994 2:110174035-110174057 TTGTTTTATAACCAAAACAAAGG - Intronic
936279637 2:111126189-111126211 GTATTTTTTAATGTAAAGACAGG + Intronic
937440773 2:121913657-121913679 GTTTATTATAAAGAAAACTCAGG - Intergenic
937606736 2:123809141-123809163 GAATTTCATAATGAAATCACAGG + Intergenic
937731919 2:125242817-125242839 GTAATTTATAAGGAAAACAGAGG - Intergenic
938267940 2:129942570-129942592 GAGTTGAATAATGAGAACACAGG - Intergenic
938656528 2:133440387-133440409 CTGTTGTTGAATGAAAACACTGG + Intronic
939083586 2:137689715-137689737 GTGTCTTAGAAAGAAAACACAGG + Intergenic
939422290 2:141988150-141988172 ATGATATATAATGAAAATACTGG + Intronic
940192761 2:151059921-151059943 TTTATTTATAATCAAAACACAGG + Intergenic
940234604 2:151496346-151496368 GTGTTATACAAAGAAAACATGGG - Exonic
940234660 2:151497011-151497033 GTGTTATACAAAGAAAACATGGG - Exonic
940234719 2:151497696-151497718 GTGTTATACAAAGAAAACATGGG - Exonic
940234848 2:151499368-151499390 GTGTTGTATAAAGAAAACGTTGG - Exonic
940662054 2:156558472-156558494 GTGTTTTAGAAAGAAAATTCTGG - Intronic
940876732 2:158905168-158905190 GGCTTTTATAATGTACACACAGG - Intergenic
941038566 2:160595028-160595050 TTCTTTTATAATGTAAACAATGG + Intergenic
941644056 2:168021046-168021068 GTGTTTAATAATAAAATGACAGG + Intronic
942761922 2:179409572-179409594 TTCTTTTCTACTGAAAACACAGG - Intergenic
943002351 2:182344320-182344342 ATATTTTAAAATGAAAACTCAGG + Intronic
943976610 2:194486880-194486902 GTTATTCAAAATGAAAACACAGG - Intergenic
944004390 2:194885620-194885642 GAGTTGAATAATGAGAACACAGG - Intergenic
944755203 2:202754586-202754608 GTAATTTATAAAGAAAACAGGGG + Intronic
944989537 2:205220143-205220165 GTGTTTTAAAATGATCACCCAGG - Intronic
945829091 2:214761105-214761127 GTATTTTATTATGAATACACTGG + Intronic
946541213 2:220686563-220686585 GTGCTTTATTATGAAATCATGGG - Intergenic
947073984 2:226320956-226320978 ATGTTTTCTAATGAAAGGACAGG - Intergenic
947687393 2:232100565-232100587 GTGAATAATAATAAAAACACTGG - Intronic
948584078 2:239007703-239007725 TTGGTTAATAAGGAAAACACGGG + Intergenic
1168784519 20:526454-526476 GTTTTTAATAATAAAAACAATGG + Intronic
1168794431 20:602148-602170 TTGTTTTACAATGAAAGCACAGG + Intergenic
1169855668 20:10099808-10099830 GTGATTTATAAAGAAAAAAGAGG - Intergenic
1169890044 20:10443008-10443030 GTGTTTCATATTGAAAATAATGG - Intronic
1169931824 20:10841771-10841793 ATTTTTTATAAACAAAACACAGG - Intergenic
1170756399 20:19210730-19210752 GTGTTTTCTAGTGAAAACGAGGG - Intergenic
1170928222 20:20745109-20745131 GTAATTTATAAAGAAAACAGAGG - Intergenic
1171564352 20:26165458-26165480 GTGTTTCAAAAGGAAAATACAGG + Intergenic
1173025441 20:39303481-39303503 TTTTTTAATAATGAAAACTCAGG - Intergenic
1177131553 21:17262354-17262376 GTGTGTTTTAATGAAATCAGGGG + Intergenic
1177477367 21:21641594-21641616 ATGTTTTATACTGTCAACACTGG - Intergenic
1177814160 21:25957976-25957998 GTTTTTTTTAATTAAAAGACAGG - Intronic
1177831789 21:26147514-26147536 GTGTATTATATTTAAAACACTGG - Intronic
1177906504 21:26977802-26977824 ATGTTTAATAAAGAAAATACTGG + Intergenic
1178466876 21:32857199-32857221 GTGTTCCATGAGGAAAACACAGG + Intergenic
1178512849 21:33220347-33220369 GTATTTAAAAAGGAAAACACAGG + Intergenic
1178753386 21:35325150-35325172 TTGTATTCTAAAGAAAACACAGG - Intronic
1181421758 22:22804472-22804494 GTGATTTATAATGAAAATAAAGG + Intronic
1181446403 22:22978580-22978602 GGGTTTTATGAGGAAAACAGAGG - Intergenic
1182178482 22:28318713-28318735 GTGTATCAAAATGAAAAAACAGG - Intronic
1182723308 22:32422171-32422193 GTGTTTTATAAAGATCACTCTGG + Intronic
1184078557 22:42200818-42200840 GTGTTTTATAAAGGAAACTCAGG - Intronic
950809104 3:15634212-15634234 TGGTTTTAAAATGCAAACACAGG + Intronic
952600775 3:35079545-35079567 TTGTTTTACAATGAAAGTACTGG + Intergenic
953013829 3:39053221-39053243 GTGTTTTATAAAGAAAGCCTAGG - Intronic
953690540 3:45114221-45114243 GTTTTTTAGGATGAACACACAGG + Intronic
955930487 3:64051540-64051562 GTGTTTTGTCATGATAAGACTGG - Intergenic
956304737 3:67811392-67811414 GTGGTTTATGGTGAAAACATTGG + Intergenic
956611434 3:71127559-71127581 GTGTTTTACCATGAAGAAACTGG - Intronic
957158118 3:76572394-76572416 TTGTTTTTTAATGAAATCATGGG + Intronic
957541202 3:81571387-81571409 ATGTTTTATAATGACAACACAGG + Intronic
958059212 3:88457260-88457282 GTGTTTTCCTATGAAAAGACTGG + Intergenic
958712686 3:97737195-97737217 GGATTTTATCATGAAAACAATGG + Intronic
958915067 3:100040657-100040679 GTGTTTCATGATAACAACACTGG - Intronic
959239917 3:103777080-103777102 GGGTCTAATAATGAAAAAACAGG + Intergenic
960607156 3:119518362-119518384 GAGGTTTCAAATGAAAACACTGG - Intronic
962719015 3:138155214-138155236 GTATCTTAAAATGCAAACACAGG - Intergenic
963083055 3:141412415-141412437 GTTTTCTAAAATGAAAGCACAGG + Intronic
963821781 3:149904568-149904590 ATGTTATAAATTGAAAACACAGG + Intronic
964124436 3:153221630-153221652 GTTTTTAAAAATGAAAACAATGG - Intergenic
964268310 3:154926128-154926150 ATCTTTTAGAAGGAAAACACTGG - Intergenic
964517873 3:157532209-157532231 CTGTTTTAAAATGCACACACTGG + Intronic
965238807 3:166165094-166165116 GTATTTTATAATGATAAAAAGGG - Intergenic
965369597 3:167844555-167844577 GTGTTTTATAATGAAAATTCTGG - Intergenic
965862908 3:173168815-173168837 GTGTTTTAAAATGATCACTCTGG + Intergenic
966650642 3:182296974-182296996 ATTTTGTGTAATGAAAACACTGG + Intergenic
966935108 3:184702298-184702320 GTGTTTTAAAATAGAATCACAGG + Intergenic
967417153 3:189232053-189232075 TTGTTTTATAAAGAAAAAAATGG + Intronic
967454312 3:189665091-189665113 GTGTAAAATAATGAGAACACAGG - Intronic
967753508 3:193141808-193141830 GTGCAATATAATGTAAACACAGG + Intergenic
968828127 4:2914695-2914717 GTGGTATATAATGGAAACACAGG - Intronic
969091314 4:4695868-4695890 CTGTTTTCTGATGCAAACACTGG - Intergenic
970620742 4:17815491-17815513 ATGTATTATATAGAAAACACAGG + Intronic
970777607 4:19694717-19694739 TATTTTTATAATGAAAACAGTGG - Intergenic
971087936 4:23300971-23300993 GTGTTTAGTAATGAAAAATCAGG - Intergenic
972426378 4:38937073-38937095 GTGTTTTAAAGAGAAAAAACAGG - Intronic
972507694 4:39735874-39735896 CTGTTTTTTAATAAAAACATAGG - Intronic
972629552 4:40831517-40831539 CTGTTTTCTAATCATAACACTGG - Intronic
974519570 4:62965682-62965704 GGGTTTTATAATAAAAATAAAGG - Intergenic
978325048 4:107543799-107543821 GTGATTTATATTAAAAACAATGG - Intergenic
978648653 4:110973090-110973112 GTGTTTAACAATGAGAACATGGG + Intergenic
979244098 4:118479121-118479143 ATGTTTCCTAATGAAAGCACTGG - Intergenic
980183183 4:129427534-129427556 GTGTCTTACAGTGAAAACAAGGG - Intergenic
980600424 4:135017961-135017983 GTATTTCATCATGACAACACTGG + Intergenic
980649308 4:135689546-135689568 GAGTTGAACAATGAAAACACAGG + Intergenic
980692684 4:136316501-136316523 GTGGTTTATCATGTAAACAAGGG - Intergenic
981012207 4:139936951-139936973 TTGCTATATAATGAAAACAAGGG + Intronic
981058442 4:140392182-140392204 GTGATTTATAATGGAGACTCTGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982270890 4:153586678-153586700 GTGTTTGCTATAGAAAACACAGG + Intronic
982352997 4:154436465-154436487 ATTTTTTAACATGAAAACACAGG - Intronic
982750397 4:159153950-159153972 ATGTTTAAAAATTAAAACACGGG - Intronic
983796137 4:171866176-171866198 GTGTTTTAAAATAAAAAAATTGG + Intronic
984694420 4:182765311-182765333 GTCTTTTATTATGAAGCCACAGG - Intronic
984784527 4:183555160-183555182 TTGTTTTACAATGATAACTCTGG - Intergenic
984866465 4:184284375-184284397 GTGTTTTTTATTGGAAGCACCGG - Intergenic
985275568 4:188234301-188234323 GTATTAGAAAATGAAAACACAGG + Intergenic
985424185 4:189812407-189812429 GTGTTTTATAAAGAAAACTTTGG - Intergenic
986511398 5:8510280-8510302 GAGTTGAATAATGAGAACACAGG - Intergenic
987442871 5:17978970-17978992 TTCTTATATAATGAAAAAACTGG + Intergenic
987745420 5:21965234-21965256 ATGATTCATAATGAAAACATTGG - Intronic
987865865 5:23537263-23537285 GAGTTTTTTAATGAAATAACTGG - Intergenic
987869993 5:23603752-23603774 GTGTTATATAATGAAAATATGGG - Intergenic
988035351 5:25821101-25821123 GTATCTTATTATGAAAACAAAGG - Intergenic
988842707 5:35098306-35098328 GGGTTTTAAAATGAGAAGACAGG + Intronic
988908897 5:35819927-35819949 GTGTTTAAAAATAAAAACAAAGG + Intergenic
989136598 5:38162054-38162076 GTGTTGTTGAATGAAAACAAAGG - Intergenic
989218986 5:38933911-38933933 GTGTTTTATAAAAAACTCACAGG + Exonic
990586192 5:57213349-57213371 ATGTTTTAGAAGGAAGACACCGG - Intronic
990673709 5:58161120-58161142 GTGTTGTTTAAAGGAAACACAGG + Intergenic
990807107 5:59676602-59676624 GTGTTTCATAAGGAAATCAAAGG + Intronic
990895765 5:60699218-60699240 ATGCATTATAATGAATACACAGG - Intronic
991765624 5:69975350-69975372 ATGATTCATAATGAAAACACTGG - Intergenic
991781698 5:70142811-70142833 ATGATTCATAATGAAAACACTGG + Intergenic
991844859 5:70850422-70850444 ATGATTCATAATGAAAACACTGG - Intergenic
991874141 5:71143125-71143147 ATGATTCATAATGAAAACACTGG + Intergenic
992149583 5:73889857-73889879 GTGTTTTAAAATGAGAATATGGG + Intronic
992885398 5:81153972-81153994 GTGTTTTATAATGAAAACACAGG + Intronic
993019433 5:82573529-82573551 GGGTTTATTAATGAAAACCCGGG - Intergenic
993237958 5:85339626-85339648 AGGTTTTAGAAAGAAAACACAGG + Intergenic
994077203 5:95666859-95666881 GTGTTTAATCATAAAAACATGGG - Intronic
994467927 5:100162412-100162434 GTGTTTCATAAGGAAAACAGAGG + Intergenic
994863098 5:105224466-105224488 TTGTTTGATAATGCAGACACTGG + Intergenic
995562127 5:113393921-113393943 GAGTTTTAGAGTGAAAAAACAGG - Intronic
995941496 5:117590689-117590711 GTCTGTTACAATGAAGACACTGG + Intergenic
997049890 5:130367294-130367316 ATGTTTTAAAATTAAAACAAAGG - Intergenic
998018239 5:138750079-138750101 GTAATTTATAAAGAAAAAACAGG + Intronic
999067024 5:148698314-148698336 GTGTTTTATAGTGAACACCGTGG - Intergenic
999598380 5:153232313-153232335 GTGATTTTTCATGAAAAAACTGG - Intergenic
999991226 5:157052025-157052047 TGGCTTTATGATGAAAACACAGG - Intronic
1000390737 5:160720384-160720406 GGAGTTTAAAATGAAAACACTGG + Intronic
1002561186 5:180083399-180083421 GTGTTTTAAAATGAGTACATGGG - Intergenic
1004232568 6:13846515-13846537 CTATTTTATAATCCAAACACTGG - Intergenic
1007004427 6:38347071-38347093 GTGTTTTAAAAAGAAAGAACAGG - Intronic
1008030752 6:46690460-46690482 GTGTCTTATGTTGAAAACCCTGG + Exonic
1008484545 6:52021368-52021390 GTGTTTTGAAATAATAACACGGG + Intronic
1009471915 6:64037124-64037146 GTATTTTATAATGATTACAGTGG + Intronic
1009511764 6:64560418-64560440 GTTTTTCTTAAAGAAAACACTGG + Intronic
1010305339 6:74314958-74314980 GTGTTTTAAAAAGAAAGCCCAGG + Intergenic
1010990977 6:82479736-82479758 GTGTCTAATTATGAAATCACTGG + Intergenic
1011074092 6:83419533-83419555 CTAGTATATAATGAAAACACTGG + Intronic
1011982463 6:93399189-93399211 GTGTTTTAAAATGAGAACAGTGG - Intronic
1011990420 6:93508667-93508689 GAGTTAAATGATGAAAACACAGG - Intergenic
1012056390 6:94416867-94416889 TTGGCTTATAATTAAAACACAGG - Intergenic
1012480441 6:99661225-99661247 CTCATTTATAATAAAAACACAGG - Intergenic
1012532557 6:100255569-100255591 GTGTTTGTTAAGGAGAACACTGG + Intergenic
1014060647 6:117067712-117067734 TTGTTTTGTACTGAAAGCACAGG + Intergenic
1014634054 6:123823184-123823206 GTGTTTTGTAAAGAAAATACAGG - Intronic
1016127153 6:140418343-140418365 GGTTTTTAAAATGAAAACAATGG - Intergenic
1016695755 6:146992975-146992997 GTGATTAAAAATGAAAACTCGGG - Intergenic
1016965305 6:149713139-149713161 GAGTATGATAATGAAAACAATGG + Intronic
1017040436 6:150304215-150304237 ATGTTTCATAATGAAAAGATGGG + Intergenic
1017523223 6:155220325-155220347 ATGTTTAATAGAGAAAACACAGG - Intronic
1018254950 6:161909084-161909106 GTATTTTATAAAGAAAGAACAGG - Intronic
1018256660 6:161926734-161926756 ATATTTTAAAATGAAAACATAGG + Intronic
1018629838 6:165812154-165812176 GTGGTTTATTATAAAGACACTGG - Intronic
1018636461 6:165863572-165863594 AAGTTTTATAAAGAAAACATGGG - Intronic
1018756165 6:166851443-166851465 GTGTCTCATAAAGAAAACGCCGG - Intronic
1019873297 7:3787666-3787688 GTATTTTATAAGGAAAGGACAGG - Intronic
1019891875 7:3954072-3954094 GTATTTTATACTGATGACACAGG + Intronic
1020403846 7:7808431-7808453 GTGTTTTATATTGTGAAAACTGG + Intronic
1020596419 7:10213023-10213045 GGGTTTCATAAGGAAAACAGAGG + Intergenic
1022831390 7:34070599-34070621 GTGTTTTATAAAACAAACTCTGG - Intronic
1023800397 7:43828911-43828933 GAGTTTTATAAGGAAAACAGAGG - Intergenic
1024206633 7:47168085-47168107 GTGTTTGATAATGAATGCATGGG - Intergenic
1024448424 7:49510057-49510079 TTGTTTTTTAATAAAAACAAGGG - Intergenic
1026222210 7:68410179-68410201 GTGTTTTATATGTAAAACAAGGG + Intergenic
1026664285 7:72328996-72329018 TTGTTTTAAAATGTAGACACCGG - Intronic
1027659097 7:80967511-80967533 GTGTTTTAAAATTAAAACACTGG + Intergenic
1027758496 7:82247611-82247633 GTGCTTTATCATGAAAACACAGG + Intronic
1028288787 7:89039765-89039787 GTGTGTTACAATAAAAAAACTGG - Intronic
1030104612 7:105976422-105976444 GTTTTTTAAAATGAGAGCACTGG - Intronic
1030152493 7:106421082-106421104 GGGATTTATAATAAAAACCCAGG - Intergenic
1030756199 7:113291012-113291034 GATTTTTATAAAGAGAACACAGG + Intergenic
1031320652 7:120323197-120323219 GAGTTGAATAATGAGAACACAGG - Intronic
1031590749 7:123589522-123589544 GAGTTGAATAATGAGAACACAGG - Intronic
1031772925 7:125868545-125868567 GGTTTTTAAAATCAAAACACTGG - Intergenic
1032987589 7:137356021-137356043 ATGTTATATAATGAAAAAAATGG - Intergenic
1033017695 7:137688718-137688740 GTTTTTAATTATGCAAACACTGG + Intronic
1033355676 7:140597600-140597622 GCTGTTTATAAAGAAAACACTGG + Intronic
1033491752 7:141850743-141850765 GTGTTTTCTAAAGGAACCACTGG - Intergenic
1033938859 7:146625461-146625483 ATGTTTTAAAAATAAAACACAGG + Intronic
1034486682 7:151369529-151369551 GTATTATATTATGAAAGCACAGG + Intronic
1035217423 7:157378716-157378738 GTTTTTTATAATAAAAATATTGG + Intronic
1036738637 8:11341548-11341570 GTGTTTTCTAATGCTAACTCTGG + Intergenic
1037107229 8:15124090-15124112 GTATTTTAGAATGACAACTCCGG + Intronic
1038179089 8:25209854-25209876 GTGTCTTTTGAGGAAAACACAGG - Intronic
1038375046 8:27032008-27032030 GTGTCATAAAATGAAAGCACAGG + Intergenic
1039469492 8:37804426-37804448 GTGTTTTCTGATGAAAATGCAGG + Intronic
1041602383 8:59735078-59735100 GTGTAACATAATGAAAACAAGGG + Intergenic
1042076042 8:64996072-64996094 TTATTTTATAAAGAAAATACAGG + Intergenic
1042080846 8:65049101-65049123 GTGTTTTACAATCAGAACAGTGG + Intergenic
1042813687 8:72854397-72854419 ATGTTTCATAATGCTAACACTGG + Intronic
1043228503 8:77767402-77767424 ATGTTTTATATTGAAAGCATAGG + Intergenic
1043625038 8:82245723-82245745 ATGTTTAATATTGAAAACATGGG - Intergenic
1044109656 8:88256209-88256231 GTCTTTGATAAAGAAAACAATGG - Intronic
1044338823 8:91023346-91023368 CAGTTTTATAAAGAAAACAAGGG + Intronic
1044568486 8:93691986-93692008 ACATTTTATAATGAAAACACTGG + Intergenic
1045088033 8:98708693-98708715 GTGTGATATTATGAAATCACAGG + Intronic
1045444896 8:102250567-102250589 GTTTTGTCTAATGAAATCACAGG - Intergenic
1045461317 8:102428126-102428148 GGGTTTGATAGTGATAACACTGG - Intergenic
1046020047 8:108654072-108654094 CTGTCTTATAATGAAAACAATGG - Intronic
1046073640 8:109289273-109289295 ATGTTTTAGCATGAAAAGACTGG - Intronic
1046785193 8:118258304-118258326 GTGGTTTATAATGAAAGCACAGG - Intronic
1047059408 8:121207387-121207409 GTATTTTTTGGTGAAAACACAGG + Intergenic
1047310763 8:123689892-123689914 GTGGTTTATTTTGAAAACACAGG + Intronic
1049095985 8:140548395-140548417 GTGGTTAAAAATAAAAACACTGG + Intronic
1049859186 8:144886168-144886190 GTCTTTAATAATAAAAACACAGG + Intronic
1050556099 9:6790894-6790916 AGGTTTTACTATGAAAACACAGG - Intronic
1050766211 9:9137897-9137919 ATATTATATAATGAAAACAATGG - Intronic
1050771441 9:9206348-9206370 ATGTTTTTTAAAGAACACACTGG + Intronic
1051115369 9:13688004-13688026 CTGGTTTATAATGAAAAAATGGG + Intergenic
1051219592 9:14833954-14833976 GGGTTTTATGAGGAAAACAGAGG - Intronic
1051410324 9:16782963-16782985 GTTTCATATAATGAAAACATCGG + Intronic
1051906271 9:22098341-22098363 TTATTTTAAAAAGAAAACACAGG + Intergenic
1052780393 9:32776891-32776913 TTGTTCTTTAGTGAAAACACAGG + Intergenic
1053433529 9:38059648-38059670 GTGTTTCAGAATCAAAACACGGG + Intronic
1053473281 9:38362218-38362240 GTGTTTTCTAAAGAAAACAATGG - Intergenic
1053589694 9:39499510-39499532 GTATTTTATAATAAGAACACAGG - Intergenic
1053625790 9:39868844-39868866 GTGATTTATAAAGAAAAAAGAGG - Intergenic
1053893588 9:42719974-42719996 GTGATTTATAAAGAAAAAAGAGG - Intergenic
1054218098 9:62381857-62381879 GTGATTTATAAAGAAAAAAGAGG + Intergenic
1054576601 9:66865797-66865819 GTATTTTATAATAAGAACACAGG + Intronic
1056871647 9:90287392-90287414 GTGTTTTATATTTTAAACAAAGG + Intergenic
1058214059 9:102210961-102210983 GTCTATTAAAATGTAAACACTGG + Intergenic
1058799898 9:108535412-108535434 GTGTTTTATAAAGATCACTCTGG + Intergenic
1058861483 9:109121259-109121281 GAGTTTTATAACCAAAACGCAGG + Intergenic
1059509257 9:114828654-114828676 GTGAATTATATTGAAAACAAAGG + Intergenic
1060364422 9:122995186-122995208 GTATTTTATAATTATTACACTGG + Intronic
1062310412 9:135932684-135932706 GTTTTTTAAAATGAAAAAAAAGG + Intergenic
1185510094 X:657589-657611 ATGTTTTATCATAAAAGCACAGG + Intronic
1185941015 X:4319141-4319163 GTGTTTCATAAAGAATACATCGG + Intergenic
1186278286 X:7964434-7964456 GAGTTTTTTAAGGGAAACACAGG + Intergenic
1187349774 X:18502277-18502299 GTGTCTTATCCTGAAAACATGGG + Intronic
1189695657 X:43659194-43659216 ATGTTTTATAATGACAAAAAAGG - Intronic
1189942031 X:46134593-46134615 GTGTTGAACAATGAGAACACAGG + Intergenic
1190982509 X:55468515-55468537 AATTTTTATAATGAAAAAACGGG - Intergenic
1190986190 X:55504668-55504690 AATTTTTATAATGAAAAAACGGG + Intergenic
1191755159 X:64584914-64584936 GTGTTCTTACATGAAAACACAGG - Intergenic
1192083184 X:68067994-68068016 CTGTTTTATAGTGAAGGCACTGG - Intronic
1193287362 X:79728102-79728124 TTGTTTTCTAATGAAATCCCAGG + Intergenic
1193729472 X:85085581-85085603 CAGTTTTATAATGAAAACAAAGG - Intronic
1194188986 X:90811164-90811186 ATGTTTTAAAATGAAAATGCTGG + Intergenic
1194197036 X:90907123-90907145 GTGAATTATAATGAAGAGACAGG + Intergenic
1196709451 X:118747517-118747539 GTGTTTTATTTTTAAAGCACTGG - Intronic
1197494931 X:127167258-127167280 GTTTTTTAAAATGAAAATAATGG + Intergenic
1197503329 X:127269359-127269381 GTGTTTCTTTATGAAAATACTGG + Intergenic
1198855522 X:141011180-141011202 GGGTTTCATAAGGAAAACAGAGG - Intergenic
1198876612 X:141235013-141235035 GGGTTTCATAAGGAAAACAGAGG + Intergenic
1198907173 X:141576188-141576210 GGGTTTCATAAGGAAAACAGAGG + Intergenic
1198909621 X:141598214-141598236 GGGTTTCATAAGGAAAACAGAGG - Intronic
1198917466 X:141689932-141689954 GGGTTTCATAAGGAAAACAGAGG + Intronic
1199994636 X:153014035-153014057 GGGTTTTACAAAGAAAACAGAGG + Intergenic
1200356104 X:155553399-155553421 CTATTTTATAATGATAACAGGGG - Intronic
1200542888 Y:4481327-4481349 GTGAATTATAATGAAGAGACAGG + Intergenic
1201049714 Y:9920239-9920261 GTTATTTCTCATGAAAACACAGG - Intergenic
1201255511 Y:12104339-12104361 ATGTGCTATAATGAGAACACAGG + Intergenic