ID: 992885508

View in Genome Browser
Species Human (GRCh38)
Location 5:81155631-81155653
Sequence GGTCTGGGGTAGCTCCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992885508_992885513 -4 Left 992885508 5:81155631-81155653 CCCATAAGGAGCTACCCCAGACC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 992885513 5:81155650-81155672 GACCATCCTGATATAGAAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 135
992885508_992885515 1 Left 992885508 5:81155631-81155653 CCCATAAGGAGCTACCCCAGACC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 992885515 5:81155655-81155677 TCCTGATATAGAAGCTGGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992885508 Original CRISPR GGTCTGGGGTAGCTCCTTAT GGG (reversed) Intronic
900006806 1:62426-62448 GGTTTGGGGTAGATCATTATAGG + Intergenic
900738274 1:4313990-4314012 GGCCTTGGGCAGCTCCTTAATGG + Intergenic
901087407 1:6619809-6619831 GGGCTGGGGCTGCTCCTTAAAGG - Exonic
903769468 1:25754717-25754739 GGTCTGGGGTAGGACATCATTGG + Intronic
906237195 1:44219201-44219223 TTTCTGGGGTAGCTTCTTTTTGG - Exonic
911010821 1:93279378-93279400 AGTCTGGGGTATGTCTTTATTGG - Intergenic
913201006 1:116495418-116495440 TGTTTGGGTTAACTCCTTATTGG - Intergenic
913664831 1:121037656-121037678 GCTCTGGAGTAGCTCCTCAAAGG + Intergenic
914016224 1:143820931-143820953 GCTCTGGAGTAGCTCCTCAAAGG + Intergenic
914161558 1:145140077-145140099 GCTCTGGAGTAGCTCCTCAAAGG - Intergenic
914654841 1:149729472-149729494 GCTCTGGAGTAGCTCCTCAAAGG + Intergenic
915832576 1:159145093-159145115 GACCTGGGCTAGCTCCTTAGGGG - Intronic
922530730 1:226342978-226343000 GGTCTTGGGTATGTCTTTATTGG + Intergenic
1075606569 10:123815773-123815795 AGTCTGGTGTACCTCCTCATGGG - Intronic
1076580055 10:131501505-131501527 GATGTGGGGTACCTCCTTGTGGG - Intergenic
1082143187 11:48633460-48633482 AGTCTTGGGTATTTCCTTATAGG + Intergenic
1083615981 11:64026872-64026894 GGTCAGGGGCAGCCCCTTAGAGG - Intronic
1089651290 11:119915153-119915175 GGTCTTGGGTATATCTTTATTGG - Intergenic
1099610051 12:84857051-84857073 GGTCTGGCAGAGCACCTTATGGG - Intergenic
1106152815 13:27122430-27122452 GGTCTTGGGTACATCTTTATTGG + Intronic
1107963162 13:45576509-45576531 GCACTGGGGAAGCTCCTTGTGGG + Intronic
1108971172 13:56379571-56379593 GGTCTCGGGTATGTCTTTATTGG - Intergenic
1111951885 13:94714039-94714061 AGTCTGGGCTAGCTCTTTTTTGG - Intergenic
1112196471 13:97231459-97231481 GGTCTGGGATGGCTCCTTGGAGG + Intronic
1112566021 13:100551966-100551988 TGGCTGGGGTAGCTCCCTGTGGG + Intronic
1118102232 14:62619612-62619634 GGTCTAGTCTAGCTCCTTTTTGG + Intergenic
1120688117 14:87562726-87562748 GGTCTTGGGTATGTCTTTATTGG + Intergenic
1121370161 14:93349499-93349521 GGACTGGGGTATAACCTTATAGG - Intronic
1121781510 14:96625085-96625107 GGTCTGGGGAAGCAGCTTGTGGG + Intergenic
1123027593 14:105434685-105434707 GAGATGGGGTAGCTCCATATTGG + Intronic
1131439836 15:92451366-92451388 AGCCTGGGGCAGCACCTTATCGG + Intronic
1132446656 15:101928208-101928230 AGTTTGGGGTAGATCATTATAGG - Intergenic
1138218486 16:55227030-55227052 CTTCTGGGGGAGTTCCTTATAGG + Intergenic
1139666776 16:68462866-68462888 GGTCTGGAGCATCTCCTCATTGG + Intergenic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1143742782 17:8966069-8966091 GGTCTGGGGTAGGGGCTTAGGGG + Intergenic
1146939132 17:36831978-36832000 GGTGTGGAGGAGCTCCTTGTTGG - Intergenic
1152401624 17:80070054-80070076 GGTCTGGTGTAGCCCCTCAAAGG + Intronic
1155639163 18:27992760-27992782 TGTATGGGGTTGATCCTTATCGG + Exonic
1157173540 18:45430065-45430087 GGTCTGGGGTGGGTCTTTCTTGG + Intronic
1160638563 19:104012-104034 AGTTTGGGGTAGATCATTATAGG + Intergenic
1160792725 19:929906-929928 GGTCTGGGGCAGGGCCTTCTGGG + Intronic
1161454617 19:4363786-4363808 CGCCTGGCGTAGCTCCTCATCGG + Exonic
1166164763 19:40979574-40979596 GGGCTGGGGGAGCTACTGATGGG - Intergenic
925396473 2:3536936-3536958 ACTCTGGGGTCTCTCCTTATAGG + Intronic
931778108 2:65557059-65557081 GGTCTGTGGTACCTTGTTATTGG - Intergenic
934846096 2:97662256-97662278 ATTCTGGGCTAGCTCCTTGTTGG - Intronic
935407760 2:102726892-102726914 GCTCTGGGCTATCTCCTTCTCGG - Exonic
937836122 2:126471867-126471889 GGTCTGGGGCAGCTCCTCTCTGG + Intergenic
939632097 2:144537499-144537521 GGTTTGGGGCTGCTCCTTAGGGG + Intergenic
946581127 2:221129088-221129110 AGTCTTAGGTAGTTCCTTATAGG + Intergenic
947044459 2:225965061-225965083 AGTCTGGTGAAGGTCCTTATGGG - Intergenic
947299113 2:228668216-228668238 GGTCTGGGGTGGGACCTTAGTGG + Intergenic
947500563 2:230668084-230668106 AGTCTGGGGTCCCTCCTTCTGGG - Intergenic
1170587014 20:17742489-17742511 GGTCAGGGGAGGCTCCTTGTTGG + Intergenic
1173799105 20:45883704-45883726 GGGCTGGGGCTGCACCTTATGGG - Exonic
1175878647 20:62243676-62243698 GGTCTGGGGTGGGTCCTCAGCGG + Intronic
1179279983 21:39925769-39925791 GGGCTGGGGAAGCTCCTCACAGG + Intronic
1180248822 21:46565987-46566009 GGTCTGGTATTGCTCCTTGTGGG + Intronic
1180319292 22:11305984-11306006 AGTCTGGGGTATGTCTTTATTGG - Intergenic
1181259252 22:21585622-21585644 GGGCTTGGGGAGCTCCTTAGAGG + Intronic
1184879999 22:47298655-47298677 GGTCAGGGGTAGCTCCTCAAGGG + Intergenic
952212345 3:31241093-31241115 GGTCAGGGGTAGCTTCTTGGAGG - Intergenic
954700641 3:52449070-52449092 GGTCTGGGAAAGCTCCCTAGAGG - Intergenic
955149907 3:56356700-56356722 GGTCAGGGTTAGCTTCTTAGAGG - Intronic
956518911 3:70082356-70082378 GGCCTAGGTTAGCTCCTTCTGGG - Intergenic
959021740 3:101195068-101195090 AGTCTCGGGTAGTTCCTTATAGG - Intergenic
970707844 4:18826505-18826527 AGTCTGGGGTATGTCTTTATTGG - Intergenic
970977541 4:22058284-22058306 GGTCTTGGGTATGTCTTTATCGG + Intergenic
974900276 4:67988150-67988172 AGTCTGGGGTATGTCTTTATTGG + Intergenic
992885508 5:81155631-81155653 GGTCTGGGGTAGCTCCTTATGGG - Intronic
997229539 5:132232553-132232575 GGTTTGGGGTAGTCCCGTATGGG + Intronic
1001515515 5:172352847-172352869 AGTCTGGGGTATATCTTTATCGG + Intronic
1013227898 6:108133899-108133921 GGGCTGGGGCAGCTCCGTGTGGG - Intronic
1014425790 6:121304070-121304092 GGTCTGCGTTAGGTTCTTATTGG - Intronic
1019859223 7:3642032-3642054 GGTCTGGGGTAGCTGGTGATGGG - Exonic
1021027606 7:15687557-15687579 GATCTGGGCTAGCTCCTGAGGGG - Intergenic
1029228673 7:99048087-99048109 GGCCTGGGGTACCTCCTTTATGG - Intronic
1035418783 7:158709981-158710003 GCTCAGGGGTATCTCCTTAGTGG + Intergenic
1038513537 8:28163056-28163078 GGAATGGGGAAGCTCCTGATGGG - Intronic
1038699432 8:29836033-29836055 AGTCTGGGTTAGCTCTTTTTTGG + Intergenic
1039468507 8:37799739-37799761 GCTCTGGGGCTGCTCCTTAAAGG - Intronic
1040110444 8:43564828-43564850 GGTCTGGTGCAGTTCCTAATGGG + Intergenic
1042755705 8:72208287-72208309 GGTCTGTGGTGGTTGCTTATTGG - Intergenic
1043866708 8:85383113-85383135 ACTCTTGGGTAGCTCCTTGTGGG - Intronic
1050650116 9:7766914-7766936 TGTCTGGGGAAGCTCCTTGCTGG + Intergenic
1051573215 9:18583704-18583726 GGTCTTGGGTAGCTCCGTCCTGG - Intronic
1052179479 9:25506514-25506536 AGTCTTGGGTAGTTCTTTATGGG - Intergenic
1053470186 9:38340668-38340690 AGTCTTGGGTATATCCTTATTGG + Intergenic
1056650254 9:88453444-88453466 GGTCTGGGGAATCTCATTAGAGG + Intronic
1058276642 9:103049967-103049989 GGTCTGGGGAAGGTCCATATTGG + Intergenic
1059652330 9:116326388-116326410 GGGCTGGGGAAGCTGCTTATAGG + Intronic
1185432103 X:17421-17443 GGTCTGGGGTTGGTACTTTTGGG - Intergenic
1185441419 X:230135-230157 GGTCTGGGGTTGGTACTTTTGGG - Intergenic
1190463346 X:50700971-50700993 ACTCTGGGGCAGCTCCTTGTAGG - Intronic
1192529967 X:71875351-71875373 GGTCCGGGGTAGCTCTTGCTAGG + Intergenic
1199188962 X:144948983-144949005 GGACTGGGGTTTCTCCTTTTGGG - Intergenic
1202085636 Y:21133687-21133709 AGTCTCGGGTATCTCTTTATTGG + Intergenic