ID: 992886140

View in Genome Browser
Species Human (GRCh38)
Location 5:81162191-81162213
Sequence GGGGGTGGTGGGGGACATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2723
Summary {0: 1, 1: 1, 2: 18, 3: 257, 4: 2446}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992886127_992886140 15 Left 992886127 5:81162153-81162175 CCTTTGCTCTGCTGGAATTTCTT 0: 1
1: 1
2: 0
3: 30
4: 415
Right 992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG 0: 1
1: 1
2: 18
3: 257
4: 2446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992886140 Original CRISPR GGGGGTGGTGGGGGACATGG GGG Intronic
Too many off-targets to display for this crispr