ID: 992888552

View in Genome Browser
Species Human (GRCh38)
Location 5:81183159-81183181
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888550_992888552 3 Left 992888550 5:81183133-81183155 CCAAGCATGGTAACAGTTACATT 0: 1
1: 0
2: 0
3: 13
4: 160
Right 992888552 5:81183159-81183181 TCTCACATGGTGAACTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr