ID: 992888624

View in Genome Browser
Species Human (GRCh38)
Location 5:81183751-81183773
Sequence GCTCCTGTGGGGCCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 236}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888619_992888624 -5 Left 992888619 5:81183733-81183755 CCAGCTCTGCCAACTGTAGCTCC 0: 1
1: 0
2: 2
3: 31
4: 222
Right 992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
992888618_992888624 9 Left 992888618 5:81183719-81183741 CCAGTGTTCTTACTCCAGCTCTG 0: 1
1: 3
2: 8
3: 53
4: 470
Right 992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
992888617_992888624 23 Left 992888617 5:81183705-81183727 CCAGAGTCAGGGGACCAGTGTTC 0: 1
1: 0
2: 0
3: 13
4: 118
Right 992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236
992888616_992888624 24 Left 992888616 5:81183704-81183726 CCCAGAGTCAGGGGACCAGTGTT 0: 1
1: 0
2: 0
3: 16
4: 159
Right 992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888624 Original CRISPR GCTCCTGTGGGGCCCCAAGC TGG Intronic
900123267 1:1058630-1058652 GCTCCTGGAGGGCTCCAAGCAGG + Intergenic
900360596 1:2287077-2287099 GCTGCTGTGGGGCCTGCAGCTGG - Intronic
900419680 1:2550477-2550499 GGTCCCCTGGGGCCCCATGCTGG + Intergenic
900425543 1:2576794-2576816 GGTCCCCTGGGGCCCCATGCTGG - Intergenic
900552390 1:3263373-3263395 TCTCCCGTGGGGCCCCCCGCAGG + Intronic
901056349 1:6450263-6450285 GCTGCTCTGGGGCCCCATGAGGG - Intronic
902466851 1:16623921-16623943 GCTCCCGGCGGGCCTCAAGCTGG + Intergenic
902477997 1:16698222-16698244 GCTGCTCTGGGGCCCCATGAGGG + Intergenic
902507751 1:16948853-16948875 GCTCCCGGCGGGCCTCAAGCTGG - Exonic
902549751 1:17212256-17212278 GCACCTGTGGGGCTCCTGGCAGG + Intronic
903875719 1:26472088-26472110 CCTCTTCTGGGGCCCCCAGCGGG + Intergenic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904585102 1:31575903-31575925 GCTCGTCTAGGGGCCCAAGCAGG + Intergenic
905441486 1:37999145-37999167 GCTCCTGTGGGGAACACAGCAGG + Exonic
906077472 1:43062802-43062824 GCTTCCATGGGGCCCCAAGGTGG - Intergenic
906847867 1:49213917-49213939 GTTCCTGTGGCCCCCCAACCTGG + Intronic
908509663 1:64841401-64841423 GCTCCTGTTTCTCCCCAAGCTGG + Intronic
909481033 1:76129195-76129217 TTTCCTGTGGGGTCCCAAGGAGG + Intronic
913280513 1:117180949-117180971 GCTCCTGTGGAGCCCCCATTAGG - Intronic
913501093 1:119473395-119473417 GGCCCTGTGGGGCCCCAAGAAGG + Intergenic
915708194 1:157867295-157867317 GCCCCTGTGGTACCCCAAGTGGG - Intronic
916576318 1:166070273-166070295 CCTCATGTGGAGGCCCAAGCGGG - Exonic
916999159 1:170337270-170337292 GCTCCTGAGGGTCCCCAAAAAGG + Intergenic
918014288 1:180617929-180617951 GCTCCTGGGTGGTCACAAGCTGG + Intergenic
919822555 1:201482263-201482285 GAGCCTTTGGGGCCCAAAGCTGG - Intergenic
920342865 1:205286580-205286602 GCTTCTGTGAGGCCCCATGAAGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
923521890 1:234741303-234741325 GCTTCTGTAGGGTCCCGAGCAGG + Intergenic
1064750336 10:18521932-18521954 TCTGCTGTGTGGCCCCTAGCAGG - Intronic
1065206029 10:23358516-23358538 GCTCCAGTGCTGCCCCCAGCTGG + Intergenic
1065384924 10:25125253-25125275 GCTCCCGGGGGCCCCCAATCTGG - Intergenic
1065467979 10:26045698-26045720 GCTCCTTTTGCTCCCCAAGCAGG + Intronic
1068955773 10:62817874-62817896 CCTCCTGTGGGGCCCCGGACAGG - Intronic
1071355003 10:84784966-84784988 GGTGCTCTGGGGTCCCAAGCTGG + Intergenic
1073008557 10:100342611-100342633 GCTCCTCCTGGGCCCCAGGCTGG - Intergenic
1076461244 10:130648979-130649001 GTCCCTGTGGGGCACCAGGCTGG + Intergenic
1076769794 10:132656691-132656713 GGTCCTGAAGGGCACCAAGCAGG + Intronic
1076856391 10:133117399-133117421 GCCTCTGTGGGGCTCCAGGCTGG - Intronic
1077222046 11:1422139-1422161 GCTCATGGGGGGCCCACAGCTGG - Intronic
1077492571 11:2868917-2868939 GGTGCTCTGGGGCCCCAAGGAGG - Intergenic
1078561533 11:12377397-12377419 GCCCCTGGGTTGCCCCAAGCAGG - Exonic
1079112439 11:17612422-17612444 CCTCCTGTGGGACCCCGACCTGG + Intronic
1081612468 11:44570857-44570879 TATCCTGTGGGGACTCAAGCTGG + Intronic
1081807585 11:45898952-45898974 GCTCCTCTGAGCCCCCAAGAGGG + Intronic
1083637832 11:64129838-64129860 CCTCCTGTGCGGCCCAAACCTGG - Intronic
1083721540 11:64606087-64606109 GCTCTTGTGGGCCCCCATGTGGG + Intergenic
1084275215 11:68047824-68047846 GGTGCTGCGGGGCCCCCAGCCGG - Intronic
1084730605 11:71070895-71070917 GCTCCAGGAGGGTCCCAAGCTGG - Intronic
1085022698 11:73219073-73219095 GCTCCTGGAGGACCCCAAGAGGG - Intronic
1086154624 11:83652174-83652196 GCTGCTTTGTGGCTCCAAGCTGG - Intronic
1086701047 11:89900898-89900920 GCTCCTGTGTGGCAGCCAGCTGG + Intergenic
1086705121 11:89943629-89943651 GCTCCTGTGTGGCAGCCAGCTGG - Intergenic
1090274865 11:125412028-125412050 GCTCAGGTGGGGCCTAAAGCTGG + Intronic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1096214569 12:49792155-49792177 GCTCCAGAGGGGGCCCAAGGTGG + Intronic
1102986685 12:117284209-117284231 GATCCTGTGTGGCTCCAAGATGG + Intronic
1106006361 13:25773576-25773598 GCTGCTGGTGGGTCCCAAGCTGG - Intronic
1107418296 13:40221623-40221645 ACCACTGTGGGGCCCCAAACTGG + Intergenic
1111604504 13:90520039-90520061 GCTGCTGTGTGTTCCCAAGCTGG - Intergenic
1112247431 13:97747629-97747651 GCTCAGGTGGGGCCCCTAGAGGG + Intergenic
1112502816 13:99955744-99955766 GCTCCTGGGGGAACCCAGGCCGG + Intergenic
1113513492 13:110873374-110873396 GCTCCTGAGCGGACCCCAGCAGG + Intergenic
1113908870 13:113832484-113832506 TCTCCTGTGGGTGCCCAGGCTGG - Exonic
1114083531 14:19220640-19220662 GCTCCCGTGGGACCCTCAGCAGG + Intergenic
1119199136 14:72740188-72740210 GCCCCTGTAGCTCCCCAAGCTGG - Intronic
1119309530 14:73634311-73634333 GCTCCTGTGGAGCCTCATGCCGG + Intergenic
1120765612 14:88324246-88324268 ACCCCTGTGGGGCTTCAAGCAGG - Intronic
1121231966 14:92364917-92364939 GCACCTTTGGGACCACAAGCAGG - Intronic
1121439760 14:93941288-93941310 CCTCCTGTGGGACTCCAAGGAGG + Intronic
1122263126 14:100534455-100534477 GCTCCTGTGGGGCTCCCAAGGGG - Intergenic
1122957503 14:105077709-105077731 ACTGCTGTGAGACCCCAAGCAGG + Intergenic
1124621156 15:31274859-31274881 CTTCCTGTGGGGCCCCTGGCTGG - Intergenic
1129897305 15:79117878-79117900 TCATCTGTGGGCCCCCAAGCTGG - Intergenic
1130909648 15:88262290-88262312 GCTCCTGCAGGGCCCCCACCAGG - Intergenic
1131066510 15:89438254-89438276 GCCCCTGTGGGACCTCAAGCAGG - Intergenic
1132302966 15:100787828-100787850 GCTGCTGTGGGGAGCCAGGCAGG + Intergenic
1132584970 16:702120-702142 GCTCCTGCGGGGCCCCCACATGG - Intronic
1132590213 16:723302-723324 GCTCCTGTGGCGCCCCCCCCAGG + Intronic
1132959176 16:2612712-2612734 GCTCCTGTGGGGCCATGGGCAGG - Intergenic
1132972236 16:2694687-2694709 GCTCCTGTGGGGCCATGGGCAGG - Intronic
1133465231 16:6020978-6021000 GCTCCTGTGTGGGCCAGAGCTGG + Intronic
1133619462 16:7512703-7512725 GCACCAGTGGTGCCCCCAGCTGG + Intronic
1134198094 16:12174549-12174571 GCTCCTTTGTTGACCCAAGCTGG + Intronic
1135415221 16:22263809-22263831 GATCCTGTGAGGCCCCAGGGAGG + Intronic
1136001619 16:27298895-27298917 GCTACTGTGGGGGCTGAAGCAGG + Intergenic
1137559186 16:49492286-49492308 GGTCCTGTGCGGCCCCAAACAGG - Intronic
1141642838 16:85351287-85351309 GCTGCTGTGGGTCCTCAAACTGG + Intergenic
1141722384 16:85763594-85763616 CCTCCTGTGGGGTGCCAGGCCGG + Intergenic
1142188088 16:88704023-88704045 GCTCCTGCTGGGCCCCCAGGGGG + Intronic
1142869324 17:2809935-2809957 GCTCCTCTGGGGCAGCTAGCAGG + Intronic
1144724971 17:17497104-17497126 GCTCCTGTTGGGCCCCAGCAAGG - Intergenic
1144960446 17:19041505-19041527 GCTGCTGTGTGGCCTCAGGCAGG - Intronic
1144974714 17:19133019-19133041 GCTGCTGTGTGGCCTCAGGCAGG + Intronic
1145207904 17:20994470-20994492 GCTCCTGTGGGACCCTCAGTAGG - Intergenic
1146128469 17:30249030-30249052 GCTCCCATGGGGTCCCATGCTGG + Exonic
1146352999 17:32111531-32111553 GGTGCTGTGGCGCCCCCAGCAGG + Intergenic
1146539299 17:33680641-33680663 TCTCCTGCTGGGCGCCAAGCAGG + Intronic
1146721803 17:35129299-35129321 GCTCCTGCTGGGGCCCAGGCAGG - Intronic
1152744736 17:82033481-82033503 CCTCCTGGTGGGCACCAAGCTGG + Exonic
1152846893 17:82606210-82606232 GCTCCACTTTGGCCCCAAGCTGG + Intronic
1152848279 17:82615894-82615916 GGTGCTGTGGCGCCCCCAGCTGG + Exonic
1152868621 17:82738517-82738539 GCTCCTGAGGGCCTCCAGGCTGG - Exonic
1154500209 18:14992302-14992324 GCTCCTGTGGGACCCTCAGCAGG + Intergenic
1155555923 18:27019231-27019253 GCTACTGTGGGTCCACAAACCGG - Intronic
1156999756 18:43510416-43510438 TCATCTGAGGGGCCCCAAGCAGG + Intergenic
1157622232 18:49023292-49023314 GCTACTGTGAGGTCCCATGCTGG + Intergenic
1160535652 18:79590011-79590033 TCCCCTGTGGGGCCCCAGGAGGG - Intergenic
1160621141 18:80171397-80171419 GCTGCTGTGGCGCCCCCTGCTGG - Exonic
1160930030 19:1566265-1566287 GCTCATGTGGGGACCCACGGAGG - Intronic
1161412574 19:4124427-4124449 GAGCCTGTGGTGCCCCAGGCTGG + Intergenic
1162926312 19:13932046-13932068 GCTCCTCTAGGGCCTCAGGCAGG + Intronic
1164630971 19:29761211-29761233 CCTGCTGTGTGGCCCCAGGCAGG + Intergenic
1165668542 19:37655291-37655313 GTTCCTGTGGAGCCTCAGGCCGG - Exonic
1165829268 19:38722492-38722514 GCCCCAGTGGAGCCCCATGCTGG + Intronic
1166502917 19:43354364-43354386 GGGGCTGTGGGGCCCAAAGCGGG - Exonic
1166538934 19:43593116-43593138 GGTGCTGTGGGGACCGAAGCAGG + Exonic
1167148222 19:47694964-47694986 GCTGGTGAGGGGCCCCAGGCTGG - Exonic
1202712017 1_KI270714v1_random:24049-24071 GCTGCTCTGGGGCCCCATGAGGG + Intergenic
925012824 2:498419-498441 GCTGCTGTGAGCCCCCAAGTAGG - Intergenic
926063948 2:9822336-9822358 GCTCCTCTGGGGTCCCATTCTGG - Intergenic
928519136 2:32071116-32071138 GCTCCTGTGGGTAGACAAGCCGG + Intronic
930021325 2:47003828-47003850 GCCCCTGTGGGTCCCCACCCTGG + Intronic
930358237 2:50346913-50346935 GCTCCGGTGCGGCGCCGAGCTGG - Intronic
932570082 2:72934006-72934028 GCCCCTGCGTGGGCCCAAGCTGG + Exonic
935666268 2:105515834-105515856 GCTCCTGTGTGCCCCAGAGCAGG + Intergenic
936025846 2:109030656-109030678 ATGCCTGAGGGGCCCCAAGCTGG - Intergenic
937354229 2:121187960-121187982 GCTGCTCTGGGGGCCCAGGCAGG + Intergenic
938493054 2:131775992-131776014 GCTCCTGTGGGACCCTCAGCAGG - Intergenic
938875515 2:135528176-135528198 TCTCCTGTGTTGCCCCAGGCTGG + Intronic
944605514 2:201348459-201348481 GCTCCTGAGGGCCCCAAAGTAGG + Intronic
947595666 2:231410030-231410052 GCTCCAGTGGGGCCCCACTCTGG + Intergenic
948900857 2:240956250-240956272 GCTCATGGGAGGCCCCCAGCTGG - Intronic
948944462 2:241212404-241212426 CCTCCTGTGGACCCCCGAGCTGG - Intronic
1168806823 20:676502-676524 GCTCCAGTGGGAGCCCGAGCAGG - Intergenic
1171239061 20:23550692-23550714 GCTCCTGTGGGAGTCCAGGCTGG - Intergenic
1171439144 20:25147257-25147279 GGTCCTGGGGGGTCCCCAGCAGG + Intergenic
1172121038 20:32598838-32598860 GCCCCTGTGGAGCCCTCAGCTGG - Intronic
1172208596 20:33181892-33181914 GCTCCAGTGGGACCCCTAGAGGG - Intergenic
1173808005 20:45938836-45938858 GCTGCTGTGTGGCACCATGCTGG + Intronic
1174325478 20:49775374-49775396 GCTCCTGTGTGGCCAGCAGCTGG - Intergenic
1176093374 20:63328764-63328786 TCTCCTGTGTGGCCCTAAGCAGG - Intronic
1176118904 20:63445419-63445441 GCTCCTGTGGGTGTCCAGGCTGG - Intronic
1176168664 20:63687435-63687457 CCCCCAGAGGGGCCCCAAGCTGG + Intronic
1176211936 20:63928720-63928742 GCTCCTGTGAGGCCTCAAACAGG - Intronic
1176614842 21:9018396-9018418 GTTCCTGTGGGACCCTCAGCAGG + Intergenic
1176710366 21:10145475-10145497 GCCCCTGTGGGACCCTCAGCAGG - Intergenic
1178672573 21:34604795-34604817 CCAGCTGTGGGGCCCCAGGCTGG - Intronic
1180096984 21:45560345-45560367 GCTCCTGTGGGGGCCATAGTGGG - Intergenic
1180294444 22:10872627-10872649 GCTCCCGTGGGACCCTCAGCAGG - Intergenic
1180497250 22:15902041-15902063 GCTCCCGTGGGACCCTCAGCAGG - Intergenic
1181032388 22:20154810-20154832 GCCCCTGTGGGGCACTTAGCAGG - Intergenic
1181054793 22:20255743-20255765 GCTCCTGAGGGGCCCCAGCCTGG - Intronic
1181490014 22:23255788-23255810 GCTCCTGTGAGGGCAGAAGCAGG - Intronic
1181511026 22:23388786-23388808 GCCCCTGTGGGGCACCTAGCAGG + Intergenic
1182968141 22:34543386-34543408 CCTCCTCTGGTGCCCCCAGCAGG - Intergenic
1183355063 22:37354165-37354187 GTTCATGTGGAGCCCAAAGCAGG + Intergenic
1183593284 22:38794070-38794092 GCTCCTGCGGGGGCCGGAGCCGG + Exonic
1184446392 22:44549844-44549866 TCTCCCCTGGGGCCCCCAGCAGG + Intergenic
1185041653 22:48507399-48507421 GCTCCTGTGAACCCCCAACCCGG + Intronic
951168110 3:19506809-19506831 GCTGCACTGGGGACCCAAGCTGG + Intronic
952224692 3:31363218-31363240 GCTCCTGAGAGGCCCCATGGTGG - Intergenic
953886664 3:46717950-46717972 GCCCCTGGGGGGCGCCACGCAGG - Exonic
953913011 3:46902256-46902278 GCACCTGTGGAGCCCTCAGCTGG - Intronic
959256851 3:104025888-104025910 GCTATTGTGGAGCCCAAAGCTGG + Intergenic
959277586 3:104296340-104296362 GGGCCTGTGGGCTCCCAAGCAGG + Intergenic
960105237 3:113788590-113788612 GCACTTGTGGGGGCCGAAGCGGG - Intronic
961983312 3:131104308-131104330 GCTGCTCTGGGGGCCTAAGCTGG + Intronic
963259079 3:143176129-143176151 TCTCCTGTGGGGGGCCCAGCCGG + Intergenic
963909930 3:150808123-150808145 GCTTCTGTGGGGTCACAAACAGG - Intergenic
964945451 3:162218076-162218098 GTTCCTGTGGGGTCCCTTGCAGG + Intergenic
967828862 3:193901712-193901734 GCAAGTGTGAGGCCCCAAGCAGG - Intergenic
968627178 4:1631218-1631240 GCTGCTGGGAAGCCCCAAGCAGG - Intronic
968804149 4:2761861-2761883 GCCCCTGTGGGGCTCCTACCTGG + Intergenic
969534183 4:7745926-7745948 GCTCCGGGGGGGTCCCAGGCTGG + Intergenic
969816421 4:9691286-9691308 CCTCCTGTCGGGCCCCAGACGGG + Intergenic
969819228 4:9707868-9707890 GCTCCAGTCAGGCCCCATGCGGG + Intergenic
969867667 4:10086172-10086194 GCTCCAGTGGGCCTCCAAGTGGG - Intronic
984512978 4:180701558-180701580 GCTCCTGTTGGGCCACCAGCTGG - Intergenic
984830255 4:183966205-183966227 GCCCCTGTGGGGCACATAGCTGG + Intronic
984938604 4:184911828-184911850 GCTCCTGTGGGGACCCTCTCTGG + Intergenic
985648009 5:1094067-1094089 GCCCCTGGGGGCCCCCAGGCCGG - Intronic
985744665 5:1639207-1639229 GCTGCTGTGGGGCTCCATGGAGG + Intergenic
986569654 5:9151964-9151986 GCTCCTGTGGATCCACAAGTGGG + Intronic
992888624 5:81183751-81183773 GCTCCTGTGGGGCCCCAAGCTGG + Intronic
995532946 5:113108947-113108969 CCTCCTGTGAGGCTCCAAACAGG - Intronic
996100998 5:119445681-119445703 GCTCCTGCGGGGGCGCAGGCGGG - Intergenic
997470248 5:134113484-134113506 GGTCCTGTGGGGCCCTCAGAGGG + Intergenic
999672002 5:153966232-153966254 GCTCCTGTGGGTCCCACAGCTGG - Intergenic
1001260705 5:170226024-170226046 GCTCCTATGGGGCCCTCTGCTGG - Intergenic
1002424125 5:179165796-179165818 GCTCTTCTGGGGCCCTAGGCTGG - Intronic
1002769810 6:281292-281314 GCACCTTTGGGGACCCAAGGTGG - Intergenic
1003251704 6:4434091-4434113 GCTGCTGTGAGTCCCCAAGAAGG - Intergenic
1003712014 6:8602842-8602864 GCTCAGCTGGGTCCCCAAGCAGG - Intergenic
1003908775 6:10725136-10725158 TTTGCTGTGGGTCCCCAAGCTGG + Intronic
1005812596 6:29528845-29528867 GCTCCTGTGGGACTCTCAGCAGG - Intergenic
1006187676 6:32190090-32190112 TCTCCTGTGGGGGGCCCAGCCGG - Exonic
1006592792 6:35170434-35170456 GGTCCCCTGGGGCCCCCAGCAGG - Intergenic
1007549156 6:42715862-42715884 GTTTCTGGGGGGCCCCAAGGAGG + Intronic
1007712012 6:43830551-43830573 GCTGCTCTGCGGTCCCAAGCTGG - Intergenic
1008116059 6:47551711-47551733 GCTTGTGTGGGGCCCTTAGCTGG + Intronic
1011586634 6:88933074-88933096 TTTCCTGTGGGGACCCAAGGGGG - Intronic
1015771289 6:136771073-136771095 GCTCCTGTGGGCCAGCCAGCAGG + Intronic
1016135235 6:140532653-140532675 GCTCCTCTCTGGCCCCAGGCAGG - Intergenic
1016986033 6:149896590-149896612 GCTGCTGTGGGGACACCAGCGGG + Intronic
1017727255 6:157284194-157284216 GCTCCTGAAAGCCCCCAAGCTGG - Intergenic
1018937070 6:168280284-168280306 GCTCCTGTGGGGGCTGCAGCCGG + Intergenic
1019127634 6:169851638-169851660 ACTGCTGTGGGGCCTCCAGCAGG - Intergenic
1019321156 7:415901-415923 GCTCTCGAGGGGCACCAAGCAGG + Intergenic
1019490768 7:1312231-1312253 GCTCCCGGGGGGCCACATGCCGG + Intergenic
1019496217 7:1341717-1341739 GCTCCTGGGGGGATCCAGGCGGG + Intergenic
1020100398 7:5391116-5391138 TCTGCTGTGTGACCCCAAGCTGG + Intronic
1022646261 7:32230963-32230985 GCTCCTGTGGGGTGGTAAGCTGG - Intronic
1023856261 7:44185978-44186000 GCTCCAGGTGGCCCCCAAGCAGG - Intronic
1024551520 7:50566354-50566376 GCTCCTGTGAGACCCCAGGCGGG - Intergenic
1027236698 7:76302739-76302761 GCTCCTGCGGGGCCCCAGCTGGG + Exonic
1028737473 7:94233571-94233593 GCTGCTGTGGGGCTGAAAGCTGG + Intergenic
1032097741 7:128947820-128947842 GCTCCTGGGTGGCCTCCAGCTGG - Exonic
1034442586 7:151094023-151094045 GCTCCTGGAGGGCTCCAAGGGGG - Intronic
1035217391 7:157378420-157378442 GTTCCTGTGGGGCTCCAACTGGG - Intronic
1042895912 8:73667569-73667591 GCTTCTTTGGTGCCCCAATCTGG + Intronic
1045361001 8:101433132-101433154 GGTGCTGTGGGACTCCAAGCTGG - Intergenic
1047381504 8:124368531-124368553 GCACCTGTGGGCACCTAAGCTGG - Intronic
1047731885 8:127735272-127735294 GCTTCCGTGGGGCCCCGTGCGGG - Intergenic
1048574702 8:135681416-135681438 GCCACTTTGGGGCCTCAAGCTGG - Intergenic
1048812981 8:138304978-138305000 GCTCTTCTGTGGCCCCAGGCTGG + Intronic
1049416308 8:142497216-142497238 CCTCCTGTGGGGCCCCTGTCAGG + Intronic
1049604579 8:143523340-143523362 GCTCTTGTGGGACCCCCATCTGG - Intronic
1049612859 8:143563463-143563485 CCTCCTGTGTGGCCCCAGGAGGG - Intergenic
1049742614 8:144248358-144248380 TCTCATGTGGGTCCCCAAGCTGG + Intronic
1049745356 8:144260924-144260946 GCGCATGTGTGGCCCCAATCTGG + Exonic
1049797301 8:144502693-144502715 GCCCCTTAGGGGCCTCAAGCAGG + Intergenic
1051501681 9:17784957-17784979 GCACCTTTGGTGCCCAAAGCAGG - Intronic
1052104949 9:24502328-24502350 GCTCCTGTGGGGCTGCAACTGGG + Intergenic
1053647345 9:40131173-40131195 GCCCCTCTGGGACCCCCAGCAGG - Intergenic
1053758382 9:41332670-41332692 GCCCCTCTGGGACCCCCAGCAGG + Intergenic
1054328337 9:63729129-63729151 GCCCCTGTGGGACCCTCAGCAGG - Intergenic
1054537234 9:66244997-66245019 GCCCCTCTGGGACCCCCAGCAGG + Intergenic
1055112066 9:72569713-72569735 GCTCCTGAAGGGCTCCAACCTGG + Intronic
1057568096 9:96182677-96182699 GCTCCTGTGTGACCGAAAGCAGG + Intergenic
1059487494 9:114637926-114637948 GTTCCTGTGTGGCCTCAGGCAGG + Intronic
1060917982 9:127402699-127402721 GTTCCTGTGGGGCTCCGAGCAGG + Exonic
1060969455 9:127730013-127730035 GCTCCTCAGAGGCCCCAAGGCGG + Intronic
1061878043 9:133554658-133554680 GCCCCTGGGGGGCCCCTCGCAGG - Exonic
1202795130 9_KI270719v1_random:114470-114492 GCCCCTGTGGGACCCTCAGCAGG - Intergenic
1186649221 X:11541006-11541028 GTGCCTGTGGAGCCCCATGCAGG - Intronic
1189007977 X:37014817-37014839 CCTCCTGCGGGGCCCCAGCCTGG + Intergenic
1189040495 X:37537712-37537734 CCTCTTGTGGGGCCCCAGCCTGG - Intronic
1193513341 X:82433021-82433043 GCTGCAGTGTGGGCCCAAGCTGG - Intergenic
1195129559 X:101839728-101839750 GCTCCTCTGAGGGCCCAGGCAGG + Intronic
1195176680 X:102320101-102320123 GCTCCTCTGAGGGCCCAGGCAGG - Intronic
1195182184 X:102366992-102367014 GCTCCTCTGAGGGCCCAGGCAGG + Intronic
1195202548 X:102564792-102564814 GCTCCTCTGAGGGCCCAGGCAGG - Intergenic
1195254905 X:103081509-103081531 GCTCCTCTGAGGACCCAGGCAGG + Intronic
1199154075 X:144525694-144525716 GCTCCACTGTGGCCCCAAGCAGG + Intergenic
1199262276 X:145789305-145789327 GCTTCTTTAGGGCCCCAAGAAGG - Intergenic
1199622577 X:149713453-149713475 GGTCCTTGGAGGCCCCAAGCAGG + Intronic
1200065384 X:153502146-153502168 GGTCCTGGGGGGCTCCAAGCTGG + Intronic