ID: 992888773

View in Genome Browser
Species Human (GRCh38)
Location 5:81185099-81185121
Sequence GGGTGATCACAATTGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888773_992888783 15 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888783 5:81185137-81185159 AGGTAGGAGAGGTCAAGGAGAGG No data
992888773_992888781 4 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888781 5:81185126-81185148 GTGGGAAGTTGAGGTAGGAGAGG 0: 1
1: 0
2: 3
3: 88
4: 676
992888773_992888776 -5 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888776 5:81185117-81185139 CACCCACCTGTGGGAAGTTGAGG 0: 1
1: 0
2: 3
3: 16
4: 185
992888773_992888782 10 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888782 5:81185132-81185154 AGTTGAGGTAGGAGAGGTCAAGG 0: 1
1: 0
2: 5
3: 39
4: 357
992888773_992888779 -1 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888779 5:81185121-81185143 CACCTGTGGGAAGTTGAGGTAGG No data
992888773_992888784 16 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG 0: 1
1: 0
2: 2
3: 52
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888773 Original CRISPR GGGTGATCACAATTGCTAGC AGG (reversed) Intronic
906071598 1:43020871-43020893 GGGAGATCAGATTTGCTAACTGG + Intergenic
914226937 1:145728369-145728391 GGATGTCCACAATTGCCAGCAGG - Exonic
916961914 1:169897033-169897055 GGGTGGTCACAAGTTCTGGCCGG + Intergenic
922213201 1:223500935-223500957 GGGGGATTTCAAGTGCTAGCTGG + Intergenic
923255363 1:232217218-232217240 GGATGGTCACTATTGCTAGATGG + Intergenic
924910615 1:248508397-248508419 GGGTGATCTCAATTTCTTCCTGG - Intergenic
924913485 1:248539642-248539664 GGGTGATCTCAATTTCTTCCTGG + Intergenic
1069684969 10:70312125-70312147 AGGTAACCAGAATTGCTAGCTGG + Intronic
1070227249 10:74522416-74522438 GGGTTTTCTCAATTGCTAGGGGG + Intronic
1071472801 10:85996313-85996335 GAGTGTTCACAATTGCTTGTTGG - Intronic
1072277548 10:93838037-93838059 GGGTGATCCAAGTGGCTAGCTGG - Intergenic
1077928938 11:6710305-6710327 GGGTGATGACAACTGCAGGCTGG + Intergenic
1083724788 11:64622516-64622538 GGGTGACCACTATTTCTAGAGGG - Intronic
1084608712 11:70187213-70187235 GGGTGCTCACACGTGCTTGCTGG + Intronic
1090455247 11:126843463-126843485 GGCAGATCACAATTGAAAGCAGG - Intronic
1095951714 12:47785223-47785245 GGGTGCTCACCATTGCTGCCTGG + Intronic
1098529645 12:71527174-71527196 GAGTGAACACAATTTCTGGCAGG - Intronic
1100279099 12:93101147-93101169 GGCTGATCATAATCGCTACCTGG + Intergenic
1102312238 12:111854725-111854747 TGGTTATCACAGTTGGTAGCGGG + Intronic
1106794430 13:33189811-33189833 GGGTGATCCCAGTTTCTAGCAGG + Intronic
1108098516 13:46930128-46930150 GAGTGTTTACAATTGCTTGCTGG + Intergenic
1109155938 13:58909489-58909511 GGGTGATCTAAGTTGCTAGAAGG - Intergenic
1112465120 13:99637219-99637241 GGGTGAGCACAATGGCAAACTGG - Intronic
1114062375 14:19029993-19030015 GGGCAATAACAAATGCTAGCAGG - Intergenic
1115082092 14:29466790-29466812 GGTTGATAACAAATGCTAACTGG + Intergenic
1135906016 16:26512470-26512492 GTGTGTTCACAATTGCATGCTGG + Intergenic
1142737768 17:1912383-1912405 GGGTGAACAGCATTGCAAGCAGG + Intergenic
1149418706 17:56487431-56487453 GGGTGCTCACAACTGACAGCCGG + Intronic
1150030541 17:61729833-61729855 GGGTTATCACAACTGGTGGCAGG + Intronic
1152830140 17:82492083-82492105 GGGTGCTCACGACTGCTGGCTGG + Intergenic
1155196563 18:23480449-23480471 AGATGATTCCAATTGCTAGCTGG + Intronic
1159739019 18:72141736-72141758 GGGTGATCACTACTGCTATTGGG - Intergenic
1160296741 18:77645344-77645366 GTGTTATCACACATGCTAGCAGG - Intergenic
1167427324 19:49436224-49436246 GCGTGAGCAAAATTGCTAGTAGG + Intronic
928402390 2:30988418-30988440 AGGTGATGCCAATTGCTAGGAGG + Intronic
929670285 2:43871877-43871899 GGGTGATCAGCATTGTGAGCTGG + Intronic
937003949 2:118494073-118494095 GGGTGACAACAATTGCGTGCCGG - Intergenic
940590015 2:155711270-155711292 GTGTTATCACAATTGTTACCTGG - Intergenic
945338300 2:208618553-208618575 GGGTGAGGCCTATTGCTAGCAGG - Intronic
1169229065 20:3874931-3874953 GGGTGAGCCCAATGGCTAGAGGG + Exonic
1169805565 20:9555963-9555985 GGCTGATCACAACTGCAAGAGGG + Intronic
1178711668 21:34922653-34922675 GGGTCACCACAATTGCCTGCTGG + Intronic
1180598245 22:16993952-16993974 GGGTGTTCACAAATGCAAGAAGG - Intronic
972830516 4:42809525-42809547 GAGTGGTCACAACTGCTTGCAGG - Intergenic
975373984 4:73620921-73620943 GGGTGAAAAAAAGTGCTAGCAGG - Intergenic
977041017 4:92018879-92018901 GGCTGATCACAAGTGCTTTCAGG - Intergenic
978863452 4:113479149-113479171 GGGTAATCACAATTTCTAAAAGG + Intronic
980875320 4:138656395-138656417 GGGTGATCACCTTTGGTACCAGG + Intergenic
983986327 4:174064357-174064379 GGATAATCACACTTGCTGGCTGG + Intergenic
984385723 4:179054888-179054910 TGGAGATCACAACTGATAGCTGG + Intergenic
984939875 4:184921744-184921766 GGGTCACCACAATGCCTAGCAGG - Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
994104196 5:95928087-95928109 GGGTGATGACAGTTACTGGCAGG + Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008291107 6:49717061-49717083 GGCTGCTCCCAAGTGCTAGCAGG + Intergenic
1010622006 6:78088396-78088418 TGCAGATCACAATTGCTATCAGG + Intergenic
1014698622 6:124655706-124655728 GGGTAATCATAATTGCAAACAGG - Intronic
1023554385 7:41405659-41405681 GGGGAATCACACTTGCTTGCAGG - Intergenic
1024151724 7:46578487-46578509 CGGTGATAACAATTGTTAGAAGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1030270999 7:107668065-107668087 GTGTGACCACAAGTGCTAGATGG - Intronic
1031798098 7:126203725-126203747 GGATGATCACAGTTGCTATTTGG + Intergenic
1036477175 8:9103915-9103937 AGGTGCTCACAATTGCTAGAAGG - Intronic
1050741005 9:8821210-8821232 AGATGATCACAGTTGGTAGCTGG + Intronic
1057035343 9:91807940-91807962 GGGTGAGCACAAGTCTTAGCTGG - Intronic
1187189940 X:17024726-17024748 GAGAGATCACAATTGGGAGCGGG + Intronic
1189500688 X:41553783-41553805 GGATGATCATAATTGGTGGCAGG - Exonic
1192586301 X:72320854-72320876 GTGTAATCACCATTGCTATCTGG + Intergenic
1194144691 X:90247413-90247435 GAGTAATCACAACTGCTTGCAGG + Intergenic
1195829543 X:109040652-109040674 GGGTGATTAGAATTCATAGCAGG - Intergenic
1197076798 X:122363308-122363330 GAGTGATCACTCTTGCTTGCAGG - Intergenic
1200490446 Y:3816718-3816740 GAGTAATCACAACTGCTTGCAGG + Intergenic