ID: 992888773

View in Genome Browser
Species Human (GRCh38)
Location 5:81185099-81185121
Sequence GGGTGATCACAATTGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888773_992888782 10 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888782 5:81185132-81185154 AGTTGAGGTAGGAGAGGTCAAGG 0: 1
1: 0
2: 5
3: 39
4: 357
992888773_992888784 16 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG 0: 1
1: 0
2: 2
3: 52
4: 696
992888773_992888776 -5 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888776 5:81185117-81185139 CACCCACCTGTGGGAAGTTGAGG 0: 1
1: 0
2: 3
3: 16
4: 185
992888773_992888779 -1 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888779 5:81185121-81185143 CACCTGTGGGAAGTTGAGGTAGG No data
992888773_992888781 4 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888781 5:81185126-81185148 GTGGGAAGTTGAGGTAGGAGAGG 0: 1
1: 0
2: 3
3: 88
4: 676
992888773_992888783 15 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888783 5:81185137-81185159 AGGTAGGAGAGGTCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888773 Original CRISPR GGGTGATCACAATTGCTAGC AGG (reversed) Intronic