ID: 992888776

View in Genome Browser
Species Human (GRCh38)
Location 5:81185117-81185139
Sequence CACCCACCTGTGGGAAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888773_992888776 -5 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888776 5:81185117-81185139 CACCCACCTGTGGGAAGTTGAGG 0: 1
1: 0
2: 3
3: 16
4: 185
992888772_992888776 20 Left 992888772 5:81185074-81185096 CCAGCTAAGAGCTCGTGAAATCA 0: 1
1: 0
2: 1
3: 14
4: 225
Right 992888776 5:81185117-81185139 CACCCACCTGTGGGAAGTTGAGG 0: 1
1: 0
2: 3
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888776 Original CRISPR CACCCACCTGTGGGAAGTTG AGG Intronic
900861637 1:5237369-5237391 AATCTACCTGTGGCAAGTTGGGG + Intergenic
901665875 1:10825881-10825903 CACCCTCCTGTGGGCAGATGGGG + Intergenic
904958177 1:34306361-34306383 CTGCCACCTATGGGAAGGTGGGG - Intergenic
906396384 1:45469621-45469643 CACCCTGTTGAGGGAAGTTGGGG - Intronic
907977760 1:59448733-59448755 GACCCTGCTGTGGGAGGTTGTGG + Intronic
912386216 1:109272469-109272491 CAGCCAGCTGTTGGGAGTTGAGG + Intronic
916660440 1:166918554-166918576 CACCAACCTGTGGGAAGTCCAGG + Exonic
919141831 1:193582166-193582188 CACCAGCCTGTGGGAAATTGAGG + Intergenic
919797197 1:201328039-201328061 CACCGACCTGTGGGAACAGGAGG - Intronic
919803264 1:201366139-201366161 CACACACCTGAGGGCAGATGGGG - Intronic
920334050 1:205232300-205232322 CACACACCTGTGGGACCTTCGGG + Intronic
922653505 1:227360873-227360895 CACCCAGCCGTTGGAAATTGTGG - Intergenic
1064874987 10:19983847-19983869 GACTCACCTGAGGGAAGGTGAGG - Intronic
1069986992 10:72291242-72291264 CTCCCATCTGTGGGCAGCTGGGG + Intergenic
1070288839 10:75101860-75101882 CACCCACCTGTGGGAGTATCTGG + Intronic
1071940627 10:90587789-90587811 CTCCCATGTGTGGGAAGCTGTGG - Intergenic
1074032356 10:109701571-109701593 CACCCACCTGTGGCCTGGTGGGG + Intergenic
1074842375 10:117367802-117367824 CACACGCCTGTGGGAGGCTGAGG + Intronic
1083283090 11:61639487-61639509 CACCCACCTATAGGAGGCTGAGG + Intergenic
1086502731 11:87470015-87470037 CACTAACCTGGGGGAAGCTGAGG + Intergenic
1087725724 11:101713989-101714011 CTCCCACATGTGGGAAGTGTGGG + Intronic
1089284026 11:117394313-117394335 GGCCCACCGGTGGGAAGCTGCGG - Intronic
1091258907 11:134218179-134218201 CACCCTCGTGTGTGAAGTGGAGG - Intronic
1093498079 12:19780027-19780049 CCCCAACCTGTGGGAGGTTAGGG + Intergenic
1095486882 12:42694706-42694728 CAGACACCTTTGGGAAGTTAAGG - Intergenic
1096017335 12:48289047-48289069 CACTCAGCTGAGGGAAGATGAGG + Intergenic
1096256333 12:50064256-50064278 CACCCACCTGTGTTCAGTTTAGG - Intronic
1097191486 12:57221529-57221551 CACGCACCTGCAGGGAGTTGAGG - Intronic
1101344967 12:103878511-103878533 AACCCACCAGTGGGAAGAAGAGG - Intergenic
1101490454 12:105205013-105205035 CACCCACCTTTGTGGAGGTGTGG - Intronic
1102258760 12:111430842-111430864 GACCCACCTGTGGGATCTGGTGG - Intronic
1102949937 12:117024718-117024740 CTTCCACCTGTGGGCAGGTGGGG - Intronic
1104223883 12:126812499-126812521 CACCCACCTGGTGGGAGTGGTGG - Intergenic
1104437231 12:128765864-128765886 CACCCTCCTGTGGGAACCAGGGG + Intergenic
1104440863 12:128792117-128792139 CCCCCACCTCCAGGAAGTTGGGG - Intergenic
1105745650 13:23375263-23375285 GACCCACCTGTGGAAAGCAGAGG + Exonic
1107305117 13:39010371-39010393 CTGCCACATGTGGGAAGTAGGGG - Exonic
1108543617 13:51468392-51468414 GGCCCACCTGTGGGAATTGGGGG + Intergenic
1110224431 13:73104964-73104986 CAGACACCTTTTGGAAGTTGAGG - Intergenic
1111547997 13:89769120-89769142 GACCCACCTGCGGGAGGCTGAGG + Intergenic
1112797095 13:103068552-103068574 CACCCACCTTTGGGAGTTGGGGG - Intergenic
1113072082 13:106431706-106431728 CACCCAGCTGTGGAAACTAGAGG - Intergenic
1114646103 14:24257077-24257099 CCCCCAACTCTGGGAAGTGGTGG - Intronic
1115152646 14:30302978-30303000 CAGCCACCTCTGGGATGCTGAGG - Intergenic
1121770428 14:96530928-96530950 CATGCACCTGTGGGAGGCTGAGG - Intronic
1123076752 14:105671299-105671321 TACCTACCTGTAGGAAATTGGGG + Intergenic
1123150561 14:106177540-106177562 CACACAACTGTGGGATGCTGAGG + Intergenic
1123398985 15:19965284-19965306 CACACAACTGTGGGATGCTGAGG + Intergenic
1124636002 15:31365624-31365646 CACTCACCTGTGGGGGGTTGGGG + Intronic
1125836789 15:42759077-42759099 CAGCCACCTGTGTGAGCTTGAGG - Intronic
1126119289 15:45236964-45236986 CACCGACCTGTGGGCAGATGAGG - Intergenic
1127842092 15:62840583-62840605 CACCGAGCTGAGGGAAGATGAGG + Exonic
1128933166 15:71723938-71723960 TGCGCACCTGTGGGAAGCTGAGG + Intronic
1131130756 15:89898845-89898867 GATACACCTGTGGGGAGTTGAGG - Exonic
1131526974 15:93160220-93160242 CAGCCAGCTGTGGGGAGCTGGGG - Intergenic
1133339837 16:5028986-5029008 CATCAACCTGTGGGAAATGGCGG - Exonic
1133348788 16:5088240-5088262 CAGCCTCCTGTGCGAGGTTGTGG + Intronic
1134640885 16:15828398-15828420 GAACCAGCTGTGGGAAGATGAGG - Intronic
1136618876 16:31414898-31414920 CTCTCACCAGTGAGAAGTTGAGG - Exonic
1136631851 16:31493518-31493540 CAGAAACCTGTGGGAAGCTGGGG + Exonic
1137031897 16:35532042-35532064 CAGCCACTTGTGGGAAGTGAAGG - Intergenic
1137785535 16:51134672-51134694 CGCCCAGCGATGGGAAGTTGTGG + Intergenic
1139343531 16:66287588-66287610 CACCCACGTGTGGGAAGTGGAGG + Intergenic
1140987194 16:80169216-80169238 GGCCCATCTTTGGGAAGTTGGGG + Intergenic
1142126523 16:88413349-88413371 CACCCACCTGTGGGCCCTGGAGG + Intergenic
1142593537 17:1018507-1018529 CACCCAGTCGTGGGAAGCTGGGG - Intronic
1143583459 17:7839440-7839462 CACCCGCCTGGGGGAAGAAGAGG + Intergenic
1144493403 17:15732916-15732938 CCTCCGCCTGTGGGCAGTTGTGG + Intronic
1144767466 17:17740390-17740412 CAGCCACCTCTGGAGAGTTGGGG + Intronic
1144845821 17:18218481-18218503 CACAGACCTGTTGGAAGGTGGGG - Intergenic
1145252933 17:21306186-21306208 CACACACCAGTTGGAAGTAGCGG + Intronic
1145269171 17:21395463-21395485 AACCCACCTCTGGGAGGCTGAGG + Intronic
1145323644 17:21781730-21781752 CACACACCAGTTGGAAGTAGCGG - Intergenic
1148452343 17:47787790-47787812 CACACACCTGTGGGAGGCTGAGG + Intergenic
1148566372 17:48635355-48635377 CACCCACCTCTGGAGAGCTGGGG - Intergenic
1148587055 17:48788436-48788458 CAGCCCCCTGGGGGAAGTGGGGG + Intronic
1149046062 17:52246752-52246774 CACTCACATGGGTGAAGTTGGGG - Intergenic
1151410218 17:73920285-73920307 CTCCCACCTGTGGGTGGCTGTGG - Intergenic
1152833189 17:82511638-82511660 TACTCAGGTGTGGGAAGTTGGGG + Intergenic
1156089917 18:33454745-33454767 CAGCCTCCTCTGGGAAGCTGAGG + Intergenic
1156337940 18:36186828-36186850 CACCCACGTGCGGGAAGTGCGGG + Intergenic
1157698844 18:49746610-49746632 CCTCCACCTGTGGGGAGGTGCGG + Intergenic
1158388308 18:57020172-57020194 CACACACATGTGGGAGGTTTGGG - Intronic
1159821430 18:73150401-73150423 CTGCCCCATGTGGGAAGTTGTGG - Intergenic
1160612610 18:80100217-80100239 CACACAACTGTGGGAAGCTTTGG + Intergenic
1161043786 19:2123760-2123782 CTCCCGCCTGTGGAAAGGTGTGG + Intronic
1161253294 19:3292995-3293017 CATCCTCCTGAGGGAAGGTGGGG + Intronic
1162670891 19:12256956-12256978 CCCACACCTGTGGGAGGCTGAGG - Intronic
1163263372 19:16204447-16204469 CACTGAACTGTGGGAAGGTGAGG - Intronic
1165432847 19:35782271-35782293 CATCCACCTGCGGGCACTTGGGG + Intronic
1165437090 19:35801779-35801801 AATCCACCTCTGCGAAGTTGGGG + Intronic
1166003512 19:39892180-39892202 CGTCCACCTGTGGGCAGTGGGGG + Exonic
925131510 2:1497138-1497160 CAGCCACCTGTAGGAGGTGGAGG - Intronic
926679098 2:15650459-15650481 CATCCAGGTGTGGGAAGGTGAGG - Intergenic
928023952 2:27724563-27724585 CACCCATCTGTAGGACGCTGGGG - Intergenic
928030986 2:27778985-27779007 AACCCATCTCTGGGAAGTAGAGG + Intronic
931904927 2:66832132-66832154 CCCCCACATCTGGAAAGTTGAGG - Intergenic
932098749 2:68876877-68876899 ATCCCACCTTTGGGAAGCTGAGG - Intergenic
933764677 2:85698526-85698548 CAGCCAGCTGTGGGCAGATGTGG - Intronic
933836654 2:86251343-86251365 CACCAGTCTGTGGGATGTTGTGG - Intronic
936265108 2:110998768-110998790 CTCCCACCTCTGGAAAGTGGGGG + Intronic
936594571 2:113835669-113835691 CACCCAAGTGCAGGAAGTTGAGG - Intergenic
937252202 2:120532094-120532116 GCCCCTCCTGTGGGAAGCTGTGG + Intergenic
940328727 2:152452631-152452653 CCCCCATCTGTGGGAAGTGAGGG + Intronic
946168572 2:217879998-217880020 CACCCATCTGTGTTCAGTTGGGG - Intronic
946360199 2:219214860-219214882 GACCCACCTATGGGAGGCTGTGG - Intronic
946360443 2:219216379-219216401 CACCCCCCTGGAGGAACTTGAGG + Exonic
947856765 2:233329298-233329320 CACCCATCTGTGGGAAGCTGGGG - Intronic
948080623 2:235202607-235202629 CTCCCCTCTGTGGGAAATTGAGG - Intergenic
948795440 2:240400051-240400073 CAGCCACCTGTGGGAGGTGCAGG + Intergenic
948922773 2:241073503-241073525 CACCCCGGTGTGGGAAGATGGGG + Intronic
1169692576 20:8348418-8348440 CAAAAACCTGTGGGAATTTGGGG + Intronic
1171418244 20:24998384-24998406 CACCCACAAGTGGCAAGTTTGGG + Intergenic
1171483131 20:25468646-25468668 CACCCACCAGTGAGAATTGGGGG - Intronic
1172413318 20:34742652-34742674 CAGCCACATTTGGGAAGTGGTGG + Exonic
1173249495 20:41357197-41357219 CACCCAGCTGTGGGAAGGGGAGG + Intronic
1175120016 20:56710190-56710212 CTCACACCTGTGGGAGGTTGAGG - Intergenic
1175499344 20:59438849-59438871 CAACCATCTGTTGGAAGTCGTGG - Intergenic
1175572508 20:60034643-60034665 CACCCACCTGAAGGCAGCTGGGG - Intergenic
1175660948 20:60811568-60811590 CCCCCACTTGTGGGATGTAGGGG - Intergenic
1176195035 20:63832780-63832802 CACCGACCTTCGGGAAGTGGGGG + Intergenic
1176745662 21:10650018-10650040 CACACAACTGTGGGATGCTGAGG + Intergenic
1176864674 21:14039623-14039645 CACCCACATGTGGAAAACTGAGG - Intergenic
1179251238 21:39673392-39673414 CATCCCCCTGTGGCAAGGTGGGG + Intergenic
1179668166 21:42926709-42926731 AACCCACTTGTGGGCAGGTGCGG - Intergenic
1179885614 21:44313128-44313150 CACTCACCTCTGGGCAGTGGTGG - Exonic
1180151393 21:45950101-45950123 CTCCCACCTGTGGGAATTCCGGG - Intergenic
1180748610 22:18109920-18109942 CACCCACCTGGGGGGAAGTGAGG + Intronic
1182573775 22:31259105-31259127 CAGCCACCTGTGAGCAGGTGGGG - Exonic
1182582119 22:31320420-31320442 CAGCCACCTGAGGGCAGCTGAGG + Intergenic
950035635 3:9883270-9883292 CACACGCCTGTGGGAGGTAGAGG - Intergenic
950129294 3:10530987-10531009 AAACCAACTGAGGGAAGTTGTGG - Intronic
950161019 3:10761390-10761412 CAGCCACTTGTGAGAAGCTGAGG + Intergenic
950229216 3:11261369-11261391 TACCCTCCTGTGGGGTGTTGTGG - Exonic
950240835 3:11368652-11368674 CACGCACCTGTGGGAGTTTGAGG + Intronic
952367737 3:32689701-32689723 CTCACACCTGTGGGAGGCTGAGG + Intronic
953271151 3:41446642-41446664 CACCCATCAGTGAGAACTTGCGG - Intronic
953856064 3:46499888-46499910 CACCCACCTATAGGCATTTGTGG + Intronic
954390385 3:50265380-50265402 CACCCATCTGAGGAAGGTTGTGG - Intergenic
954645571 3:52129596-52129618 TACCCACCTGTGGGAAGCCCTGG + Intronic
955405803 3:58624972-58624994 CAGCCTTCTGTGGGAGGTTGGGG + Intronic
956958418 3:74369261-74369283 CATCTTCCTGTTGGAAGTTGGGG + Exonic
957773911 3:84730538-84730560 GAGCAGCCTGTGGGAAGTTGGGG - Intergenic
964567781 3:158076480-158076502 CTTCCACCTGCTGGAAGTTGGGG - Intergenic
965093521 3:164192994-164193016 CACCAACCTGTGGGACTGTGGGG - Intergenic
968606174 4:1536768-1536790 CAGCCACCTGTGGGATGTAGGGG - Intergenic
968648988 4:1753020-1753042 CACCAGCCTGTGGGGACTTGGGG + Intergenic
969709747 4:8835979-8836001 CTCCAGCCTGTGGGCAGTTGGGG - Intergenic
974932856 4:68379358-68379380 CACCTACCTGTGGGTAGTTGTGG - Intergenic
979466866 4:121049434-121049456 CATCATCCTGTGGGAAGTGGGGG + Intronic
980582581 4:134773482-134773504 CACCCCCCTGTGGGGAATGGTGG - Intergenic
984888082 4:184468715-184468737 CACACACCTGAGGGAGGCTGGGG + Intronic
986169413 5:5303576-5303598 CACACACCTGTGGGAAGGGGTGG + Exonic
986389702 5:7273276-7273298 CTAGCACCTGTGGGAAGTTTTGG - Intergenic
988611564 5:32731847-32731869 CATCCAGGGGTGGGAAGTTGAGG + Intronic
989511807 5:42296429-42296451 CAGGCACCTGTAGGAAGCTGAGG + Intergenic
990176462 5:53113956-53113978 CTCCCTCCTGTGAGGAGTTGTGG - Intergenic
990289218 5:54331542-54331564 CTCCCTCCTAAGGGAAGTTGGGG + Intergenic
990739193 5:58895056-58895078 CAACCACCTGTGTGCACTTGAGG + Intergenic
992888776 5:81185117-81185139 CACCCACCTGTGGGAAGTTGAGG + Intronic
996536405 5:124582277-124582299 CTCCCACCAGTGGGGGGTTGTGG - Intergenic
1001153633 5:169254083-169254105 GACCCAGCTGTGTGGAGTTGGGG - Intronic
1001963361 5:175893982-175894004 CAGCCCCCTGTGGGAACTGGAGG + Intergenic
1002255474 5:177955176-177955198 CATTCTCCTGTTGGAAGTTGGGG - Intergenic
1002482577 5:179512901-179512923 CACTCTCCTGTTGGAATTTGGGG + Intergenic
1002585700 5:180245537-180245559 CTCCCACCTGTAGGATGCTGGGG - Intronic
1004709589 6:18156308-18156330 GACCCAGCTGTAGAAAGTTGGGG + Intronic
1006144175 6:31948365-31948387 CACCCACAGGTGGCAAGTTATGG + Exonic
1006798763 6:36746389-36746411 CACCTACCAGTGGGAACTCGTGG + Exonic
1008407086 6:51130516-51130538 CACACACCTGTCGGGTGTTGGGG - Intergenic
1015710177 6:136130648-136130670 CACCTTCCTCTGGGTAGTTGAGG + Intronic
1017252597 6:152297235-152297257 AAACCACCTGTTGGAAGCTGTGG - Intronic
1019180915 6:170186926-170186948 CACCCACCTGGAGGCAATTGGGG + Intergenic
1021030302 7:15724570-15724592 CACCCTCCTGGGGGAAGGAGGGG - Intergenic
1024114666 7:46181322-46181344 CACCCACATGTGGGAATTGCGGG + Intergenic
1024612389 7:51078772-51078794 CAGCCACTTGAGTGAAGTTGGGG - Intronic
1024857201 7:53795468-53795490 CACCCATCACTGGGAAATTGAGG - Intergenic
1030082881 7:105792415-105792437 CACCCAGCCGTGTGAAGTGGTGG - Intronic
1030434886 7:109504878-109504900 CACTCATCTGTGGAAATTTGGGG - Intergenic
1033545436 7:142395080-142395102 CACATACCTGTGGGAAGCTGAGG + Intergenic
1035314663 7:157990524-157990546 CACCCACCTCTGGCAAGTTCTGG + Intronic
1036407609 8:8468957-8468979 CCCCAAGCTGTGGGAAGCTGGGG + Intergenic
1039615308 8:38950844-38950866 CCCCCACCTTTGGGAACCTGGGG - Exonic
1044306592 8:90646367-90646389 CGCGCGCCTGTGGGAAGTCGGGG - Intronic
1044932067 8:97260291-97260313 CAGCCAGCTGTGGGAGGATGGGG - Intergenic
1045935442 8:107673041-107673063 CTCACACCTCTGGGAAGTTGTGG - Intergenic
1049783444 8:144439379-144439401 CAGGCAGCTGTGGGAAGTTGGGG - Intronic
1051252135 9:15170780-15170802 CACATACATGTGGGGAGTTGGGG + Exonic
1052043803 9:23771162-23771184 CTCCCACCAGGGTGAAGTTGGGG + Intronic
1056647701 9:88429214-88429236 CACCCAAATGTGGGAAGGGGAGG + Intronic
1057348958 9:94278514-94278536 CACCCAGCTGCTGGAAGATGGGG + Intronic
1057695425 9:97319555-97319577 CTCCCACTTGTGAGAAGCTGTGG + Intronic
1057802351 9:98198124-98198146 CACCCACAGGTGTGAATTTGAGG - Intergenic
1060937778 9:127525759-127525781 TTCCCAACTGTGTGAAGTTGGGG - Intronic
1060942623 9:127551805-127551827 CACCGATCTCTGGGAAGTTTTGG + Intronic
1061939647 9:133877053-133877075 CACCCACCTGGGGAAAGGGGAGG + Intronic
1188213181 X:27447130-27447152 CACAGAACTTTGGGAAGTTGAGG - Intergenic
1190335941 X:49261677-49261699 GTCCAACCTGTGGGAAGTTGGGG + Intronic
1190383444 X:49861794-49861816 CACAATCCTGTGGGAATTTGGGG - Intergenic
1190383532 X:49862535-49862557 CACCATCCTGGGGGAATTTGGGG - Intergenic
1191198610 X:57752408-57752430 CACTCACCTGAGAGAAGTAGAGG + Intergenic
1192206750 X:69101409-69101431 CACCTACATGTTAGAAGTTGGGG + Intergenic
1198537048 X:137596964-137596986 GACCAAGCTGTGGGAAGGTGAGG + Intergenic
1199535082 X:148893804-148893826 CAGCCACCTCTGGAAAGCTGGGG + Intronic
1200042880 X:153382428-153382450 CACCCACCTCTGGGAAATGTTGG + Intergenic