ID: 992888782

View in Genome Browser
Species Human (GRCh38)
Location 5:81185132-81185154
Sequence AGTTGAGGTAGGAGAGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888777_992888782 -10 Left 992888777 5:81185119-81185141 CCCACCTGTGGGAAGTTGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 992888782 5:81185132-81185154 AGTTGAGGTAGGAGAGGTCAAGG 0: 1
1: 0
2: 5
3: 39
4: 357
992888773_992888782 10 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888782 5:81185132-81185154 AGTTGAGGTAGGAGAGGTCAAGG 0: 1
1: 0
2: 5
3: 39
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888782 Original CRISPR AGTTGAGGTAGGAGAGGTCA AGG Intronic
900182964 1:1320499-1320521 GGGTGATGTAGGAGAAGTCAGGG + Exonic
900798310 1:4722857-4722879 AGTTGGGTTGGGACAGGTCAGGG + Intronic
900883909 1:5402055-5402077 AGTGGAGGTGGTAGAGGTCAAGG - Intergenic
901011699 1:6206095-6206117 AGGAGAGGTAGGAGAGGCCACGG + Intronic
901029357 1:6298012-6298034 AAATGAGGTAGGACAGGTGAGGG + Intronic
901357458 1:8663761-8663783 AGGTGAGGCTGGAGAGGTGAAGG - Intronic
903467703 1:23563751-23563773 AGTGAAGGTAGGAGAAGTCAGGG - Intergenic
904451695 1:30617055-30617077 GGATGAGGTCAGAGAGGTCATGG + Intergenic
904532679 1:31179925-31179947 AGTTGGGGTGAGAGAGGTGAGGG + Exonic
905368770 1:37471502-37471524 AGATGAGGTTGGAGAGGGAAAGG - Intergenic
906687619 1:47772552-47772574 AGATGAGCTGGGAGAGGTGATGG + Intronic
906722871 1:48022063-48022085 AGATGAGGTCAGAGAGGTAATGG + Intergenic
907488132 1:54791186-54791208 AGGTGAGGGACCAGAGGTCATGG - Intronic
908052849 1:60251347-60251369 AGTCGGAGTAGGAGAGGGCAGGG + Intergenic
910914916 1:92278352-92278374 GGATGAAGTAGGAGAGGTGACGG - Intronic
912466804 1:109880136-109880158 AGTGGTGGGAGTAGAGGTCAGGG + Intergenic
912481001 1:109982084-109982106 AGCTGATGTAGGAGAGTTCGGGG - Intergenic
912638742 1:111323335-111323357 AGGTGAGGTCAGAGTGGTCAGGG - Intergenic
913229814 1:116732394-116732416 ATTTTAGGAAGGAGGGGTCAAGG - Intergenic
913251840 1:116918414-116918436 AGTTGGGGTAGCAGAGTTCTAGG - Intronic
914221848 1:145688635-145688657 TGGTGAGGTAGGACAGGACAAGG + Intronic
914446814 1:147757603-147757625 AGTAGAGGGAGGAGAAGCCAAGG + Exonic
914975488 1:152357073-152357095 AGTTGGGAAAGGAAAGGTCATGG - Exonic
915644687 1:157260920-157260942 AGTTGAAGTAAGAGAAGTCTTGG - Intergenic
915701192 1:157798200-157798222 AGTTGAGGTAGGTGAACTCTTGG + Exonic
915918816 1:159959102-159959124 AGTTGGGGGAGGAGAGTTGAGGG - Intergenic
917976811 1:180245138-180245160 GGCTGAGGGAGGAGGGGTCAGGG - Intronic
918591227 1:186244006-186244028 ATTTGAGGTAGGAGAAGCCGTGG - Intergenic
918660441 1:187081599-187081621 AGATGAGTTTGGAGAGGTGATGG + Intergenic
919236599 1:194853204-194853226 AGTAGAGCTAGGAAAGGTTAAGG - Intergenic
919455151 1:197812541-197812563 GTATGAGGTAGGAGAGATCAGGG - Intergenic
920131681 1:203736896-203736918 GGGTGAGGGAGGAGAGGGCATGG - Intronic
920234559 1:204494277-204494299 AGTGGAGGCAGCCGAGGTCAGGG - Intronic
920371749 1:205483517-205483539 ACTAGAGGTGGGAGGGGTCAGGG - Intergenic
920402039 1:205681948-205681970 GGATGAGGAAGGAGAGCTCAGGG + Intergenic
920547990 1:206834617-206834639 AGTGAAGGAAGGAAAGGTCAAGG + Intronic
920839692 1:209544347-209544369 AGTTGAGGTAAGAAAAGACAAGG - Intergenic
924331708 1:242946430-242946452 AGTTGGGTTAGGAGAGGTGAGGG - Intergenic
1062989214 10:1800003-1800025 AGTTGGTGTTGGAGAGGCCAAGG + Intergenic
1063530091 10:6822552-6822574 AGGTGGGGCAGGAGAGGTCCTGG + Intergenic
1064195715 10:13242550-13242572 ACTGGAGGCTGGAGAGGTCAAGG + Intergenic
1064928080 10:20592435-20592457 ACCTGAGGTAGGGGAGGTCAAGG - Intergenic
1065454711 10:25894864-25894886 TGGTGGGGAAGGAGAGGTCATGG + Intergenic
1066653091 10:37678346-37678368 AGGTGAAGGAGGAGAGGGCAAGG - Intergenic
1066672575 10:37856322-37856344 AGTGGAGGAAGGAGAGCTGAAGG + Exonic
1066675711 10:37884898-37884920 AGTTGATGTTGGAGAGGTAATGG + Intergenic
1067391432 10:45866543-45866565 ACTTGAGCTTGGGGAGGTCAAGG - Intergenic
1067403255 10:45997136-45997158 ACTTGAGCTTGGGGAGGTCAAGG + Intronic
1067871859 10:49969608-49969630 ACTTGAGCTTGGGGAGGTCAAGG + Intronic
1068391664 10:56405840-56405862 AAGTGAGGAAGGAGAGGTAAAGG - Intergenic
1068945016 10:62720993-62721015 AGCTGAGGTCAGAGAGGTGATGG - Intergenic
1069468565 10:68664728-68664750 ACTTGAGATGGGAGAGTTCAAGG - Intronic
1069638034 10:69937519-69937541 TGTAGAGGAAGGAGGGGTCAGGG - Intronic
1070146867 10:73780803-73780825 TGGTGAGGTGTGAGAGGTCAGGG + Intergenic
1071270640 10:84003810-84003832 AGGTGAGGAAGGAGGGGTCAGGG - Intergenic
1071835807 10:89415647-89415669 AGTTGAGGAATGAGATGTTAAGG + Intronic
1073300994 10:102470881-102470903 AGTTGAGGTGGGTGCGGTCGTGG - Exonic
1074003894 10:109399566-109399588 AGTTGAGGGGGAAGAGGACAGGG - Intergenic
1074314257 10:112347336-112347358 TGTGGAGCTAGGACAGGTCAGGG - Intergenic
1074449104 10:113544860-113544882 AGGTGAGGCAGGAGATGGCATGG - Intergenic
1074449333 10:113546441-113546463 AGGTGAGGCAGGAGATGGCATGG + Intergenic
1074822945 10:117194999-117195021 AGAAGAGGTAGCAGAGGGCAAGG + Intergenic
1074889471 10:117723310-117723332 AGTGGAGGTAGGAGTGGGTAAGG + Intergenic
1075125087 10:119693079-119693101 AGATGAGGGAGGAGAGGGCAGGG - Intergenic
1075168565 10:120091814-120091836 AGTTGAGGTGGTAGAGGTCTTGG + Intergenic
1075292686 10:121243769-121243791 GGGTGAGGTAGGACAGGACAGGG - Intergenic
1075884991 10:125892174-125892196 AGATGAGGAAGGAGAAGCCAGGG - Intronic
1076270765 10:129150323-129150345 AGTTGATGTGGGAGTGATCAGGG + Intergenic
1077559237 11:3247255-3247277 ATTTGGGGTAGCTGAGGTCATGG - Intergenic
1077565128 11:3293044-3293066 ATTTGGGGTAGCTGAGGTCATGG - Intergenic
1077886199 11:6390091-6390113 AGGGGAGGTAGGAGAGAGCAGGG - Intergenic
1077977354 11:7261834-7261856 AGATGAGGTCAGAGAGGTGATGG + Intronic
1078091492 11:8267347-8267369 AGTGGTGGTAGGATGGGTCAAGG + Intronic
1078356623 11:10636932-10636954 ATGTGAGATAGGAGAGGTCAGGG + Intronic
1078439921 11:11356154-11356176 AGTTGCAGAAGGAGGGGTCAGGG - Intronic
1079101150 11:17543240-17543262 AGCTCAGGTAGGGCAGGTCAGGG - Intronic
1080497488 11:32834071-32834093 AGATGAGGTTAGAGAGGTAAGGG + Intronic
1080542232 11:33278951-33278973 AGTTGAGTAAGGAGAGTGCAAGG + Intronic
1082817959 11:57522811-57522833 ACTTGAGGTAGGAGAGAGCATGG - Intergenic
1083641054 11:64145542-64145564 AGATGAGGAAGTAGAGGCCACGG + Intronic
1084780073 11:71402180-71402202 TGCTGAGGAAGGAGAGGTGAGGG + Intergenic
1085414269 11:76309966-76309988 TGTTGAGGGAGGAGAGGGGAAGG - Intergenic
1085819113 11:79773051-79773073 TGTTGAACTAAGAGAGGTCAAGG - Intergenic
1087042954 11:93819614-93819636 AGCCCAGGTAGGAGAGGGCAAGG + Exonic
1087377198 11:97358739-97358761 AGATGAGGAAGGAGAGGTCATGG - Intergenic
1088711530 11:112513056-112513078 ATTTGATGTTGGTGAGGTCATGG + Intergenic
1089666282 11:120022062-120022084 AATTGAGATAAGAGAGGTCTAGG - Intergenic
1090685969 11:129119912-129119934 AGATGAGGTCGGAAAGGTAAGGG + Intronic
1092297328 12:7210741-7210763 AGTTTTGGTAGGAGTGCTCATGG + Intronic
1092729816 12:11519958-11519980 AGTTAGGGTAGTACAGGTCAAGG - Intergenic
1096504922 12:52086755-52086777 AGCAGAGGTAAAAGAGGTCAAGG - Intergenic
1098896275 12:76064821-76064843 AGTTGGGGAAGTAGAGGTCCAGG - Intronic
1099532776 12:83806115-83806137 AGGTGATGTAGCAGAGGTCAAGG + Intergenic
1100030791 12:90188083-90188105 AGGTGAGGGAGGAGCAGTCATGG + Intergenic
1100491384 12:95082235-95082257 AGTTAAGGTAGGAGGAGACAGGG - Intronic
1101088970 12:101265300-101265322 AGTTGAAGAATGAGAAGTCATGG - Intergenic
1101229012 12:102720806-102720828 AGGTGAGGAAGGGGAGGTAAAGG - Intergenic
1102311959 12:111852297-111852319 AGCAGAGGTAGAAGAGGTGAAGG - Intronic
1102404131 12:112658028-112658050 AGATGAGGTTGGTGAGATCATGG + Intronic
1102665455 12:114568594-114568616 AGTAGAGGTCGGAGGCGTCAGGG - Intergenic
1103162299 12:118739652-118739674 AGTTGAGCCTGAAGAGGTCAGGG + Intergenic
1103225651 12:119285154-119285176 AGCAGAGGGAGGAGAGGTGAGGG - Intergenic
1103522263 12:121544199-121544221 AGCTGAGGTAGGAGGAGTCCTGG + Intronic
1104321450 12:127755208-127755230 AGTTGAGCTCAGAGAGGTAATGG + Intergenic
1104578509 12:129990764-129990786 TGTTGAGTGAGGAGAGGGCATGG + Intergenic
1105345449 13:19567108-19567130 AGTTGAGGGAGAAGAAGGCAAGG - Intergenic
1107500779 13:40972948-40972970 TGTTGAGGTAGGAAAGGGGAGGG + Intronic
1108266324 13:48712524-48712546 AGATGGGTTAGGAGAGGACATGG + Intergenic
1109829332 13:67766155-67766177 AGTTGAGGAATGAGAGAGCATGG - Intergenic
1110596443 13:77326122-77326144 CGTTGAGGTAGGAGGTGGCATGG - Intronic
1110832809 13:80051136-80051158 AGTTGAAGAACGAGAGGTTAGGG - Intergenic
1114317020 14:21518977-21518999 AGTGGGGGTGGGAGAGGTTAAGG + Intergenic
1114466624 14:22927789-22927811 AGTTGAGCTTGGGAAGGTCAAGG - Intronic
1118298798 14:64595548-64595570 GTTAGAGGTAGGAGAGGTAAAGG - Intergenic
1118764570 14:68901152-68901174 AGGAGAGGTGGGAGAGGGCAGGG + Intronic
1118892943 14:69924703-69924725 AGGGGAGGTAGGAGAGGTAGGGG + Intronic
1118892966 14:69924765-69924787 AGGGGAGGTAGGGGAGGTAAGGG + Intronic
1118893008 14:69924881-69924903 AGGGGAGGTAGGAGAGGTAGGGG + Intronic
1119682884 14:76606089-76606111 AACTGAGGTCGGAGAGGTAATGG + Intergenic
1120225732 14:81789303-81789325 CTTGGAGGTAGGAGAGGGCAGGG - Intergenic
1120617108 14:86720795-86720817 AGCTGAGGGAGTAGAGGACATGG - Intergenic
1120701835 14:87706583-87706605 AGCTTAGGCAGAAGAGGTCATGG + Intergenic
1121320142 14:92987373-92987395 AGTTGAGGCAGCAGAGGCCAGGG - Intronic
1121418939 14:93798847-93798869 AGGTGGGGTTGGAGAGGTGAGGG - Intergenic
1121970996 14:98355720-98355742 TCTGGAGGTTGGAGAGGTCAAGG - Intergenic
1123066459 14:105621801-105621823 GGTTGAGGGCGGTGAGGTCAGGG + Intergenic
1202873047 14_GL000225v1_random:181780-181802 AGATGAGGAAGGAGAAGCCAGGG + Intergenic
1124792314 15:32739999-32740021 AGGTGAGGCAGTAGAGGGCAGGG - Exonic
1125267306 15:37897933-37897955 AGTTGAGATTGGAGAGTTAAAGG - Intergenic
1127128348 15:55835695-55835717 AGTTGAGATAGGATTGGTAAGGG - Intronic
1127770573 15:62226928-62226950 AGGGGAAGGAGGAGAGGTCAAGG - Intergenic
1131443683 15:92477763-92477785 ACTTGAGCTAGGGGAGGTTATGG - Intronic
1132843769 16:1990676-1990698 AGTTGAGGGAGGAGAGGCTCTGG + Intronic
1132953069 16:2575659-2575681 AGCTGAGGTTGGAGAGGGCAGGG + Intronic
1132961282 16:2624509-2624531 AGCTGAGGTTGGAGAGGGCAGGG - Intergenic
1133843823 16:9435996-9436018 AGTGGAGGAGGGAGAGATCAGGG + Intergenic
1134020798 16:10920103-10920125 GGTGGAAGTAGGGGAGGTCAGGG + Intronic
1135848229 16:25938695-25938717 AATGGAGGCAGGAGAGTTCAAGG - Intronic
1135881190 16:26259247-26259269 CCTGGAGGGAGGAGAGGTCATGG + Intergenic
1136372310 16:29844125-29844147 AGATGAGGAAGTAGAGGTCCAGG - Intronic
1136585291 16:31180529-31180551 AGTTGGGGGAGGCGAGGCCACGG - Intronic
1137886505 16:52110151-52110173 AGTTGATGTTAGAGAGGTAAGGG + Intergenic
1137925090 16:52532867-52532889 AGTGGGGGTAGGAGAAGTCAAGG + Intronic
1138225696 16:55292486-55292508 AGCTGAGGGAGGAGAGTTCCAGG + Intergenic
1139386811 16:66578349-66578371 AGTTGAGGCTGGAGAGGTGCAGG - Intronic
1139924421 16:70478351-70478373 GGTGGAGGTAGAAGAGGTCACGG + Exonic
1140950113 16:79808811-79808833 AGTGAAGGTAACAGAGGTCAGGG - Intergenic
1141260437 16:82448795-82448817 AGTTGAGGTCAGGGAGTTCATGG - Intergenic
1141316725 16:82969389-82969411 CCTTGAGGTGGGAGAGATCAGGG - Intronic
1143761990 17:9111430-9111452 GGTGGTGGTAGGAGAGGTGAAGG + Intronic
1144673133 17:17144129-17144151 AGGTGCGGAAGGAGTGGTCAGGG + Intronic
1145199095 17:20924495-20924517 AGTGGAGGGAGGGGAGGACATGG - Intergenic
1145837255 17:27963867-27963889 AGTTGTGCTTGGAGAGGACAAGG - Intergenic
1146630224 17:34464244-34464266 AATTGAGTTAGGAGAGGGGAGGG + Intergenic
1146905080 17:36612993-36613015 AGTTGAGGGAGGAGAGGGGTTGG + Intergenic
1148758668 17:49987931-49987953 AGAGGAGGAAGGGGAGGTCAGGG + Intergenic
1148782814 17:50130949-50130971 AGGTGAGGGAGGAGGGGTCTAGG + Intergenic
1149030559 17:52078251-52078273 AGTTGAGGTAGGGAAGGAAATGG + Intronic
1149854119 17:60064342-60064364 TGTTGTGGTAGGTGATGTCATGG - Intronic
1151554473 17:74839632-74839654 AAATGAGGGAGGACAGGTCACGG - Exonic
1152081678 17:78191247-78191269 ACTGGAGGCAGGAGAGGTCCGGG + Intronic
1153640727 18:7154792-7154814 AATTGAGAGAGGAGAGGGCAGGG + Intergenic
1156048765 18:32906975-32906997 AGTTGTGGTGGGAGAGGTTTGGG - Intergenic
1156516225 18:37682921-37682943 AGTTGAGGTAAAAGAGGTCACGG + Intergenic
1156546714 18:37970636-37970658 AGTTGAGGTGGGAGAAGAGAGGG + Intergenic
1157157261 18:45280325-45280347 AGTTCAGACAGGAGAGATCAGGG + Intronic
1157259526 18:46166320-46166342 ATTTAAGGGGGGAGAGGTCATGG - Intergenic
1157515832 18:48310725-48310747 AGCTGAGCTAGGGGAGGCCAGGG - Intronic
1158141237 18:54258701-54258723 AGCTGAGCTAGGGAAGGTCAAGG - Intergenic
1159118379 18:64140836-64140858 AAGGGAGGTAGGAGAGTTCATGG + Intergenic
1161636615 19:5393292-5393314 AGTTGGGGTCAGAGAGGCCATGG - Intergenic
1161989641 19:7677369-7677391 AGTTCAGATGGGAGAGGTAAGGG + Intronic
1162024765 19:7887720-7887742 AGTTGCGGGAGGAGAGGACGGGG - Intergenic
1162534340 19:11254026-11254048 AGATGAGGGAGCAGAGGCCAGGG - Intronic
1163440903 19:17322204-17322226 AGCTGAGGTAGGGGAGGGGAAGG - Exonic
1165460220 19:35939905-35939927 GGTTGTTGTAGGAGAGGTCGAGG - Exonic
1165535376 19:36439890-36439912 GGTTGGGGTGGGAGAGGTAAGGG + Intergenic
1165834004 19:38743622-38743644 ATCTGAGGGAGGAGAGGCCAAGG - Intronic
1167375888 19:49111547-49111569 AGTAGAGTTAGGAGAGGTAGAGG + Intergenic
1167586310 19:50377604-50377626 ACTCGTGGTAGGAGAGGACATGG - Exonic
1167874637 19:52401499-52401521 AGATGAGGTCAGAGAGGTCCTGG - Intronic
1167885905 19:52499900-52499922 AGATGAGGTCAGAGAGGTCCTGG - Intronic
1167891344 19:52542308-52542330 AGATGAGGTCAGAGAGGTCCTGG - Intronic
1167916535 19:52744403-52744425 AGATGAGGTCAGAGAGGTCCTGG + Intergenic
1167920657 19:52780510-52780532 AGATGAGGTCAGAGAGGTCCTGG + Intronic
1167922521 19:52793548-52793570 AGATGAGGTCAGAGAGGTCCTGG + Intronic
1167963193 19:53123637-53123659 AGATGAGGTCAGAGAGGTCCTGG + Intronic
1202648442 1_KI270706v1_random:160530-160552 ATTTGAGGAAGGACAGGTGAGGG + Intergenic
925584535 2:5450980-5451002 AGATCAGGTAGGAGAGAACAAGG + Intergenic
926705403 2:15834108-15834130 AGTGGATGCAAGAGAGGTCAAGG - Intergenic
927082719 2:19646407-19646429 AGTCAAGGTAAGGGAGGTCATGG + Intergenic
927728729 2:25450885-25450907 AGTTGAGCCCGGGGAGGTCAAGG - Intronic
927846491 2:26475035-26475057 GGTTGTGGTAGGTGAGGGCAGGG + Intronic
927869669 2:26615575-26615597 AGTTGGGGAAGAAGAGCTCAGGG - Intronic
930893005 2:56412800-56412822 AGAGGAAGTAGGACAGGTCAGGG - Intergenic
932276951 2:70458763-70458785 GGTTCAGGGAGGAGAGGTTAGGG - Intronic
932426065 2:71636123-71636145 AGTTGAAGGACGTGAGGTCAGGG + Intronic
933827502 2:86176717-86176739 AGTGGAGTGAGGAGAGGCCAAGG + Intronic
934123555 2:88863903-88863925 ACTTGAGGGCAGAGAGGTCAAGG + Intergenic
934157068 2:89213261-89213283 AGTTTTGGTAGAAGGGGTCAGGG - Intergenic
934210248 2:89969484-89969506 AGTTTTGGTAGAAGGGGTCAGGG + Intergenic
934517079 2:94995419-94995441 AGCTGAGGTTGGTGGGGTCAGGG - Intergenic
935211980 2:100946170-100946192 AGTGGAGGCAGGTGAGCTCATGG + Intronic
935363667 2:102268207-102268229 AGTTGAGGTAGCAGAGGAAAGGG - Intergenic
936160240 2:110079331-110079353 AGCTGAGGTTGGTGGGGTCAGGG + Intergenic
936184424 2:110292023-110292045 AGCTGAGGTTGGTGGGGTCAGGG - Intergenic
936349590 2:111702695-111702717 TGTGGAGGAAGGAAAGGTCAGGG + Intergenic
936980235 2:118256953-118256975 AGTTGAGGTGGGATGGGACAAGG + Intergenic
937334969 2:121056620-121056642 AGTTGAGGTAGGTGGGAGCAGGG - Intergenic
937720072 2:125084060-125084082 ACTTAAGTTAGGAGAGGTGAAGG + Intergenic
939111498 2:138013304-138013326 AGATGAGGTTGGAGAGATTAGGG - Intronic
939266747 2:139884330-139884352 AGTTGAAGAAGGAGAGCACATGG + Intergenic
939559868 2:143719767-143719789 AGATGAGGTCAGAGAGGGCAGGG - Intronic
941265364 2:163354886-163354908 AGTTAACGTAGCAGAGGTAATGG + Intergenic
941333982 2:164217250-164217272 AGGTGAAGTAGGAGAGTTCGTGG + Intergenic
942780964 2:179642424-179642446 TGTTGAGACAGGAGAGGACATGG - Intronic
944743396 2:202633950-202633972 AGTAGAGGGAAAAGAGGTCATGG + Intergenic
946268607 2:218569821-218569843 AGGAGAGGAAGGAGAGTTCAAGG - Intronic
1168764047 20:369785-369807 AGATGAGGTCAGAGAGGTAAAGG - Intronic
1168771056 20:417238-417260 AGAAGAGGTTGGAGAGGTCAGGG + Intronic
1169913685 20:10667318-10667340 AGTTGAGTCAGCAGAGCTCAGGG - Intronic
1169963338 20:11187541-11187563 AGATGAGTAAGGAGAGGTAAGGG + Intergenic
1170443521 20:16402030-16402052 AAGTGAGGGAGGGGAGGTCAAGG - Intronic
1170947939 20:20908816-20908838 GGCTGAGGTAGGAGGTGTCATGG + Intergenic
1172777267 20:37414951-37414973 AGTTGAGGAAGATGAGGACAAGG - Intergenic
1172808877 20:37633120-37633142 AGATGAGGAAGGAGAGGAGATGG + Intergenic
1173317986 20:41962090-41962112 AGTTGGGGTGGGAGTAGTCAAGG - Intergenic
1174645410 20:52081063-52081085 AGGTGGGGTGGGAGAGGCCATGG + Intronic
1174852190 20:54006247-54006269 AGTTTAGGGAGGAGGGGTTAAGG - Intronic
1175202582 20:57288250-57288272 TGGTGAGGAAGGAGAGGTCTTGG - Intergenic
1175595000 20:60223953-60223975 AGTTGTGGAAGGAGAGGTGTTGG - Intergenic
1176603411 21:8812160-8812182 ATTTGAGGAAGGAGAGGTGAGGG - Intergenic
1179101838 21:38361164-38361186 GGTTGAGTTAGGAGAGGGAAAGG - Intergenic
1179290198 21:40011824-40011846 AGTGGAGATAGGAAAAGTCATGG + Exonic
1179968517 21:44820211-44820233 AGTTAAGAGAGGAAAGGTCAGGG + Intergenic
1180285048 22:10737737-10737759 AGATGAGGAAGGAGAAGCCAGGG - Intergenic
1180345695 22:11703718-11703740 ATTTGAGGAAGGAGAGGTGAGGG - Intergenic
1180605344 22:17054849-17054871 AGCTGAGGCAGGAGGGGTCAAGG + Intergenic
1181377683 22:22473065-22473087 AGTTGAGGTGGGACAGGGAAAGG + Intergenic
1181516479 22:23416587-23416609 AGCAGAGGGAGTAGAGGTCATGG - Intergenic
1182042977 22:27252821-27252843 AGTAAATGTAGCAGAGGTCACGG - Intergenic
1182513295 22:30835798-30835820 ACTTGAGATAGGGGAGGTCGAGG - Intronic
1182756243 22:32682038-32682060 AAGTGAGGGAGGAGAGGGCACGG + Intronic
1183589033 22:38769357-38769379 AGATGAGGTCAGAGAGGACAGGG + Intronic
1184460119 22:44633174-44633196 AGATGAGGCAGGAGAGGCCGTGG - Intergenic
1185289232 22:50015551-50015573 GGCTGGGGTAGGAGAGGACAGGG - Intronic
953206194 3:40831940-40831962 AGGTGAGGTAAAAGAGGTCTGGG - Intergenic
954791109 3:53134146-53134168 ATTTGAGTTTGGAGAGATCAAGG + Intergenic
956166982 3:66404576-66404598 AGTTGAGGAAAGAGAAGTGAGGG - Intronic
956756092 3:72388424-72388446 AGTTGAGATGGGAGAGGAGATGG - Intronic
959007827 3:101040463-101040485 AGGTGAGGTCAGAGATGTCAGGG - Intergenic
959026837 3:101248982-101249004 ACAAGAGGAAGGAGAGGTCAGGG + Intronic
959530294 3:107428734-107428756 ATTAGAGGAAGGAAAGGTCAGGG - Intergenic
959656137 3:108807403-108807425 AGGTGTATTAGGAGAGGTCAGGG + Intergenic
961428724 3:126865019-126865041 AGTAGAGGTAGTAGAGGTAGTGG - Intronic
962086973 3:132201389-132201411 TTTTGAGGTAGCAGAGGTCAGGG + Intronic
962734664 3:138315274-138315296 AGTTGAGGTGGGAGACGAAAGGG + Intronic
963727435 3:148937898-148937920 AGTTGAGATTGGAGGGGACAAGG + Intergenic
965773478 3:172205296-172205318 AGTTGGGGTAGGAGAGGGCCTGG + Intronic
967145094 3:186599744-186599766 AGCTGGGGCAGGAGAGGGCAGGG - Intergenic
968150708 3:196335224-196335246 AGTGGGGGTAGGAGAGGGGAGGG + Intronic
969168355 4:5337688-5337710 AGTTGAGTTACGAGAGGTTCAGG + Intronic
970170972 4:13290387-13290409 AGTTGAGCAAGGAGGGGCCAAGG + Intergenic
971681159 4:29702800-29702822 AGTAGAGGTAGGAGAAAGCAGGG + Intergenic
973176557 4:47212897-47212919 GGTGGAAGTAGCAGAGGTCAAGG + Intronic
973702101 4:53547578-53547600 AGTAGGGGAGGGAGAGGTCAGGG - Intronic
975366235 4:73532041-73532063 AGTTGAAGTAGGAGATGACAAGG - Intergenic
975773560 4:77758050-77758072 AATTGAAGTAGAAGAGTTCAAGG - Intronic
975991824 4:80266257-80266279 TGTAGAGGTGGGAGAGGACAAGG + Intergenic
976463815 4:85344499-85344521 AGTGGAAGTAAGAGAGATCAGGG - Intergenic
976494894 4:85716797-85716819 AGTAGAGCTAAGAGTGGTCAGGG - Intronic
976668230 4:87623247-87623269 ACTAGAGGTAGGAGAGGGGAGGG - Intergenic
978290386 4:107131179-107131201 ACCTGAGGGAAGAGAGGTCAAGG - Intronic
979446048 4:120813370-120813392 GGTTGAGGCAGGAATGGTCATGG - Intronic
979454623 4:120913444-120913466 AGTTGATATAGCAGAGGTCAGGG + Intronic
984592956 4:181636908-181636930 GGCTGAGGTCAGAGAGGTCATGG - Intergenic
985698406 5:1356219-1356241 CGTGGAGGAAGCAGAGGTCAGGG + Intergenic
986213941 5:5700197-5700219 AGTTCAGGTGAGAGAGGTGAGGG - Intergenic
987031546 5:13980782-13980804 AGTTGGAGTAGGAGAGGTATTGG - Intergenic
987653369 5:20773831-20773853 ATTTGAGCCTGGAGAGGTCAAGG + Intergenic
988742206 5:34087654-34087676 ATTTGAGCCTGGAGAGGTCAAGG - Intronic
988793722 5:34633159-34633181 AGTTCAAGGAGCAGAGGTCACGG + Intergenic
989045859 5:37272750-37272772 AGCTAAGGAAGGAGTGGTCAGGG + Intergenic
989086750 5:37684903-37684925 AGTGGAGGAAGCAGAGCTCAGGG + Intronic
989816192 5:45740621-45740643 TGTTGTGGTACAAGAGGTCAGGG - Intergenic
990273771 5:54173873-54173895 AGTTGAGGTAAGAGAGGGCATGG - Intronic
990309269 5:54522290-54522312 AGTTGGGGTTGGGGAGGTGACGG - Intronic
990809182 5:59702784-59702806 ACCTGAGCCAGGAGAGGTCAAGG + Intronic
991020149 5:61971899-61971921 AGGTGAGGTTAGAGAGGACATGG - Intergenic
992353858 5:75958848-75958870 GGTTGAGGTTGAAAAGGTCAAGG - Intergenic
992888782 5:81185132-81185154 AGTTGAGGTAGGAGAGGTCAAGG + Intronic
993397013 5:87402768-87402790 ATTTTAGGTAGGAGAGGGAAAGG - Intronic
993494707 5:88594678-88594700 AGGTGAGATCAGAGAGGTCATGG + Intergenic
993921063 5:93803414-93803436 AATTGAAGTAGGAGAGTTCTAGG - Intronic
995050828 5:107701179-107701201 AGGTGAGGTAGGAGAGGGTGTGG + Intergenic
995590034 5:113689786-113689808 TGTTGGGGGAGTAGAGGTCAAGG + Intergenic
996056386 5:118987873-118987895 AGTTCTGGTAGGATAGGTAAAGG + Intronic
997591488 5:135075837-135075859 AGTTCTGGTAGCAGAGATCAAGG + Intronic
998268187 5:140682423-140682445 AGATGAGGTAGGAGAGGCAGTGG + Intronic
998727529 5:145034903-145034925 AGGTGAGGTATGTGAGGTGATGG - Intergenic
999240975 5:150127175-150127197 AGTTGGGGTTGGAGTGGTGACGG + Intronic
999461437 5:151760276-151760298 TGTTTAAGAAGGAGAGGTCAGGG - Intronic
1001010704 5:168095281-168095303 AGTTGAGTTTGGAGAGATCCAGG - Intronic
1001639045 5:173232524-173232546 TGTTGAGGTGGGATCGGTCAGGG + Exonic
1002379142 5:178812860-178812882 TGGTGAGGTAGCAGAGGACAGGG + Intergenic
1002625266 5:180522779-180522801 GGCTGAGGTGGGAGAGGGCATGG + Intronic
1003814949 6:9829084-9829106 GGTTGAGTTGGGAGAGGCCATGG + Intronic
1005529892 6:26692434-26692456 ATTTGAGGGAGGAGAAGTCAAGG - Intergenic
1005540904 6:26809213-26809235 ATTTGAGGGAGGAGAAGTCAAGG + Intergenic
1005795623 6:29358789-29358811 GTTTGAGGTAGGAGTGGACAGGG + Intronic
1005967816 6:30740323-30740345 AGATCAGGTAGGAAATGTCAGGG + Intronic
1006144463 6:31950174-31950196 ACTTGGGGGAGGTGAGGTCAAGG + Intronic
1006408511 6:33858636-33858658 TGTTGAGGCAGGAGTGGTCTAGG - Intergenic
1008736373 6:54549488-54549510 AATTGAGGTTGGAGAGGCAATGG - Intergenic
1009011720 6:57851301-57851323 ATTTGAGGGAGGAGAAGTCAAGG + Intergenic
1009491117 6:64292554-64292576 ATTTGAGGTAAGAGTAGTCAAGG + Intronic
1013106476 6:107030174-107030196 AGATGAGGTTGGAGAGGAAATGG + Intronic
1013591897 6:111625929-111625951 AGGTGAGGTAGGAGAGGGTTTGG - Intergenic
1013607415 6:111763026-111763048 AGTTGAGGTAAGTGGGGTCAGGG - Intronic
1015164513 6:130188599-130188621 GATTGAGGTAAGAGAGGTTAGGG - Intronic
1016090731 6:139975904-139975926 ATTTGAGGTAGGAAAGGAAATGG - Intergenic
1017523691 6:155224368-155224390 AGTTGAGGGAGGAGGGGTCATGG + Intronic
1018795931 6:167185620-167185642 AGGTGAGATAAGGGAGGTCAGGG + Intronic
1018820386 6:167369444-167369466 AGGTGAGATAAGGGAGGTCAGGG - Intronic
1018881615 6:167888018-167888040 AGTTGGGGCAGGAGGGATCATGG + Intronic
1019349941 7:549935-549957 AGTTGAGGCCGAAGAAGTCAAGG - Exonic
1019650183 7:2152658-2152680 AGTTGAGCCTGGAGGGGTCAGGG - Intronic
1028460497 7:91086510-91086532 AGTAGAGTTAGGGGAGATCAAGG - Intronic
1029018341 7:97338051-97338073 GGATGAGGTTAGAGAGGTCAAGG - Intergenic
1029513619 7:101012499-101012521 CGTAGAGGAGGGAGAGGTCAAGG - Intronic
1029710134 7:102294916-102294938 GGGTTAGGTAGGAGAGGTCAGGG + Intronic
1030279640 7:107758912-107758934 TGTTGAGGTGGGGGAGGTCCTGG - Exonic
1030841891 7:114364270-114364292 AGTGGAGGTCGTGGAGGTCATGG + Intronic
1031159732 7:118151998-118152020 AGATGAGGTGGGAGAGTTTATGG + Intergenic
1031489512 7:122369612-122369634 ACCTGAGGGAGGAGATGTCAAGG - Intronic
1034380030 7:150683855-150683877 AGGTGAGGAAGGAGAGGGCAGGG - Intergenic
1034390651 7:150785025-150785047 AGCTAAGGTAGCAGAGGGCAGGG + Intergenic
1034538960 7:151744016-151744038 AGATGAGGAAGGAGAGGTCAGGG + Intronic
1034844549 7:154432006-154432028 AGTGGAGGGTGGAGAGGCCAAGG - Intronic
1035017396 7:155778649-155778671 AGTTCAGGTAGGGCAGGTGAGGG + Exonic
1036034434 8:5003813-5003835 AGATGAGGAATGAGAGGTCCCGG - Intergenic
1036142105 8:6218126-6218148 AGTTAAGGCAGGAGAAATCAGGG - Intergenic
1036732241 8:11276129-11276151 GGTGTAGGGAGGAGAGGTCAGGG + Intergenic
1036749532 8:11435125-11435147 AGAGGAGGCTGGAGAGGTCAAGG - Intronic
1036939077 8:13033766-13033788 AGGTGAGGGAGGGGAGGGCAGGG + Intergenic
1037608671 8:20458477-20458499 ACTTGGGGTTGGAGAGATCAAGG + Intergenic
1037746830 8:21652184-21652206 AGATGAGGTTGGAGATGTGATGG - Intergenic
1038040336 8:23718704-23718726 AGATGAGGTCAGAGAGGTAAGGG + Intergenic
1038076165 8:24077179-24077201 AGTTGAAGAGGCAGAGGTCAGGG - Intergenic
1038772976 8:30501262-30501284 TGTTGGGGTGGGAGGGGTCAGGG - Intronic
1038992215 8:32880152-32880174 ATTTGAGGTAGGTGAGGAAAAGG + Intergenic
1039844171 8:41314062-41314084 AGGTGAAGCTGGAGAGGTCATGG - Intergenic
1041229744 8:55737404-55737426 GGTTGAGCCTGGAGAGGTCAGGG - Intronic
1041327692 8:56686747-56686769 AGTTGAGGTAGGAGCTTTCATGG + Intergenic
1041689063 8:60671730-60671752 ATTTGAGGTGGGAGAGATCAAGG - Intergenic
1042404581 8:68389438-68389460 AGTGCATGTAGGAGAGATCATGG + Intronic
1042689256 8:71479102-71479124 AGGTGAGGTCAGAGAGGTAAAGG - Intronic
1044300593 8:90578681-90578703 AGATGAGGCAGGAGGGCTCAAGG - Intergenic
1044681161 8:94778908-94778930 AGTGGAGGAAGGTGAGGCCATGG + Intronic
1044785018 8:95784127-95784149 AGTTGAGCTGGAAGAGGACAGGG - Intergenic
1045985978 8:108250212-108250234 AGATGAGGTCAGAGAGGTAATGG - Intronic
1047290534 8:123525711-123525733 AGGTGAGGAAGCAGAGGCCAGGG - Intronic
1047954065 8:129960001-129960023 TGTAGAGGTAGGATAGGTCAGGG - Intronic
1048760372 8:137788023-137788045 AGTTGAGAAAGGAGGGGCCATGG - Intergenic
1049428036 8:142545946-142545968 AGTTGAGGTTGTAGGGGTGAGGG - Intergenic
1051940730 9:22502541-22502563 ATTTGGGGTTGGAGAGTTCACGG + Intergenic
1054810803 9:69432520-69432542 TGGGGAGGTAGGAGAGGTCCGGG - Exonic
1054910703 9:70452734-70452756 AGTTTAGGTAAGAGAGCCCAAGG + Intergenic
1055093363 9:72385451-72385473 AGTTCAGGTAGTAGATGTCGAGG - Intergenic
1055134228 9:72808562-72808584 AGTTCAAATAAGAGAGGTCAGGG - Intronic
1055360569 9:75485565-75485587 TAGAGAGGTAGGAGAGGTCAAGG + Intergenic
1055620817 9:78123072-78123094 AGTTGAGGTCAAAGAGGTGATGG - Intergenic
1057304771 9:93905680-93905702 TGCTGAGGCTGGAGAGGTCAAGG + Intergenic
1059629452 9:116104906-116104928 AATTAAGGTAGGAGAGGTGAAGG + Intergenic
1059659172 9:116384369-116384391 ACTTGAGCTCAGAGAGGTCAAGG + Intronic
1061044371 9:128156854-128156876 AGTTCAGGGAGGAGAAGGCAGGG + Intergenic
1061372812 9:130207319-130207341 AGTTGAGGTCAGAGACCTCAGGG - Intronic
1061570749 9:131476203-131476225 AGTTCTGGTAGGAGAGCTCAGGG - Exonic
1061597743 9:131643086-131643108 AGTTGTGGGGGGAGTGGTCAGGG + Intronic
1061926503 9:133808472-133808494 AGGTGGGGTAGGGGAGGTGAAGG + Intronic
1203731410 Un_GL000216v2:94765-94787 AGATGAGGAAGGAGAAGCCAGGG - Intergenic
1185558146 X:1037381-1037403 AGTGAGGGTAGGGGAGGTCATGG - Intergenic
1186736553 X:12471437-12471459 AGTTTAAGGAGTAGAGGTCAGGG + Intronic
1186958924 X:14713788-14713810 AGTTAAGGTCTGAGAGGTAAAGG + Intronic
1187452576 X:19411833-19411855 AGAGGAGGTTGGAGAGCTCATGG + Intronic
1188252705 X:27918309-27918331 AGAGGAGGAAAGAGAGGTCATGG - Intergenic
1190528889 X:51355109-51355131 AGGTGAGGGAGGAGAAGTAAGGG - Intergenic
1191668663 X:63728943-63728965 AGTGGAGTTTGGAGAGGTTAGGG + Intronic
1191732285 X:64349953-64349975 TGTAGAGGTAGGAGAGCACAGGG + Exonic
1192389324 X:70708790-70708812 AGTAGAGGGGGGAGAGGTGAAGG + Intronic
1193356821 X:80529111-80529133 AGAAGAGGTATGAGAGGACATGG + Intergenic
1194356076 X:92885458-92885480 AGTTCAGGTAGGAGATGATAGGG + Intergenic
1195240927 X:102951065-102951087 AGTTGGGGCAGGAGAGGGGAGGG - Intergenic
1196350864 X:114727353-114727375 AGTTGAGGTAGGAAAAGAAAAGG + Intronic
1196612970 X:117734834-117734856 AGTAGAGGTAGGAGAGGGAAGGG + Intergenic
1196938737 X:120754961-120754983 AGATGAGGTTAGAGAGTTCATGG + Intergenic
1197238599 X:124096800-124096822 TTATGAGGTAGGAGAGGGCAAGG - Intronic
1197337361 X:125224215-125224237 AGATGAGGGAGGAGAGTGCAAGG - Intergenic
1199482114 X:148309159-148309181 AGTTAAGTTTGGAGAAGTCATGG + Intergenic
1200287476 X:154837547-154837569 AGCTGAGGAGGGAGAGGTGACGG + Exonic
1200664421 Y:6002436-6002458 AGTTCAGGTAGGAGATGATAGGG + Intergenic
1201229048 Y:11845595-11845617 AGTTGGGTTAGGAGAGGTGAGGG - Intergenic