ID: 992888783

View in Genome Browser
Species Human (GRCh38)
Location 5:81185137-81185159
Sequence AGGTAGGAGAGGTCAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888780_992888783 -9 Left 992888780 5:81185123-81185145 CCTGTGGGAAGTTGAGGTAGGAG 0: 1
1: 2
2: 10
3: 116
4: 861
Right 992888783 5:81185137-81185159 AGGTAGGAGAGGTCAAGGAGAGG No data
992888777_992888783 -5 Left 992888777 5:81185119-81185141 CCCACCTGTGGGAAGTTGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 992888783 5:81185137-81185159 AGGTAGGAGAGGTCAAGGAGAGG No data
992888773_992888783 15 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888783 5:81185137-81185159 AGGTAGGAGAGGTCAAGGAGAGG No data
992888778_992888783 -6 Left 992888778 5:81185120-81185142 CCACCTGTGGGAAGTTGAGGTAG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 992888783 5:81185137-81185159 AGGTAGGAGAGGTCAAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888783 Original CRISPR AGGTAGGAGAGGTCAAGGAG AGG Intronic
No off target data available for this crispr