ID: 992888784

View in Genome Browser
Species Human (GRCh38)
Location 5:81185138-81185160
Sequence GGTAGGAGAGGTCAAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 696}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992888778_992888784 -5 Left 992888778 5:81185120-81185142 CCACCTGTGGGAAGTTGAGGTAG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG 0: 1
1: 0
2: 2
3: 52
4: 696
992888780_992888784 -8 Left 992888780 5:81185123-81185145 CCTGTGGGAAGTTGAGGTAGGAG 0: 1
1: 2
2: 10
3: 116
4: 861
Right 992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG 0: 1
1: 0
2: 2
3: 52
4: 696
992888777_992888784 -4 Left 992888777 5:81185119-81185141 CCCACCTGTGGGAAGTTGAGGTA 0: 1
1: 0
2: 1
3: 8
4: 165
Right 992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG 0: 1
1: 0
2: 2
3: 52
4: 696
992888773_992888784 16 Left 992888773 5:81185099-81185121 CCTGCTAGCAATTGTGATCACCC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG 0: 1
1: 0
2: 2
3: 52
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992888784 Original CRISPR GGTAGGAGAGGTCAAGGAGA GGG Intronic
900407964 1:2500759-2500781 GGGAGGAGAGGCCAGTGAGAAGG - Intronic
901120001 1:6883447-6883469 GGCAGGAGAGGGCAGGGAGTTGG + Intronic
902329923 1:15726316-15726338 GGTCGGGGAGGTCAGGGAGCCGG - Intronic
902469971 1:16642531-16642553 GGGAGCAGAGGTCAGGGAGCGGG - Intergenic
903043958 1:20552456-20552478 GGGAGAAGAGGGCAAGGGGAGGG + Exonic
903140749 1:21337880-21337902 GGGAGGAGAGGGCAGGGAGGCGG - Intronic
903267346 1:22165743-22165765 GGCAGGAGAGGGCAAGAAGGAGG + Intergenic
903296489 1:22346625-22346647 AGGAGGAGGGGTCATGGAGAAGG - Intergenic
903358292 1:22761671-22761693 GGAGAGAGAGGTCCAGGAGAGGG - Intronic
903545890 1:24123258-24123280 GGAGGGAGAGGTCCAGGGGAGGG - Intronic
903570995 1:24304811-24304833 TGTAGGGGAGGACAAGGAGGAGG + Intergenic
903667634 1:25017620-25017642 GGGAGCTGAGGTCAAGCAGAGGG - Intergenic
903673058 1:25047762-25047784 GGGATGAGAGGGCGAGGAGAGGG - Intergenic
904307765 1:29601246-29601268 GGTAGGAGGGGCCAGAGAGATGG - Intergenic
904762780 1:32817599-32817621 GGTAGGGGAGGTCGGGGAGGGGG + Exonic
904944798 1:34191401-34191423 GGTGGGGGAGGTCAGGGAGAGGG - Intronic
905266327 1:36756524-36756546 GGAAGGAGGGGAGAAGGAGAGGG + Intergenic
906194452 1:43921098-43921120 GGAAGGAAAGTTCAGGGAGAAGG - Intronic
906796003 1:48696889-48696911 GGGAGGAGGGGCCACGGAGAAGG - Intronic
907315677 1:53570081-53570103 GGAAAAAGAGGTCAGGGAGAGGG - Intronic
907408017 1:54265589-54265611 GTGGGGAGAGGACAAGGAGAGGG + Intronic
907504482 1:54907791-54907813 AGTGGGAGAGGTCAAGTTGAAGG + Intergenic
907889731 1:58625298-58625320 GGTAGGAGAAAACCAGGAGAGGG - Intergenic
908567091 1:65368535-65368557 GGAAGGAGAAGGGAAGGAGAAGG - Intronic
908972015 1:69847637-69847659 AGTAGGAGAGGAAAATGAGATGG - Intronic
909125307 1:71660841-71660863 GGTAGTAGGGGGCTAGGAGAGGG - Intronic
909288392 1:73850559-73850581 GGGAGGAGAGGTTAAAGAAATGG - Intergenic
910351871 1:86307649-86307671 GGTAGGAGAGGGCAAGGCAGTGG - Intergenic
910492630 1:87789351-87789373 GATAGCAGAGGCCAAAGAGATGG + Intergenic
910971212 1:92857747-92857769 GGCAAGAGAGGTTAAGAAGAGGG + Intronic
911577990 1:99600707-99600729 ATTGGGAGATGTCAAGGAGAGGG + Intergenic
911690797 1:100831991-100832013 AGTGGGAGAGGTAAAAGAGAGGG - Intergenic
911781523 1:101885522-101885544 GGCAGAAGAGGTGAAGGAGATGG - Intronic
911967280 1:104384779-104384801 GGTAGGAGTGACCAATGAGAAGG - Intergenic
912432446 1:109636083-109636105 GGCAGGAGAGTTGAAGGTGACGG - Intergenic
912597488 1:110893770-110893792 GGTAAAAAAGGTGAAGGAGAAGG + Intronic
913338551 1:117733585-117733607 GTGAGGAGAGGTCAAGGCCACGG - Intergenic
913414171 1:118587038-118587060 GGTAAGTAAGGTAAAGGAGAAGG + Intergenic
913963665 1:143357521-143357543 AGAAGGAGAGGAGAAGGAGAAGG - Intergenic
914058024 1:144183110-144183132 AGAAGGAGAGGAGAAGGAGAAGG - Intergenic
914121121 1:144783255-144783277 AGAAGGAGAGGAGAAGGAGAAGG + Intergenic
915537705 1:156547241-156547263 GGTAGGAGAGGAAAGGTAGAAGG + Intronic
915740544 1:158115527-158115549 GGTAGGAAAGGAAAAGGAGCAGG + Intergenic
915950792 1:160188712-160188734 TGTAGGAAAGGACCAGGAGATGG + Intergenic
915974312 1:160375046-160375068 GGAGGGAGAGGGCAGGGAGATGG + Intergenic
916079536 1:161223753-161223775 GGGAGGAGAGGACAAGCACATGG + Intergenic
916329112 1:163594997-163595019 GGTGGGAGTGACCAAGGAGAAGG - Intergenic
916664950 1:166958135-166958157 GGAAGGTGAGGTCCAGGATATGG - Intronic
918109663 1:181444378-181444400 AGAAGGAGAGGTAAAAGAGAGGG + Intronic
918134264 1:181657477-181657499 GTTAGGAGAGGTAAAGCAGAGGG + Intronic
918386645 1:184014700-184014722 GGGAGGATGGGTCAAGGAAAAGG + Intronic
918733114 1:188022984-188023006 GATAGGAGAGGAGAAGGGGAGGG + Intergenic
918851978 1:189703512-189703534 AGTAGGAGATGGAAAGGAGAAGG + Intergenic
919086891 1:192931132-192931154 AGAAGGAGAGGCCAAGGAGGTGG - Intergenic
920641698 1:207758325-207758347 GGCTGGAGAGTTCAAGGGGATGG + Intronic
920736593 1:208538374-208538396 AGTAGGAGAGGTCTAGGCGAGGG - Intergenic
920968820 1:210724924-210724946 GACAGGAGAAGTCAGGGAGATGG - Intronic
921205458 1:212844984-212845006 GGTAGGAGTGACCAATGAGAAGG - Intronic
921959483 1:221019878-221019900 GCTATGTGAGGCCAAGGAGATGG + Intergenic
922432567 1:225570459-225570481 GGTGGGAGAGGAGAAGGAGGTGG - Intronic
922469484 1:225867059-225867081 GATGGGTGAGATCAAGGAGAAGG - Intronic
922520092 1:226242740-226242762 GGCAGAAGAGGTAGAGGAGATGG - Intronic
922564944 1:226595716-226595738 AGAAGCAGAGGTCAGGGAGAAGG + Intronic
922662933 1:227446055-227446077 GCAAGGAGTGGTCAAGGACAAGG + Intergenic
922974310 1:229770982-229771004 GGCAGGATAGGTTAAAGAGAGGG + Intergenic
923043488 1:230337032-230337054 GGTGGGAGAGGTCCAGGTGGGGG - Intronic
923740632 1:236651709-236651731 AGAAGCAGAGGACAAGGAGATGG - Intergenic
924159177 1:241212526-241212548 GGTAGGAGAGTTGGAGGAAAAGG + Intronic
1063039989 10:2327796-2327818 GGCAGGAGAGGTAAAGAGGAGGG + Intergenic
1063343112 10:5286938-5286960 GGCAGAAGAGGTGAAGGAGGGGG - Intergenic
1063533204 10:6856330-6856352 GGTAGGAAAGGTTATGCAGATGG + Intergenic
1063938987 10:11107944-11107966 GGTAAGAGAGAGCAAGGAGACGG - Intronic
1064014092 10:11759496-11759518 GGCTGGAGAGTTCAAGGTGAGGG - Intronic
1064328817 10:14374884-14374906 GGAAGGAAAGGGAAAGGAGAAGG + Intronic
1064374960 10:14786962-14786984 GGTCTGAAAGGTCAAGGTGAGGG + Intergenic
1064477332 10:15705285-15705307 GGTTGAGGAGGTCAAAGAGAAGG - Intronic
1065186689 10:23175307-23175329 GTTGGGAGAGGTCAGTGAGAAGG - Intergenic
1065691396 10:28337439-28337461 GGTAAGAGAGGAGAAGGAAAAGG + Intergenic
1066074102 10:31855046-31855068 GATAGGAGAGGGAAAGGGGAAGG + Intronic
1067069570 10:43121876-43121898 GGAAGGAGGGGTAAAGGAGAAGG - Intronic
1067345478 10:45435122-45435144 GGTACAAGAGCTCAAGGAGATGG + Intronic
1067870328 10:49953869-49953891 GGTGGGAGAGGAGAGGGAGATGG - Intronic
1070312574 10:75284340-75284362 GGGAGGAGAGGCCCAGAAGAGGG + Intergenic
1072626581 10:97116233-97116255 AGTAGGAGAGGAGAAAGAGAAGG + Intronic
1072739591 10:97901433-97901455 GGGAGGAACGGTCAGGGAGAAGG - Intronic
1073201103 10:101736605-101736627 GGTAGGAGAGGTAAAATAGTGGG - Intergenic
1073757812 10:106599399-106599421 GGAAGGGGAGGGGAAGGAGAAGG + Intronic
1074290801 10:112136915-112136937 GGAAGGAGAGGGCAATGAGCTGG - Intergenic
1074321338 10:112405997-112406019 GGTGGAAGAGGTAGAGGAGATGG + Intronic
1074747410 10:116548619-116548641 CCTAGGGGAGGTCAAGGAGGTGG + Intronic
1074963767 10:118471021-118471043 GGAAGCAGGGGTCAGGGAGAGGG + Intergenic
1075832127 10:125420175-125420197 GGGAGGAGAGGTCATGGGCAGGG + Intergenic
1076066399 10:127451466-127451488 AGAAGGAGAGGGCATGGAGATGG - Exonic
1076133537 10:128029480-128029502 TGTAGCCGAGGTCAGGGAGAAGG - Intronic
1076312752 10:129520397-129520419 GGTAGGAGTAGACAAGGAGATGG - Intronic
1076467841 10:130697303-130697325 GGTCTAAGAGGGCAAGGAGAGGG + Intergenic
1076489946 10:130851922-130851944 GGGAGGAGAAGTGAAGGGGAGGG - Intergenic
1076591386 10:131586138-131586160 GGATGGTGAGGTCAAAGAGAGGG + Intergenic
1077251571 11:1563123-1563145 GGTAGCAGAGGCCAGGCAGAAGG + Intronic
1077868066 11:6239531-6239553 CTAAAGAGAGGTCAAGGAGAAGG + Intronic
1077869930 11:6253168-6253190 GGAAGGTGAGGGCTAGGAGATGG - Intergenic
1078039780 11:7849245-7849267 AGCAGGAGAGGGCCAGGAGAGGG - Intergenic
1078186085 11:9053140-9053162 GGTAAGAGTGGTGGAGGAGACGG - Exonic
1078653222 11:13215142-13215164 GGTAGAAGAGCTCAAGAAGGAGG + Intergenic
1079129411 11:17738607-17738629 GGGAGGAGAGGGCCAGGGGAGGG - Intronic
1079163401 11:18014086-18014108 GGTTGGAGAGATAAAGGTGAGGG - Intergenic
1079815998 11:25058740-25058762 GGCAGGAGTGGTCGAGGGGAAGG - Intronic
1080221439 11:29910057-29910079 GGTGGTGGGGGTCAAGGAGAGGG + Intergenic
1080458796 11:32436418-32436440 GGGAGGAGGGGTGAAGGGGAGGG + Intergenic
1080856019 11:36112350-36112372 GTTAGTAGTGGTCAAAGAGATGG - Intronic
1081047183 11:38290743-38290765 GGTGGGAAGGGTCAGGGAGAGGG - Intergenic
1081674283 11:44959548-44959570 GGTAAGAAAGGTCAAGCCGAAGG - Intergenic
1081746041 11:45473212-45473234 GGGTGGAGAGGCCAAGGACATGG - Intergenic
1082771565 11:57211571-57211593 GGCAGAAGAGGTGGAGGAGATGG - Intergenic
1083674717 11:64318969-64318991 GGGAGGGGAGGTCATGGAGTGGG - Intronic
1083727497 11:64636237-64636259 GGTAGGGGAGGGCTGGGAGAGGG - Intronic
1083988911 11:66234629-66234651 GGTGGCAGAGGTCAAGGGCACGG + Intronic
1084960715 11:72714890-72714912 GGTAGCAGAGGTGTGGGAGATGG - Intronic
1085447438 11:76610182-76610204 GGAAGGATAGGGCAGGGAGAGGG + Intergenic
1086947137 11:92854246-92854268 GCAGGGAGAGGTCAAGGAGCAGG + Intronic
1087940727 11:104093760-104093782 GTTAGGAAAGGAGAAGGAGAAGG - Intronic
1088169075 11:106975167-106975189 AGTAGGAGAGTTAAGGGAGAAGG - Intronic
1089493225 11:118896373-118896395 GGGAGGAGAGGGGACGGAGAGGG + Exonic
1089625645 11:119749133-119749155 GATGGAAGAGGTGAAGGAGAAGG - Intergenic
1089785375 11:120903591-120903613 TGTAGGAAAGGTGAAGGCGATGG - Intronic
1089837397 11:121383216-121383238 GGCAGGTTAGGTCTAGGAGAAGG + Intergenic
1090207197 11:124891887-124891909 AGCAGAAGAGGGCAAGGAGATGG + Intronic
1092536023 12:9388089-9388111 GAGAGGAGGGGTCAAGGAAAGGG - Intergenic
1093017634 12:14170936-14170958 GGGAGGAGAGAGGAAGGAGAAGG + Intergenic
1093130236 12:15383108-15383130 GGTTGGAGTGGACAAGGAAAGGG - Intronic
1093402036 12:18758079-18758101 AATAGGAGAGCCCAAGGAGAGGG - Intergenic
1093607283 12:21108037-21108059 GGTAGAAGAAGTGAAGGAGGCGG + Intronic
1094083791 12:26566286-26566308 GGGAGGAGAGGAGAGGGAGAGGG + Intronic
1094500967 12:31020517-31020539 GGAAGGAGAGGGCAGGCAGAGGG + Intergenic
1095314832 12:40747024-40747046 GGTAGGAGTGGGGCAGGAGAGGG - Intronic
1095799888 12:46260859-46260881 GGTGGGAGAGGGCAAGAAGCAGG - Intronic
1095940651 12:47724735-47724757 GTTATGAGAGGTCCAGGGGATGG - Intronic
1096202908 12:49698539-49698561 GGTAGGGGAGGACATGGATAGGG - Intronic
1096584046 12:52608044-52608066 AGGCAGAGAGGTCAAGGAGAAGG + Exonic
1098231530 12:68376207-68376229 TGTGGGAGTGGCCAAGGAGAAGG - Intergenic
1098331159 12:69355002-69355024 GGGAGGTGAGGTCATGGAGTTGG - Intergenic
1100081407 12:90855656-90855678 GGAAGGAGAGGGAAAGGAAAGGG + Intergenic
1100828767 12:98498894-98498916 GCTAGGAAAGGGCAAGGTGAAGG + Intronic
1101227458 12:102704183-102704205 GGAAGGAGAAGAGAAGGAGAAGG - Intergenic
1102311957 12:111852291-111852313 GGTAGAAGAGGTGAAGGGCATGG - Intronic
1102457094 12:113077674-113077696 GGTAGGCGAGGTCCAGGCGGCGG - Exonic
1102598667 12:114012664-114012686 AGGAGGAGAGGGGAAGGAGAGGG + Intergenic
1103624079 12:122205475-122205497 GGCAGTGGAGGTCAAGGGGAGGG + Intronic
1104098483 12:125583579-125583601 GGGAGAGGAGGTCAGGGAGAGGG + Intronic
1104277680 12:127344657-127344679 GGGAGAGGAGGTCAGGGAGAGGG - Intergenic
1104850669 12:131872024-131872046 GGGAAGGGAGGTGAAGGAGATGG + Intergenic
1105629536 13:22148628-22148650 GGGAGGAGAGGGGAAGGGGAGGG - Intergenic
1105643757 13:22294345-22294367 GCTGCCAGAGGTCAAGGAGAGGG - Intergenic
1105846377 13:24297713-24297735 GGTGCAAGAGGACAAGGAGATGG + Exonic
1106466238 13:30016820-30016842 GGCAGAAGAGGCAAAGGAGATGG - Intergenic
1107996042 13:45862138-45862160 TGGAGCAGAGGTAAAGGAGATGG + Intergenic
1108781130 13:53835529-53835551 GGTAGCAGAGGTGGAGGAGGTGG - Intergenic
1108815119 13:54281480-54281502 GGTAGGTGAGGGCAAGAGGAGGG - Intergenic
1111149027 13:84223659-84223681 TATAAGAGAGGTCAAGCAGAAGG + Intergenic
1111481994 13:88841475-88841497 GGTAGCAGAGGCTAAGGAGTTGG + Intergenic
1112532214 13:100216077-100216099 GGAAGGAGAGGGGAAGGGGAAGG - Intronic
1112542270 13:100326619-100326641 GGCAGGAGAGGTGGAGGAGGTGG - Intronic
1113047447 13:106170960-106170982 GGTAGGAGAGTACATTGAGAAGG + Intergenic
1114069131 14:19094399-19094421 GGGAGGAGGGGACAAGGAGAGGG - Intergenic
1114093129 14:19305604-19305626 GGGAGGAGGGGACAAGGAGAGGG + Intergenic
1114317023 14:21518983-21519005 GGTGGGAGAGGTTAAGGGGATGG + Intergenic
1114529398 14:23386392-23386414 GGAAGGAGACCTCAATGAGATGG - Exonic
1114534799 14:23416081-23416103 GGAAGGAGACCTCAATGAGATGG - Exonic
1115581852 14:34767785-34767807 GGTTGCAGAGGTCAATGTGAAGG + Intronic
1115810563 14:37102507-37102529 GCTAGGAGAGGTAAAGGAACAGG - Intronic
1115905923 14:38202780-38202802 AGCAGGAGAAGACAAGGAGATGG + Intergenic
1115969825 14:38932668-38932690 GGTAGGGAAGGCCAATGAGATGG - Intergenic
1116203548 14:41831937-41831959 GCTAGGTGAGGACAAGGAGAAGG - Intronic
1117047604 14:51828778-51828800 GGCAGGAGAAACCAAGGAGAAGG - Intronic
1117061393 14:51967171-51967193 GGAAGGAGGGGTAGAGGAGAAGG - Exonic
1118132616 14:62983955-62983977 GGTAGAGGAGGACAAGGAGGAGG + Intronic
1118744363 14:68763151-68763173 GGGAGGAAAGATAAAGGAGAAGG - Intergenic
1118832247 14:69445242-69445264 GGTAGAAGAGGTGAAGGAGGTGG - Intronic
1118892945 14:69924709-69924731 GGTAGGAGAGGTAGGGGAGGAGG + Intronic
1118892981 14:69924807-69924829 GCTAGGGGAGGTAAAGGAGGAGG + Intronic
1118893010 14:69924887-69924909 GGTAGGAGAGGTAGGGGAGGAGG + Intronic
1119187476 14:72652909-72652931 GGGAAGAGAGGTCAATGTGAAGG + Intronic
1120436328 14:84487442-84487464 GGAGGGAGAGGTGAGGGAGAGGG + Intergenic
1120615433 14:86698321-86698343 AGGAGTAGAAGTCAAGGAGAGGG - Intergenic
1120891551 14:89496325-89496347 GGTGGGTGAGGTCAAAGAGGAGG - Intronic
1121004172 14:90477633-90477655 GGTAGAAGAGGTAGAGGAGGAGG + Intergenic
1121312771 14:92944154-92944176 GGTGGGAGAGGCCTGGGAGAGGG - Intronic
1121389219 14:93559992-93560014 AGTAGGAGAGGTCAAGTTGAAGG + Intronic
1121970995 14:98355714-98355736 GGTTGGAGAGGTCAAGGAAACGG - Intergenic
1122426235 14:101607706-101607728 AGGAGGAGAGGTGGAGGAGAAGG - Intergenic
1122426246 14:101607749-101607771 AGGAGGAGAGGTGAAGGAGGAGG - Intergenic
1122426300 14:101607950-101607972 AGGAGGAGAGGTGAAGGAGGAGG - Intergenic
1123426137 15:20171719-20171741 GGCAGAAAAGGTCAGGGAGATGG + Intergenic
1123473133 15:20569401-20569423 GCTAGGCAAGGTGAAGGAGACGG + Intergenic
1123535369 15:21178246-21178268 GGCAGAAAAGGTCAGGGAGATGG + Intergenic
1123644873 15:22430952-22430974 GCTAGGCAAGGTGAAGGAGACGG - Intergenic
1123733434 15:23164412-23164434 GCTAGGCAAGGTGAAGGAGACGG + Intergenic
1123751563 15:23361783-23361805 GCTAGGCAAGGTGAAGGAGACGG + Exonic
1124283936 15:28385708-28385730 GCTAGGCAAGGTGAAGGAGACGG + Exonic
1124298762 15:28525906-28525928 GCTAGGCAAGGTGAAGGAGACGG - Exonic
1124345362 15:28918460-28918482 GGTGGGAGAGGTGAAGCAGATGG + Intronic
1124482517 15:30090271-30090293 GCTTGGCGAGGTGAAGGAGACGG + Exonic
1124488974 15:30142373-30142395 GCTTGGCGAGGTGAAGGAGACGG + Exonic
1124521057 15:30406938-30406960 GCTTGGCGAGGTGAAGGAGACGG - Exonic
1124537605 15:30559282-30559304 GCTTGGCGAGGTGAAGGAGACGG + Exonic
1124544060 15:30611337-30611359 GCTTGGCGAGGTGAAGGAGACGG + Exonic
1124754556 15:32395950-32395972 GCTTGGCGAGGTGAAGGAGACGG - Exonic
1124761051 15:32448305-32448327 GCTTGGCGAGGTGAAGGAGACGG - Exonic
1124777583 15:32600758-32600780 GCTTGGCGAGGTGAAGGAGACGG + Exonic
1124833050 15:33167919-33167941 GGCAGAAGAAGTGAAGGAGAAGG + Intronic
1125144731 15:36453631-36453653 GGTTGCAGAGGTGCAGGAGATGG - Intergenic
1126362804 15:47863603-47863625 GGAAGAAGAGGAGAAGGAGAAGG + Intergenic
1126850646 15:52794991-52795013 GGCTGGAGAGGACAAGGGGAAGG + Intergenic
1127504209 15:59582397-59582419 GGTAGGAGGGGGTAAGGAGGTGG - Intergenic
1127770569 15:62226922-62226944 AGGAGGAGAGGTCAAGGTGGGGG - Intergenic
1128332712 15:66766257-66766279 CGTGGGAGATGTCAGGGAGAGGG + Intronic
1128824138 15:70694839-70694861 TGTGGGAGAGGTCAAGTATAGGG - Intronic
1129038081 15:72663096-72663118 GCTAGACGAGGTGAAGGAGATGG + Exonic
1129211809 15:74074135-74074157 GCTAGACGAGGTGAAGGAGATGG - Exonic
1129398594 15:75266949-75266971 GCTAGACGAGGTGAAGGAGATGG + Exonic
1129402202 15:75291225-75291247 GCTAGACGAGGTGAAGGAGATGG + Exonic
1129450681 15:75649522-75649544 GGTAGGAGAGGTTGAGGGGAGGG - Exonic
1129674647 15:77625889-77625911 GGGCGGAGAGTTCAGGGAGAGGG + Intronic
1129728932 15:77918407-77918429 GCTAGACGAGGTGAAGGAGATGG - Intergenic
1129839579 15:78735454-78735476 GCCAGGCGAGGTGAAGGAGATGG + Intergenic
1130017572 15:80199695-80199717 GGTAGGAGAGGGGTATGAGAGGG + Intergenic
1130226101 15:82059168-82059190 AGGAGGAGAGGAAAAGGAGAAGG - Intergenic
1131016838 15:89064931-89064953 GGGATGAGAGGGCAATGAGATGG - Intergenic
1131535288 15:93232324-93232346 GGGGAAAGAGGTCAAGGAGATGG - Intergenic
1132240629 15:100254845-100254867 GGGAGGCGGGGTGAAGGAGAGGG + Intronic
1132294951 15:100727925-100727947 GGCAGGGGAGGTCAAGGGGATGG + Intergenic
1133485526 16:6215084-6215106 AGAAGGAGAGGAGAAGGAGAGGG + Intronic
1133569605 16:7027838-7027860 GGTGGGAGAGAGAAAGGAGAGGG + Intronic
1133588307 16:7217061-7217083 GGGAGGAGAGGGAAAGGAGAGGG - Intronic
1133710580 16:8397551-8397573 CATGGGAGAGGACAAGGAGATGG - Intergenic
1133891327 16:9882170-9882192 GGAAAGAGATGGCAAGGAGAGGG + Intronic
1134125105 16:11610987-11611009 GGGAGGAAAAGTCAAGGAGAAGG + Intronic
1135149797 16:19995384-19995406 GTCAGAAGAGGGCAAGGAGATGG - Intergenic
1135193418 16:20374289-20374311 CTTATGAGAGGTGAAGGAGAGGG + Intronic
1135277906 16:21129145-21129167 GGTAGGAGAGGAGATGGGGAGGG - Intronic
1135304539 16:21356704-21356726 GGAAGAAGAGGTGAGGGAGAGGG + Intergenic
1135514018 16:23114196-23114218 GGTAGGAGAGATGGAAGAGAAGG + Intronic
1135522662 16:23189337-23189359 GGGAGGAAAAGTCAGGGAGAGGG - Intronic
1135848228 16:25938689-25938711 GGCAGGAGAGTTCAAGGCCAAGG - Intronic
1136004087 16:27316422-27316444 GGTGGAAGAGGGCAGGGAGATGG - Intronic
1136081334 16:27854300-27854322 GGAGGGAGAGGAAAAGGAGAAGG + Intronic
1136301279 16:29335834-29335856 GGAAGAAGAGGTGAGGGAGAGGG + Intergenic
1136781504 16:32905332-32905354 GGCAGCACAGGTGAAGGAGAGGG - Intergenic
1136891875 16:33976736-33976758 GGGAGGGGAGGGCAGGGAGAGGG - Intergenic
1137016067 16:35376675-35376697 GGGAGCAGAGGTTAAGGAGTAGG + Intergenic
1137473102 16:48780114-48780136 GGTGTGAGAGGTTAAGGAGGAGG - Intergenic
1138511826 16:57513151-57513173 GGTTAGAGAGGTGAAGGAGCTGG + Intronic
1138768868 16:59637829-59637851 GGAAGGAGAAGGAAAGGAGATGG + Intergenic
1139459747 16:67112108-67112130 GGTAGAAGCTGTCAAGGAGAGGG - Intronic
1139546789 16:67653324-67653346 GGTGGTAGCGGTCAAGGAGAGGG + Intronic
1139970236 16:70769813-70769835 GGTCGGGGAGGTCTAGGAGAAGG - Intronic
1140028499 16:71313762-71313784 GCTTGGAGAGTTCAAGGTGAAGG - Intergenic
1140834380 16:78779824-78779846 GGAAGGAAAGGGGAAGGAGAAGG + Intronic
1141263075 16:82471346-82471368 GGGAGAAGAGGGAAAGGAGAAGG - Intergenic
1142174236 16:88637784-88637806 GGTGGGAGAGGTCCCGGAGATGG - Intergenic
1143685647 17:8513555-8513577 GGAAGGAGAGCTGGAGGAGATGG - Exonic
1143813408 17:9491080-9491102 GGTACCAGAGCTCAGGGAGAGGG - Intronic
1144334190 17:14254711-14254733 GGCAGGAGAGATAAAGGAGGAGG - Intergenic
1144644455 17:16962731-16962753 TCTAGGAGAGAGCAAGGAGAAGG + Intronic
1145781603 17:27567447-27567469 GGTAGGAGTGGGCAAGAACATGG + Intronic
1145868708 17:28256670-28256692 GGCTGGAGAGGGCAAGAAGAGGG + Intergenic
1145911540 17:28546237-28546259 GGCAGCTGAGGGCAAGGAGATGG + Intronic
1146246564 17:31289138-31289160 GGTTTGAGAGGGCAAGAAGAGGG + Intronic
1146283049 17:31557822-31557844 GGTAGGACATGTCCAGGAGCTGG - Intergenic
1146442326 17:32907947-32907969 GGTAGGTGACATGAAGGAGAAGG + Intergenic
1147130386 17:38404501-38404523 GGTAGGAGAGGGAAAGGGAACGG - Exonic
1147568221 17:41550621-41550643 GGGAGGACAGGTCAGGGTGAGGG + Intergenic
1148512528 17:48184701-48184723 GGTAGGACGCATCAAGGAGATGG - Exonic
1148818783 17:50348322-50348344 GGCAGGAGAGTTCAGGCAGAAGG + Intronic
1148958643 17:51374651-51374673 GGAAAGAGAGGCCTAGGAGATGG - Intergenic
1149683795 17:58523393-58523415 GGAAGGAGAGGGAAAGGAAAAGG + Intronic
1151409269 17:73910512-73910534 GGTGGGAGAGGGCAGAGAGATGG + Intergenic
1151675457 17:75595151-75595173 GGATGGAGAGGTAAAGGAGTGGG + Intergenic
1152037001 17:77879731-77879753 GGAAGGAGAGGTGATGGAGGTGG - Intergenic
1152314522 17:79572473-79572495 GGTGGGAGGGGTCTGGGAGAAGG - Intergenic
1152368195 17:79869522-79869544 GGTGGGAGAGGTTAAGTAGCAGG + Intergenic
1152736606 17:82000332-82000354 GGCAGGAGGGGTCCAGGGGAGGG + Intronic
1153259536 18:3209799-3209821 GGTAAGAGAGATCAGGGACATGG - Intronic
1153503654 18:5773169-5773191 GGTAGGAGAGGGCAGGGACGGGG + Intergenic
1153552751 18:6279331-6279353 GGAAAGAGAGGGGAAGGAGAAGG + Intronic
1153857159 18:9161182-9161204 GGTATTGGAGGTCATGGAGAAGG - Intronic
1155339512 18:24799605-24799627 GGTAGGGGAGGCCAAGGTAAAGG - Intergenic
1155789373 18:29946229-29946251 GGTGGGAGATGTCAAAGGGAAGG + Intergenic
1155815374 18:30301401-30301423 AGTAAGAGAGGACAAGCAGATGG - Intergenic
1155927564 18:31673241-31673263 GTTAGGAAGGGTCAAGCAGATGG + Intronic
1156516229 18:37682927-37682949 GGTAAAAGAGGTCACGGGGAGGG + Intergenic
1156681749 18:39598323-39598345 GGCAGAAGAGGTGAAGGAGGTGG - Intergenic
1156794676 18:41029611-41029633 GATAGGAGATGGCAAGTAGAAGG - Intergenic
1157047706 18:44122763-44122785 GGTGGAAGAGGTCAAGGCAAGGG - Intergenic
1157504559 18:48217489-48217511 GGAAGGAGAGGAGAAGGAGGGGG - Intronic
1157739651 18:50081136-50081158 CTTAGGAGAGGTGAAGGAGGAGG - Intronic
1158491752 18:57916402-57916424 GGAAGGACAGGTCGAGGAAATGG + Intergenic
1158842408 18:61402109-61402131 GGTCTGAGAAGTCAAGGTGAGGG - Intronic
1158963474 18:62604831-62604853 GGGAGGAGAAGGGAAGGAGAAGG + Intergenic
1159001060 18:62975480-62975502 ATTAGCAGAGGTCAAGGTGAAGG - Exonic
1159481310 18:68994494-68994516 GGCAGGAGGGGTCAGGGAGAGGG - Intronic
1159624703 18:70679073-70679095 GGGAGGGGAGGGCAAGGAGAGGG - Intergenic
1159831070 18:73278866-73278888 GGAAGGAGGGGTGAGGGAGAAGG + Intergenic
1160017442 18:75155408-75155430 GGTTTGAGAGGTGAAGGAGGAGG + Intergenic
1160231768 18:77054294-77054316 AGTGGGAGATGTCAACGAGAAGG + Intronic
1160335215 18:78032803-78032825 GGGAGGAGAAGAGAAGGAGAAGG - Intergenic
1160402233 18:78619488-78619510 GGGAGGAAAGGGGAAGGAGAGGG + Intergenic
1161093885 19:2377585-2377607 GGTAGGGGAGGGGGAGGAGAGGG - Intergenic
1161698572 19:5783463-5783485 GGTGGCCGAGGTCAAGGAGGGGG - Exonic
1161965096 19:7543330-7543352 GGCAGGAGAGATCTAGGAGTTGG - Intronic
1163321732 19:16578536-16578558 GGTAGGAGACGACATGGAGTGGG - Intronic
1163588243 19:18175565-18175587 GGCAGGAGAGGGCATGAAGAGGG - Intronic
1163866416 19:19776875-19776897 GGTAGGAGAGGTTAAAGAACAGG - Intergenic
1163895115 19:20051928-20051950 GGTAGGAGAGGTTAAAGAACAGG + Intergenic
1163928943 19:20370295-20370317 GCTGGGTGAGGTTAAGGAGATGG - Intergenic
1164249704 19:23466161-23466183 AGGAGGAGAGGAGAAGGAGAAGG - Intergenic
1164324580 19:24180389-24180411 AGTAGGAGAGGAGAAGGAGGAGG + Intergenic
1164481245 19:28612505-28612527 TGTAGGAGTGGTCAAGATGATGG - Intergenic
1164817643 19:31217331-31217353 AGCAGATGAGGTCAAGGAGATGG + Intergenic
1164892520 19:31836971-31836993 GGCAGGGGTGCTCAAGGAGAAGG - Intergenic
1165368790 19:35388985-35389007 GGTGGCAGAGGTCTAGGAGATGG - Intergenic
1165454194 19:35901209-35901231 GGTAGGAGTGGGGATGGAGATGG + Intronic
1165758699 19:38308531-38308553 GGTAGTAGAGGCCAAGAGGAAGG + Intronic
1165896540 19:39145044-39145066 GGAAGGGCAGGTGAAGGAGAGGG - Intronic
1165944828 19:39435806-39435828 GGAAGGGGAGGGGAAGGAGAAGG - Intronic
1166253178 19:41585290-41585312 GGTAGGAGGGGCCCAGGTGAGGG - Intronic
1166290416 19:41860087-41860109 GGGTGGAGAGGTAAAGGGGAGGG - Exonic
1166309064 19:41952166-41952188 GGGAGGAGAGGGGAAGGGGAGGG - Intergenic
1166556730 19:43705134-43705156 GGGAGGGGAGGGAAAGGAGAAGG - Intergenic
1166718945 19:44986632-44986654 GCCAGGAGAAGACAAGGAGATGG - Intronic
1166834368 19:45658231-45658253 GGGAGGAGAGGGGAAGGAAAGGG - Intergenic
1166902144 19:46072835-46072857 TGTAAGAGAGATAAAGGAGATGG + Intronic
1167191198 19:47991435-47991457 AGGAGGAGAGGAGAAGGAGAAGG - Intronic
1167600982 19:50454729-50454751 GCTCTGGGAGGTCAAGGAGAAGG - Intronic
1167664461 19:50815838-50815860 AGAAGCAGAGGTCAGGGAGAAGG - Intergenic
1167665706 19:50821908-50821930 GGCAGGAGAGGCCAGGGACAAGG + Intronic
1167974277 19:53211202-53211224 GGAAGAAGAGATCAAGGTGATGG + Intergenic
1202697508 1_KI270712v1_random:135778-135800 AGAAGGAGAGGAGAAGGAGAAGG - Intergenic
925845969 2:8033782-8033804 GAAAGGAGAGGAAAAGGAGAGGG + Intergenic
926025316 2:9537900-9537922 GGGAGGAGAGGGGGAGGAGAGGG + Intronic
926025325 2:9537921-9537943 GGGAGGAGAGGGGGAGGAGAGGG + Intronic
926025331 2:9537932-9537954 GGGAGGAGAGGGGAAGGGGAGGG + Intronic
926054549 2:9766777-9766799 GGCAGAAGAGGTAGAGGAGATGG - Intergenic
926312539 2:11685110-11685132 GGTTGGGGAGGTCACAGAGAAGG + Intronic
926747604 2:16171796-16171818 GTTGGGAGAGGACAAGAAGAGGG + Intergenic
926784845 2:16508824-16508846 GCTAGCAGAGGACAAGGAGCAGG - Intergenic
927699972 2:25261789-25261811 GCTAGGAGAGGACCAGGATAGGG - Intronic
928347328 2:30512451-30512473 GTTGGGTGAGGTCAAGGGGAAGG + Intronic
928696197 2:33852555-33852577 AGCAGGAGAGGTCAAGGGAAGGG + Intergenic
929054109 2:37861496-37861518 GGTAGGAGAGTTCTAGCAGATGG - Intergenic
929288896 2:40166518-40166540 GTTAGCAGAGGCAAAGGAGAGGG + Intronic
929685400 2:44029649-44029671 GGATCAAGAGGTCAAGGAGATGG + Intergenic
931835424 2:66093963-66093985 GGGAGGAGCGGTCAAGGATGGGG + Intergenic
932278750 2:70471650-70471672 GGTAGGGGAGGGCAGGGACAGGG + Intronic
932403123 2:71495847-71495869 GGGAGGAGAGGTGGAAGAGAAGG + Intronic
932470526 2:71952221-71952243 GCTGAGATAGGTCAAGGAGAAGG + Intergenic
932506038 2:72233227-72233249 GGCAGGAGAGGCCAAGGTGGTGG + Intronic
934278681 2:91592802-91592824 AGAAGGAGAGGAGAAGGAGAAGG - Intergenic
934475543 2:94591110-94591132 GATGAGAGAGCTCAAGGAGAGGG - Intronic
934615359 2:95767395-95767417 AGTAGGAGAGGAGAGGGAGAGGG - Intergenic
934995974 2:98960804-98960826 GGTAGGAGAGGTCACAGGAAAGG - Intergenic
935083013 2:99817086-99817108 AGTAGGAGAGATGAAGGACATGG + Intronic
935155692 2:100481948-100481970 GTCTGGAGACGTCAAGGAGATGG - Intronic
935803693 2:106726209-106726231 GGGAGGAGTGGGGAAGGAGAGGG - Intergenic
936645559 2:114365707-114365729 GGGGGTGGAGGTCAAGGAGAGGG + Intergenic
936714955 2:115175491-115175513 GGTAGGAAAGGGCAAGGGAAGGG - Intronic
937091478 2:119209283-119209305 GGGAGGAGAGCTCAGGGAGCAGG - Intergenic
937274137 2:120673337-120673359 GGGAGGAGGACTCAAGGAGAGGG + Intergenic
938815423 2:134899003-134899025 GGAAGGAGTGGCAAAGGAGAGGG - Intronic
938863822 2:135397854-135397876 GGGAGGAGAGGTAAGGGAAAGGG - Intronic
939017722 2:136920928-136920950 GGAGGGAGAGGCCAAGGAGTGGG + Intronic
939776376 2:146392604-146392626 GGTTGGAGAGTTCATGGAAATGG - Intergenic
939783802 2:146483053-146483075 GATATGAGAGGCAAAGGAGATGG - Intergenic
939799996 2:146696905-146696927 GGAAGGGGAGGGGAAGGAGAGGG + Intergenic
939800001 2:146696916-146696938 GGAAGGAGAGGGGAAGGGGAAGG + Intergenic
941956667 2:171212289-171212311 GGTGGGGGAGGTGAAGGAGGGGG - Intronic
942229238 2:173844423-173844445 GGTAGGACAGGGCAAGGGGCTGG - Intergenic
942657189 2:178226157-178226179 GGTAGGGGTGGGCAAGGAGATGG + Intronic
943604525 2:189961268-189961290 GGGTGGAGAGGGCCAGGAGAAGG + Intronic
944157483 2:196622513-196622535 GGAAGCAGAGGTCAGGGAGATGG - Intergenic
944251915 2:197587186-197587208 AGTAGCAGAGGTCAAGTTGAAGG - Intronic
944317708 2:198301037-198301059 AATAGGACAGGACAAGGAGATGG - Intronic
945027590 2:205633785-205633807 GCAAGGAGAGGTAAGGGAGAAGG - Intergenic
945961002 2:216134928-216134950 GGTAAGTGAGGTCAAGGACTTGG + Intronic
946074784 2:217064821-217064843 GCCAGGAGAGGTGAAGGAGAGGG - Intergenic
946122816 2:217531173-217531195 GCTCTGAGAGGTCCAGGAGATGG - Intronic
946268606 2:218569815-218569837 GGAAGGAGAGTTCAAGGAAGAGG - Intronic
946750738 2:222893737-222893759 GGAAGGAGAGGGAAAGGAGGCGG - Intronic
947159076 2:227193841-227193863 AGAAGGAGAGGAGAAGGAGAAGG + Intronic
947159093 2:227193908-227193930 AGAAGGAGAGGAGAAGGAGAAGG + Intronic
947159123 2:227194046-227194068 AGAAGGAGAGGAGAAGGAGAAGG + Intronic
947372822 2:229465939-229465961 GCTATAAGAGGACAAGGAGAAGG - Intronic
947934517 2:233992558-233992580 GGAAGGAGAGGCCATGCAGAGGG - Intronic
947940851 2:234053900-234053922 GGAAAGAGAGGGAAAGGAGATGG + Intronic
948105622 2:235411533-235411555 AGAAGGAGAGGAAAAGGAGAAGG + Intergenic
948571802 2:238922436-238922458 GGAAGGGGAGGTGAAGGACATGG + Intergenic
948803626 2:240443751-240443773 GGTGGGAGAGGACCAGGGGAGGG - Intronic
948871930 2:240805060-240805082 GGAGGGAGAGGGCAGGGAGAGGG + Intronic
1168807373 20:679940-679962 GGTTGGAGAAAGCAAGGAGAGGG + Intergenic
1168891422 20:1297310-1297332 GGTGGGAGAGGTAAGGGAGCAGG + Intronic
1169442497 20:5644355-5644377 GGTTGGATAGGGCAAGGAGATGG - Intergenic
1169717359 20:8635276-8635298 GGAAGGAAAGGGGAAGGAGAAGG + Intronic
1169855877 20:10102260-10102282 GGTAGAAGAGGTGGAGGAGGTGG - Intergenic
1170922543 20:20692413-20692435 GGTGGGTGAGGTGAAGGAGCTGG - Intronic
1172013910 20:31861884-31861906 GGGAAGAGGGGTCAGGGAGAGGG - Intronic
1172189930 20:33055821-33055843 GGTTGAAGAGGTCGAGGGGAGGG + Intronic
1172313067 20:33932961-33932983 GGTAGGAGGGGTCAAGGCTGGGG - Intergenic
1172423932 20:34842271-34842293 GGAAGGGGAGGGGAAGGAGAGGG + Intergenic
1172423937 20:34842293-34842315 GGAAGGAGAGAGCAAGGAGAGGG + Intergenic
1172623512 20:36334607-36334629 GGCTGGGGAGGTCAAGGCGAGGG + Intronic
1172754574 20:37274090-37274112 GGGAGGGGAGGGAAAGGAGAAGG + Intergenic
1174050456 20:47763954-47763976 GGTCGGAGAGGTGATGGAGCAGG - Intronic
1174334915 20:49853129-49853151 GGTAGGAGAGGCACAGGACAGGG + Intronic
1175232398 20:57482111-57482133 GGGAGGAGAGGGGGAGGAGAGGG + Intergenic
1175232403 20:57482122-57482144 GGGAGGAGAGGGGGAGGAGAGGG + Intergenic
1175232408 20:57482133-57482155 GGGAGGAGAGGGGGAGGAGAGGG + Intergenic
1175232413 20:57482144-57482166 GGGAGGAGAGGGGGAGGAGAGGG + Intergenic
1175232418 20:57482155-57482177 GGGAGGAGAGGGGGAGGAGAGGG + Intergenic
1175232423 20:57482166-57482188 GGGAGGAGAGGGGGAGGAGAGGG + Intergenic
1175514901 20:59563162-59563184 AGGAGGAGAGATGAAGGAGAAGG + Intergenic
1175854884 20:62115303-62115325 GGAAGGAGACGCCAAGGAGCTGG - Intergenic
1175873118 20:62217606-62217628 GGTAGGACAGCTCGAGGAGGAGG + Intronic
1176386387 21:6140302-6140324 GGGAGGAGGGGTCAGGGAGGAGG + Intergenic
1176689960 21:9894084-9894106 GGCAGGAAAAGGCAAGGAGAAGG + Intergenic
1179737086 21:43397950-43397972 GGGAGGAGGGGTCAGGGAGGAGG - Intergenic
1180118268 21:45726191-45726213 GGTAGGAGGGGTTAAGGATTTGG + Intronic
1180203914 21:46245137-46245159 GGCAGCAGAGGTCAAGGGAATGG + Exonic
1180487605 22:15816962-15816984 GGGAGGAGGGGACAAGGAGAGGG - Intergenic
1181114446 22:20622345-20622367 GGTATGAGAGGCAAAGGAGATGG - Intergenic
1182048948 22:27298759-27298781 GTGAGGAGAGATGAAGGAGAGGG + Intergenic
1182437896 22:30342278-30342300 GGAAGAAGAGGAGAAGGAGAAGG - Exonic
1182462309 22:30491505-30491527 GGAAAGAGAGGGCAAGCAGAGGG + Intronic
1182593612 22:31400722-31400744 GGTGGTGGAGGTCCAGGAGAAGG + Exonic
1183675397 22:39296464-39296486 GTAATGAGAGGCCAAGGAGAAGG - Intergenic
1183714301 22:39524714-39524736 AGGAGGTGAGGTCAGGGAGAAGG - Intergenic
1183736271 22:39646535-39646557 GGGAGGAGAGGACAGGGACAGGG - Intronic
1184107115 22:42374342-42374364 AGCAGGAGAGGGCAAGGAAACGG - Intergenic
1184435620 22:44473342-44473364 GGTAGCAGAGTTCAAAGGGAGGG + Intergenic
950430410 3:12947663-12947685 GGTGGGACAGGCCAAGGACAGGG + Intronic
950882088 3:16330073-16330095 GGTAGGAGATGTCAGCCAGAGGG + Intronic
951467408 3:23017165-23017187 AATAGGAGAGGTCAAGGAATAGG - Intergenic
951604059 3:24412022-24412044 GATAGGATAGGTGCAGGAGAGGG + Intronic
952937785 3:38413646-38413668 GGGAGGAGAGATGAAGGAGGGGG - Exonic
953480652 3:43248840-43248862 GATAGGAAAGGAGAAGGAGAGGG + Intergenic
953938564 3:47069339-47069361 GGAAGGAGAGGTTAAGGGGATGG - Intronic
954171426 3:48805973-48805995 TGTAGGATAGGTCTGGGAGATGG - Intronic
954299461 3:49691723-49691745 GGGAGCAGAGGTCAGGGAGCGGG + Intronic
954745401 3:52784911-52784933 GGTCCGAGAGGTCAAGTAGCTGG - Intronic
956463457 3:69494972-69494994 GGAAGGAGAGGGGAAGGAAAGGG + Intronic
957128153 3:76188881-76188903 TGTTGGAGAAGTCAAGGAAAAGG + Intronic
957532767 3:81461341-81461363 GGTAGGAGAGTTGAAGGAAAAGG + Intergenic
960533653 3:118793254-118793276 GGTAGAAAAGGGAAAGGAGATGG - Intergenic
961356914 3:126345109-126345131 GGTAGGAGAGAGCAAGGAGGGGG - Intronic
962717667 3:138141022-138141044 AGTAGGAGAGGAAGAGGAGAAGG + Intergenic
963747726 3:149142198-149142220 GCTAGGAGAAGCCATGGAGAAGG + Intronic
964647234 3:158971167-158971189 GGGAGGAGAGGAAAAGGAAATGG - Intronic
964888306 3:161509828-161509850 CAAAGGAGAGGTCAGGGAGAAGG - Intergenic
965436201 3:168654989-168655011 GGCATGAGAGGTCGGGGAGAAGG + Intergenic
965611411 3:170547677-170547699 GGTGGAAGAGGTGAAGGAGGTGG + Intronic
966855853 3:184193462-184193484 GGGAGGAGTGGTCAGGGTGAAGG - Intronic
966956056 3:184880324-184880346 GGTATCAGAGGTTAAGGAGGGGG - Intronic
967294033 3:187948360-187948382 GTTAGGAGAGGGCAGGGCGAGGG - Intergenic
967313707 3:188130766-188130788 GGTAGCAGAGGTGAAAGAGGTGG + Intergenic
967848633 3:194064831-194064853 GGCAGGAGAGGGCAAGGAAGTGG - Intergenic
968359900 3:198139582-198139604 GGAGGGAGAGGACAAGGAGGAGG + Intergenic
968974472 4:3814026-3814048 GGTTTGAGAGGTGAAGGAGAAGG - Intergenic
969245198 4:5927414-5927436 GATAGGAGTCGTCAAGCAGAGGG - Intronic
969561496 4:7950927-7950949 GGGAGCAGAGGACAAGGGGAAGG + Intergenic
970949088 4:21731393-21731415 GGAAGGAGAGGTGGAGGAGGAGG + Intronic
971219668 4:24693295-24693317 GGTAGCAGGGGTAGAGGAGAGGG + Intergenic
971415714 4:26426841-26426863 GGGAGGAGAGGTCAAGTGGCAGG + Intronic
971518075 4:27513526-27513548 GTTAGGAAAGGCCAAAGAGACGG - Intergenic
971769839 4:30882141-30882163 GGAAGGAGAGGAAAAGGAGGGGG - Intronic
972181084 4:36466587-36466609 GATGCGAGAGGTGAAGGAGAAGG - Intergenic
972201791 4:36721499-36721521 TGGAGGAGAGTTCAAGGAAATGG - Intergenic
972243730 4:37222842-37222864 AGGAGGAAAGGGCAAGGAGAAGG - Intergenic
972969817 4:44559515-44559537 GGGAAGAGAGGCAAAGGAGAGGG + Intergenic
973134560 4:46689920-46689942 AGTAGGAGCGATCATGGAGAAGG + Intergenic
973908067 4:55550610-55550632 GGTAGGAGGGGTCCAGGCAAGGG - Intergenic
974366718 4:60959565-60959587 GGTACTAAAGGGCAAGGAGAAGG + Intergenic
975816074 4:78217923-78217945 GGGAGGAGAGGGGAAGGGGAGGG - Intronic
976130523 4:81879246-81879268 GTTAGGGGTAGTCAAGGAGAAGG + Intronic
976885056 4:89971613-89971635 AGGAGGAGAGGAAAAGGAGAAGG - Intergenic
977878586 4:102178246-102178268 GGGATATGAGGTCAAGGAGAGGG - Intergenic
979029310 4:115620303-115620325 CGTAGGAGAGGTATAGGACAAGG - Intergenic
980271957 4:130595507-130595529 GGAAGGAGAGGTCAACCCGAAGG - Intergenic
980797091 4:137698882-137698904 GGTAGAGGAGGAGAAGGAGAAGG + Intergenic
980975554 4:139606914-139606936 GGCTGCAGGGGTCAAGGAGATGG + Intergenic
981310712 4:143295388-143295410 AGTAGTAGAGGTACAGGAGAGGG - Intergenic
981472558 4:145153117-145153139 GGTCTGGGAGGTTAAGGAGATGG - Intronic
981537358 4:145813896-145813918 GTTAGGAGAGATCTAGGAGGAGG + Intronic
981571720 4:146158739-146158761 GGTGGAAGAGGTGGAGGAGATGG - Intergenic
981583233 4:146271833-146271855 GGAAGGAGATTCCAAGGAGAAGG - Intronic
981835428 4:149047860-149047882 GGAAGGAGAAGTGAAGTAGAAGG - Intergenic
984375701 4:178926040-178926062 CGTGGGTGAGGTCAAGGGGATGG + Intergenic
984424874 4:179570679-179570701 GGTAGGGGAGGTGAAAGTGAAGG + Intergenic
985006896 4:185543163-185543185 GGTGGGAAAGCTCACGGAGAAGG - Intergenic
985089709 4:186350613-186350635 GGTAGGAGAGGGGCTGGAGAGGG - Intergenic
986032628 5:3908591-3908613 GGAAGGAGAGGCCAAGGAGGGGG - Intergenic
986996260 5:13610990-13611012 GGGAGGGTAGGTCAAGGAGAAGG - Intergenic
987038076 5:14037579-14037601 GATAGGAGAGGCCAAGCAGGAGG + Intergenic
987425148 5:17764571-17764593 GGTGGGAGAGATCAAAGAGAGGG + Intergenic
989197694 5:38731771-38731793 GGTTGATGAGGGCAAGGAGAGGG + Intergenic
989710160 5:44388500-44388522 GGAAGGAGAGGAGAAGGAGGAGG + Exonic
990093027 5:52078924-52078946 GGTAGGTAAGGTCAAGGTGAAGG - Exonic
991776011 5:70086637-70086659 AGGAGGAGAGATTAAGGAGATGG + Intergenic
991855299 5:70962091-70962113 AGGAGGAGAGATTAAGGAGATGG + Intergenic
991869305 5:71094869-71094891 AGGAGGAGAGATTAAGGAGATGG + Intergenic
992291216 5:75282037-75282059 GGAAGGAGAAGCCAAGAAGAAGG + Intergenic
992353856 5:75958842-75958864 GGTTGAAAAGGTCAAGGAGAGGG - Intergenic
992888784 5:81185138-81185160 GGTAGGAGAGGTCAAGGAGAGGG + Intronic
993076895 5:83243496-83243518 GTTAAGCGAGGTCAAGGAGGTGG - Intronic
993938996 5:94035858-94035880 GGGAGGAGGGGGTAAGGAGAGGG + Intronic
994703410 5:103166920-103166942 GGTGGAAGAGGTGAAGGAGGTGG + Intronic
995258601 5:110075364-110075386 GGCAGCAGAGTTCAAGGAGTGGG + Intergenic
996220273 5:120923901-120923923 TGGAGGAGTGGTCATGGAGATGG - Intergenic
996279578 5:121712234-121712256 TGAAGGAGAGGTCACAGAGAAGG + Intergenic
997154607 5:131540599-131540621 GGAAGGAGAAATCAAGGAGAAGG + Intronic
1000008312 5:157208337-157208359 GGTTGGGGAGGACATGGAGAAGG + Intronic
1000193559 5:158936957-158936979 GTTAGGGGAGATCAAAGAGAGGG + Intronic
1000724512 5:164752744-164752766 GGGGGGAGGGTTCAAGGAGATGG + Intergenic
1001031882 5:168269197-168269219 GGAGGGAGAGGCGAAGGAGAAGG - Intergenic
1001314658 5:170633645-170633667 GAGAGGAGAGGTCAGAGAGATGG + Intronic
1001634134 5:173197579-173197601 GGAAGGAGAGGAGGAGGAGAGGG + Intergenic
1001661334 5:173395774-173395796 TGTCAGAGAGGACAAGGAGAGGG - Intergenic
1001674750 5:173502555-173502577 GCTAGGGGAGGGCAAGGAGGCGG + Intergenic
1001690806 5:173631305-173631327 GGTAGGAGATGAGGAGGAGAAGG - Intergenic
1001690823 5:173631355-173631377 GGTAGGAGATGAGGAGGAGAAGG - Intergenic
1001690839 5:173631405-173631427 GGTAGGAGATGAGGAGGAGAAGG - Intergenic
1001691783 5:173638768-173638790 GGAAGGAGAGAGGAAGGAGAGGG - Intergenic
1001939123 5:175728665-175728687 GGCAGGAAAGGGCAGGGAGAGGG - Intergenic
1002109845 5:176901096-176901118 GGTGGGAGAGGCCAAAGGGAGGG - Intergenic
1002302124 5:178263186-178263208 GGTAAGAGAGGGCATGGAGTTGG - Exonic
1002874145 6:1196457-1196479 AGTAGGTGCCGTCAAGGAGAGGG + Intergenic
1003232515 6:4267497-4267519 GGTAGAAGAGGTGGAGGAGGTGG + Intergenic
1003492914 6:6639633-6639655 GGTAGGAGATCAGAAGGAGAAGG - Intronic
1004318133 6:14609644-14609666 GGAAAGAGAGGTAAAGCAGATGG + Intergenic
1004617410 6:17303615-17303637 GGAAGGAGAAGGGAAGGAGAAGG + Intergenic
1006474073 6:34244091-34244113 GGTAGGAGAGGGCCAGGAGCTGG - Intronic
1006567612 6:34973848-34973870 GGAAGGGGAGGGCAAGGGGAAGG - Intronic
1007742855 6:44023300-44023322 AGCAGGAGAGGACAAGGACAGGG + Intergenic
1007953018 6:45889164-45889186 GGTAGGAAAGTCCAAGGTGAAGG + Intergenic
1008008062 6:46433538-46433560 GGAAGCAGAAGTCAAAGAGATGG + Intronic
1008625763 6:53315010-53315032 GGTTGGAGAAGAAAAGGAGAGGG + Intronic
1009056773 6:58345856-58345878 GGCAGGAGAGGTGGAGGAGGTGG - Intergenic
1009195689 6:60681680-60681702 GGCAGATGAGGTCATGGAGAGGG - Intergenic
1009234468 6:61105716-61105738 GGCAGGAGAGGTGGAGGAGGTGG + Intergenic
1010188566 6:73170399-73170421 GGTGGGAAAGGTCATGGAAAAGG - Intronic
1011356847 6:86480079-86480101 GCTAGGTGAGGTTAAGGAGATGG - Intergenic
1012020693 6:93915363-93915385 GATAGGAGAGGTGACAGAGAGGG - Intergenic
1012032783 6:94093813-94093835 GGCAGAAGAGGTTTAGGAGATGG - Intergenic
1012930356 6:105309949-105309971 GGTAGGAGAGGGGAAGAAAATGG - Intronic
1012956525 6:105576656-105576678 GCAAGGAGAGGAGAAGGAGATGG - Intergenic
1013581094 6:111535419-111535441 GGAAGTAGTGGTCAAGGTGATGG + Intergenic
1014657559 6:124127352-124127374 GGAAAGAGAGGTCATAGAGAAGG + Intronic
1015144054 6:129966134-129966156 GGTAGAAGAGGTAAGGGACAGGG + Intergenic
1016261417 6:142174716-142174738 GGGAGGAGTGGTCATGGGGATGG + Intronic
1016604057 6:145898768-145898790 GGCAGGGAAGTTCAAGGAGATGG - Intronic
1016773674 6:147880518-147880540 AATAGAAAAGGTCAAGGAGAGGG + Intergenic
1016811415 6:148264781-148264803 GTTAGGAGAGGTGATGGAGCAGG - Intergenic
1017219360 6:151948591-151948613 GGCAGGAAAGGGGAAGGAGAAGG - Intronic
1017293258 6:152765639-152765661 GGAAGGAGAGGGGAAGGAGAGGG - Intergenic
1018146739 6:160898673-160898695 GGGAGGAGAGGAGAAGGAGGAGG - Intergenic
1018839497 6:167508031-167508053 GGGAGGAGAGGGGAAGGGGACGG - Intergenic
1018839694 6:167508525-167508547 GGGAGGAGATGGGAAGGAGAGGG - Intergenic
1018839897 6:167509155-167509177 GGGAGGAGAGGCAATGGAGAGGG - Intergenic
1019260088 7:77067-77089 GGAGGGAGAGGACAAGGAGGAGG - Intergenic
1019542367 7:1557307-1557329 GGTAGGAGATATGAAGGACAAGG - Intronic
1019817998 7:3215479-3215501 GTTGGGAGAGGTCAAGAAAAGGG - Intergenic
1020378450 7:7514831-7514853 GGCAGGAGAGGTCATGTAGCGGG - Intronic
1020434982 7:8152575-8152597 GGTAGTGGTGGTGAAGGAGATGG - Intronic
1020484652 7:8706379-8706401 GGGAGGAGAGGTAATGCAGAAGG - Intronic
1021897741 7:25253054-25253076 GGAAGCAGAGGTCAGGGAGGAGG + Intergenic
1023130459 7:36997744-36997766 GGTAGGAGAGGAAAAGAGGAGGG + Intronic
1023377768 7:39575913-39575935 TGTTGGAGAAGGCAAGGAGAAGG - Intronic
1023630858 7:42162930-42162952 GGGAGGAGTGGTCCAGGGGAAGG + Intronic
1024569639 7:50713344-50713366 GGCAGGAGAAGTGATGGAGATGG - Intronic
1026464808 7:70644898-70644920 TCTTGGAGAGGTCAAGGAGCAGG - Intronic
1026762570 7:73137774-73137796 GGAAGGAGAGGGGAAGGGGAGGG + Intergenic
1026762578 7:73137796-73137818 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1026762586 7:73137818-73137840 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1026762594 7:73137840-73137862 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1026762602 7:73137862-73137884 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1026762612 7:73137884-73137906 GGAAGGAGAGGGGAAGGGGAGGG + Intergenic
1027039033 7:74947550-74947572 GGAAGGAGAGGGGAAGGGGAGGG + Intergenic
1027039041 7:74947572-74947594 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1027039049 7:74947594-74947616 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1027039057 7:74947616-74947638 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1027039065 7:74947638-74947660 GGAAGGAGAGGAGAAGGGGAGGG + Intergenic
1027039075 7:74947660-74947682 GGAAGGAGAGGGGAAGGGGAGGG + Intergenic
1027039079 7:74947671-74947693 GGAAGGGGAGGGGAAGGAGAGGG + Intergenic
1027039085 7:74947682-74947704 GGAAGGAGAGGGGAAGGGGAGGG + Intergenic
1027084566 7:75254706-75254728 GGAAGGAGAGGGGAAGGGGAGGG - Intergenic
1027084572 7:75254717-75254739 GGAAGGGGAGGGGAAGGAGAGGG - Intergenic
1027084576 7:75254728-75254750 GGAAGGAGAGGGGAAGGGGAGGG - Intergenic
1027084586 7:75254750-75254772 GGAAGGAGAGGAGAAGGGGAGGG - Intergenic
1027084594 7:75254772-75254794 GGAAGGAGAGGAGAAGGGGAGGG - Intergenic
1027084602 7:75254794-75254816 GGAAGGAGAGGGGAAGGGGAGGG - Intergenic
1027084612 7:75254816-75254838 GGAAGGAGAGGAGAAGGGGAGGG - Intergenic
1027084620 7:75254838-75254860 GGAAGGAGAGGAGAAGGGGAGGG - Intergenic
1027084628 7:75254860-75254882 GGAAGGAGAGGAGAAGGGGAGGG - Intergenic
1027084636 7:75254882-75254904 GGAAGGAGAGGAGAAGGGGAGGG - Intergenic
1027084644 7:75254904-75254926 GGAAGGAGAGGGGAAGGGGAGGG - Intergenic
1027084650 7:75254915-75254937 GGAAGGGGAGGGGAAGGAGAGGG - Intergenic
1027084654 7:75254926-75254948 GGAAGGAGAGGGGAAGGGGAGGG - Intergenic
1027691899 7:81358130-81358152 GGCAGGAGAGGAAGAGGAGACGG - Intergenic
1028160619 7:87480611-87480633 GATCAGAGAGGTCACGGAGAGGG - Intergenic
1028990554 7:97044651-97044673 GGTAAGAATGGTTAAGGAGAGGG + Intergenic
1029018338 7:97338045-97338067 GGTTAGAGAGGTCAAGGGGCAGG - Intergenic
1029622273 7:101697698-101697720 GGAGAGAGAGGTCAAGGTGAAGG + Intergenic
1031681603 7:124681428-124681450 GGTAGCAGAGGTGGAGGAGGTGG - Intergenic
1031866034 7:127039761-127039783 GGTAAGAGAGGGGAAGGGGAAGG + Intronic
1032058290 7:128701414-128701436 GGGAGGAGAGGGGAAGGGGAGGG + Intergenic
1032379999 7:131469070-131469092 AGTAGGACAGGACAAGCAGATGG - Intronic
1032448045 7:132001468-132001490 GGTGGGGGAGGTCAGGGAGAGGG + Intergenic
1032464303 7:132134274-132134296 GGTTGGAGAAGTGAAGGATAGGG - Intronic
1032516588 7:132510659-132510681 GGTGAGAGAGGGCAAGGAGCAGG + Intronic
1033073310 7:138224531-138224553 AGTAGGAAAGGTAAAGCAGAAGG - Intergenic
1033464519 7:141578628-141578650 AGTGGGAGAGGTCAAGTTGAGGG + Intronic
1033614941 7:143004951-143004973 GGAAGAGGAGGTCAAGGGGAAGG - Intergenic
1034348207 7:150399760-150399782 GGAAGGGGAGTTCCAGGAGAGGG - Intronic
1034448915 7:151127085-151127107 GGAGGGAGAGGTCCAGGAAACGG + Intronic
1034537033 7:151731765-151731787 GGGAGGAGAAGTCAATGACAGGG + Intronic
1034844548 7:154432000-154432022 GGGTGGAGAGGCCAAGGAGCTGG - Intronic
1035270818 7:157718986-157719008 GGAGGGAGAGGTCCAGAAGATGG - Intronic
1035305520 7:157928996-157929018 GGCAGGAGGGGACATGGAGATGG + Intronic
1035481403 7:159190235-159190257 GGAAGGAGAGGAGAAGGAGCAGG + Intergenic
1035856354 8:2980401-2980423 AGGAGGAGAGGACAAGGAGGTGG - Intronic
1036415709 8:8545986-8546008 GGAAGGAGAAGTAAGGGAGAAGG - Intergenic
1036528237 8:9555808-9555830 GGTAGCAGGGGCCAAAGAGAAGG - Intergenic
1036596029 8:10213176-10213198 GGTAGTAGGGGTACAGGAGAAGG - Intronic
1036763856 8:11533633-11533655 GGAAGGGGAGGTGGAGGAGACGG + Intronic
1036803310 8:11808747-11808769 GGTGGGAGACGTCGAGGAGCAGG - Intronic
1037502551 8:19499693-19499715 GAAGGGAGAGGTCAAGGAAAAGG - Intronic
1037503502 8:19507494-19507516 GGTAGGGGAAGACAAGGAAAAGG - Intronic
1037584689 8:20268477-20268499 GGGAGGAAGGGTCAAGGACAAGG - Intronic
1037585872 8:20275590-20275612 GGTAAGAGAGGAGAAAGAGAAGG + Intronic
1037613811 8:20498994-20499016 GGTAGAAGAGGTGAAGGAGGTGG - Intergenic
1037702087 8:21284506-21284528 GGTGGAAGAGGTAGAGGAGATGG + Intergenic
1038741346 8:30219648-30219670 AGGTGGAGAGATCAAGGAGAAGG - Intergenic
1038900901 8:31842577-31842599 GGAAGGAGTGGTCAGGTAGAAGG - Intronic
1039087995 8:33799031-33799053 AGCTGGAGTGGTCAAGGAGAAGG + Intergenic
1039691296 8:39867652-39867674 GGAAGGGGAGGTGAAGGAGGGGG - Intergenic
1039706488 8:40012740-40012762 GGGAGGAGAGGAGAAGGAAAGGG + Intronic
1041020849 8:53636810-53636832 GGTGGGAGGGGGGAAGGAGAAGG - Intergenic
1041103154 8:54416972-54416994 GGAAGGAGAGGTTTGGGAGAGGG - Intergenic
1041122089 8:54596802-54596824 GGTTGTAGAAGGCAAGGAGATGG - Intergenic
1041547517 8:59062221-59062243 GGTAGGAGTGGAAAAGGAGGAGG + Intronic
1042014978 8:64299017-64299039 GATATGAGAAATCAAGGAGAAGG + Intergenic
1042857097 8:73278423-73278445 GGTAGGAGAAGGCTAGCAGAAGG - Intergenic
1042952117 8:74210996-74211018 AGTGAAAGAGGTCAAGGAGAGGG + Intergenic
1043127768 8:76421343-76421365 GATAGGAGAGGGAAAGAAGAAGG - Intergenic
1043708518 8:83382476-83382498 GGGAGGGGAGGGAAAGGAGAGGG + Intergenic
1043746935 8:83886183-83886205 GGCAGAAAAGGTAAAGGAGATGG + Intergenic
1043766685 8:84143474-84143496 GTTGGGAAAAGTCAAGGAGAAGG + Intergenic
1044088181 8:87968111-87968133 GGTATGAGAGGGGCAGGAGAGGG + Intergenic
1044389781 8:91636314-91636336 GGTAGGAGAGGTTAATTAGCAGG - Intergenic
1045379750 8:101611532-101611554 AGTGAGACAGGTCAAGGAGATGG - Intronic
1045993255 8:108334631-108334653 GGCAGAAGAGATCAAGGAGGTGG - Intronic
1047215231 8:122870709-122870731 GGTAGGAGAAGTCAAAGACAAGG + Intronic
1047372830 8:124270329-124270351 GGTAATAAAGTTCAAGGAGATGG - Intergenic
1047424895 8:124736296-124736318 GCCAGGAGAGGGCAAGAAGAGGG + Intergenic
1047953590 8:129956097-129956119 GGTTGGAGAAGGAAAGGAGAGGG - Intronic
1048001309 8:130381713-130381735 GGAAAGTGAGGTCAGGGAGATGG - Intronic
1048261434 8:132948738-132948760 GGTAGGAGAGGTCAGTGTGATGG - Intronic
1048605687 8:135966435-135966457 GATATGAGAGGTTAAGGGGATGG - Intergenic
1048968032 8:139628215-139628237 GGGAGGAAAGGCAAAGGAGATGG - Intronic
1049283387 8:141761861-141761883 GATAGGAGTGGTGAAGGAAATGG - Intergenic
1049675492 8:143887167-143887189 GCAAGGAGAGGACAGGGAGAAGG - Intergenic
1049931739 9:463867-463889 TCTGGGAGAGGTCAAGGAGCAGG - Intronic
1050345006 9:4677521-4677543 GGTATGAGAGGTAAAGGAGAGGG + Intergenic
1050609202 9:7333679-7333701 GGTAGAAGACGTAAAGGAGGTGG - Intergenic
1050952113 9:11610757-11610779 GGGAGGAGAGGGGAAAGAGAAGG - Intergenic
1051187516 9:14475648-14475670 GTTGGGGAAGGTCAAGGAGATGG - Intergenic
1051600830 9:18871960-18871982 GGTAGGAGTTGTAATGGAGAGGG - Intronic
1051908384 9:22123558-22123580 GGTAAGAGAGGCCAAAGAGCTGG + Intergenic
1052405872 9:28059896-28059918 GGTATGAGAGGCAAAGGGGAGGG + Intronic
1052460590 9:28757742-28757764 GGTGGGAGGGGTGAGGGAGAGGG + Intergenic
1052797014 9:32931827-32931849 GGGAGGGGAGGTGAAGAAGAGGG + Intergenic
1052854521 9:33398806-33398828 GATGAGAGAGCTCAAGGAGAGGG + Intronic
1053263589 9:36693933-36693955 GGAAGGAGAGGGGTAGGAGAAGG - Intergenic
1053269482 9:36740248-36740270 GGCAGGAGAGGTTCAGGAAATGG - Intergenic
1053682524 9:40494968-40494990 GATGAGAGAGCTCAAGGAGAGGG + Intergenic
1053732703 9:41074131-41074153 GCTAGGAGAGGGCATGGCGACGG + Intergenic
1053843079 9:42206948-42206970 GGTAGGAGAAGGAAAGGACATGG - Intergenic
1053932507 9:43123294-43123316 GATGAGAGAGCTCAAGGAGAGGG + Intergenic
1054100138 9:60937674-60937696 GGTAGGAGAAGGAAAGGACATGG - Intergenic
1054121535 9:61213301-61213323 GGTAGGAGAAGGAAAGGACATGG - Intergenic
1054281190 9:63129961-63129983 GATGAGAGAGCTCAAGGAGAGGG - Intergenic
1054295623 9:63330468-63330490 GATGAGAGAGCTCAAGGAGAGGG + Intergenic
1054393643 9:64634972-64634994 GATGAGAGAGCTCAAGGAGAGGG + Intergenic
1054428291 9:65140185-65140207 GATGAGAGAGCTCAAGGAGAGGG + Intergenic
1054502088 9:65881358-65881380 GATGAGAGAGCTCAAGGAGAGGG - Intronic
1054542285 9:66278131-66278153 GGAAGGAGAGGGGAAGGGGAGGG - Intergenic
1054542291 9:66278142-66278164 GGAAGGGGAGGGGAAGGAGAGGG - Intergenic
1054586206 9:66969211-66969233 GGTAGGAGAAGGAAAGGACATGG + Intergenic
1055074062 9:72195725-72195747 GGGAGGAGATGGGAAGGAGAAGG + Intronic
1055093362 9:72385445-72385467 GGTAGTAGATGTCGAGGACAAGG - Intergenic
1057311471 9:93945868-93945890 GGTAGGGGAGGACACGCAGAGGG - Intergenic
1058580203 9:106447553-106447575 GGTAGCAGAGGTGAAAGAGGTGG - Intergenic
1058616722 9:106837335-106837357 GGTTGGAGAGGGCAGTGAGAAGG - Intergenic
1058837407 9:108870582-108870604 GGTAGGGGAGGTTAAAGAGGAGG + Intronic
1058902492 9:109454204-109454226 GGCAGGAGAGGCCAGGGAGGTGG + Intronic
1059437628 9:114285982-114286004 GGAATGAGAGGTCAAGGTGGGGG + Intronic
1059542529 9:115144384-115144406 GGAAGGGGAGGAAAAGGAGAAGG - Intronic
1059751762 9:117254038-117254060 GGCAGGGGAGGTGAAGGTGAAGG + Intronic
1060059405 9:120445663-120445685 GGTAGGAGGGATCCAAGAGAGGG - Intronic
1060256806 9:122038297-122038319 GGTAGGACAGCTTAGGGAGAAGG - Intronic
1060272909 9:122159726-122159748 GAAAGGGGAGTTCAAGGAGACGG - Exonic
1060610951 9:124963933-124963955 GAGAGGAGAGGTGAAGGAGATGG + Intronic
1060811008 9:126611554-126611576 GGTAGGAGAGGCCAGGCACAGGG + Intergenic
1060818644 9:126649158-126649180 GATAGGGGAGGTGAAGGGGACGG - Intronic
1061220043 9:129245207-129245229 GGAAGGAGAGGACCAGGGGAGGG + Intergenic
1061941324 9:133885752-133885774 GGTTTGCGAGGTCAGGGAGATGG - Intronic
1062480951 9:136751079-136751101 GGCAGGAGAGGGGAAGAAGAAGG + Intergenic
1062744603 9:138203402-138203424 GGAGGGAGAGGACAAGGAGGAGG + Intergenic
1203775115 EBV:68610-68632 GGTGGCGGAGGTGAAGGAGATGG - Intergenic
1185714481 X:2330200-2330222 GGAAGAGGAGGTGAAGGAGAAGG + Intronic
1185893419 X:3839034-3839056 CCTAGGAGACTTCAAGGAGAAGG + Intronic
1185898535 X:3877458-3877480 CCTAGGAGACTTCAAGGAGAAGG + Intergenic
1185903650 X:3915887-3915909 CCTAGGAGACTTCAAGGAGAAGG + Intergenic
1186051204 X:5597618-5597640 GGTAGGAATGCTTAAGGAGAAGG - Intergenic
1186071476 X:5825989-5826011 GGTAGGCGAGGAGGAGGAGAAGG + Intergenic
1186462659 X:9760683-9760705 GGGAGGAGAGGGCATGCAGAGGG + Intronic
1187152533 X:16694309-16694331 GGTAGGAGGGCTTAAGGAGCAGG - Intronic
1188072627 X:25735928-25735950 GCTTGGAGAGTTCAAGGTGAAGG + Intergenic
1189087139 X:38037292-38037314 GGCAGGAGAAGGCAGGGAGAGGG - Intronic
1190133566 X:47773106-47773128 GGAAGGAGAAATCAAGGTGAAGG + Intergenic
1190424104 X:50315762-50315784 GGAAGGAGAGGGGAGGGAGATGG - Intronic
1190545497 X:51522354-51522376 GGTCCCAGAGGTCAAGGATACGG - Intergenic
1190927859 X:54924750-54924772 GAGAGGAGAGCTCAAGGAGGAGG - Intronic
1192332032 X:70183303-70183325 GGGAGCAGAGGTGAAGGAGTGGG - Intronic
1192572240 X:72215860-72215882 GGTAGAAGAAATCTAGGAGAAGG - Intronic
1193235706 X:79104551-79104573 GAAAGGAGAAGGCAAGGAGACGG - Intergenic
1193235713 X:79104596-79104618 GGAAGGAGAAGAGAAGGAGAAGG - Intergenic
1193380331 X:80809679-80809701 GGAAGGAGAGGAGAGGGAGAGGG + Exonic
1194088722 X:89560233-89560255 AGGAGGAGTGGTCCAGGAGAGGG - Intergenic
1195300986 X:103529774-103529796 GGCAGGAGAGGGGAAAGAGATGG - Intergenic
1196038341 X:111172490-111172512 GGCAGGAGAGGAGAGGGAGAAGG - Intronic
1197758276 X:130011176-130011198 GGTGGGAGTGGCCAAGGAGGAGG - Intronic
1197840814 X:130744220-130744242 GGTAGGAGAGTTGAATTAGATGG + Intronic
1197850144 X:130849925-130849947 AGAAGGAGAGGCCCAGGAGAAGG - Intronic
1198532343 X:137559205-137559227 GGAAGGAAAGATGAAGGAGAGGG + Intergenic
1198784622 X:140273725-140273747 GGTCAAAGAGGTCAAGGAAATGG - Intergenic
1198801704 X:140454231-140454253 GGTGGGTGTGGTCAAGAAGATGG - Intergenic
1199022471 X:142898053-142898075 AGTAGAAGAGATCATGGAGAAGG + Intergenic
1199643143 X:149882225-149882247 GGTAGGGGGCCTCAAGGAGATGG + Intronic
1200091711 X:153639059-153639081 GGGAGGACAAGACAAGGAGAGGG + Intergenic
1200215907 X:154368178-154368200 GGTAGCAGGGGCCAAGGAGGAGG + Intronic
1200441399 Y:3216286-3216308 AGGAGGAGTGGTCCAGGAGAGGG - Intergenic
1201537168 Y:15063249-15063271 GGGAGGTGGGGGCAAGGAGAGGG - Intergenic