ID: 992889736

View in Genome Browser
Species Human (GRCh38)
Location 5:81193167-81193189
Sequence CCAAGGGAACTCTAGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 6, 3: 12, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992889736 Original CRISPR CCAAGGGAACTCTAGGACAT TGG (reversed) Intronic
902838972 1:19063460-19063482 CCCAGGGAACAAGAGGACATTGG - Intergenic
907612728 1:55888872-55888894 CCCAGGGATCTCAAGGACATAGG - Intergenic
909996973 1:82291843-82291865 CCAAGGAAAGTCTCTGACATGGG - Intergenic
910444968 1:87290888-87290910 AGAAGGGAACTCTACGACATCGG + Intergenic
911404138 1:97415157-97415179 CAAACAAAACTCTAGGACATTGG + Intronic
912205246 1:107501171-107501193 TCCAGGGAAATCTCGGACATGGG + Intergenic
913268460 1:117068341-117068363 CCATGAGAACACTTGGACATAGG + Intronic
915850213 1:159313851-159313873 CCCAGGGAACTCTGGGACTTAGG + Exonic
917233485 1:172864159-172864181 CCAAGGGTGCTCTAAGATATGGG - Intergenic
921808219 1:219480111-219480133 GCAAGGAAACTCTAGGATAAAGG + Intergenic
922220616 1:223555767-223555789 ACAAGGGAATTTTTGGACATTGG + Intronic
922749869 1:228065277-228065299 TCCAGGGAACTCCAGGACACAGG + Intergenic
924748271 1:246859361-246859383 CCAGGGGAACACTAGTAAATGGG - Intronic
1062802192 10:388931-388953 CTAAGGGATCTCAGGGACATGGG + Intronic
1062802237 10:389058-389080 CCAAGGGATCTCAGGGGCATGGG + Intronic
1062802260 10:389126-389148 CCAAGGGATCTCAGGGGCATGGG + Intronic
1062802279 10:389183-389205 CCAAGGGATCTCAGGGGCATGGG + Intronic
1063628275 10:7711539-7711561 CCAAGGGGTCTTTAGGACAAAGG - Intronic
1064358375 10:14640463-14640485 CCAAGAGAACTCAAGCAGATGGG - Intronic
1070891606 10:79945482-79945504 CTGAGGGACCTCTATGACATTGG - Intronic
1071135114 10:82444687-82444709 CCAAGGCAAATTCAGGACATAGG + Intronic
1071523681 10:86346180-86346202 CCAGGGCAACTCCAGCACATGGG + Intronic
1071926658 10:90416677-90416699 CAATGGGAACACTTGGACATAGG - Intergenic
1072628929 10:97132398-97132420 CCAAGAGGACTCTCAGACATCGG - Intronic
1076865025 10:133162219-133162241 CCAGGGGAATTCTGAGACATGGG - Intronic
1078432692 11:11300046-11300068 CCCAGGCAAATCTAGAACATTGG + Intronic
1080255726 11:30288562-30288584 CCAAGGCAACTCTGGAAAATGGG + Intergenic
1080354178 11:31422549-31422571 ACAGGGGAACTTTAGGAGATAGG + Intronic
1087361770 11:97169671-97169693 CAAAAGGAACTCCAGGAAATGGG - Intergenic
1088771357 11:113038693-113038715 CCAAAAGAACTCTAGGATTTGGG + Intronic
1089756247 11:120689510-120689532 CCAAGTGAACTCTAGAACAGGGG - Intronic
1093319187 12:17691789-17691811 CAACGGGAACACTAGGACACAGG + Intergenic
1094150418 12:27276471-27276493 CAAAGGGATTTCTAGGAGATGGG - Intronic
1095962072 12:47842010-47842032 CCAAAGGAAGTCTAGGAGCTGGG - Intronic
1096802465 12:54120174-54120196 ACAAGGGAAATCAAGGAAATAGG + Intergenic
1096982962 12:55738784-55738806 CTGAGGGAACTCAAGGAAATAGG + Intergenic
1102560571 12:113759243-113759265 CCAAAGGAACACCATGACATGGG + Intergenic
1103426852 12:120843565-120843587 CCCTGGGAACTCTAGGAGAAAGG - Intronic
1109257544 13:60101630-60101652 CCAAGGACACTCTAGGGCAGGGG - Intronic
1111137806 13:84072496-84072518 TCAAGGTACCTCTAGGCCATTGG - Intergenic
1113821510 13:113217238-113217260 CCAAGAGAACTTTACGACAAAGG - Intronic
1114430710 14:22658052-22658074 CCAAGCAAACTCTAGGAGCTAGG + Intergenic
1115412727 14:33093916-33093938 CAATGGGAACACTTGGACATGGG + Intronic
1120494718 14:85220769-85220791 CCAAAGAAAGTCTAGGATATTGG - Intergenic
1127901106 15:63341600-63341622 CCAAGGGACCTCTAGATCAGTGG - Intronic
1128456447 15:67834079-67834101 CCGTGTGAACTCTAGGGCATCGG + Exonic
1129999472 15:80034503-80034525 CCCAGGAAACTCCAGCACATGGG - Intergenic
1132004558 15:98214957-98214979 CCAAGTGAACTAAAGGACACGGG - Intergenic
1134384099 16:13755895-13755917 CCAAGCCATCTCTAGGACATGGG + Intergenic
1137788415 16:51154917-51154939 CCAAGGATACTCTAGGACTTGGG - Intergenic
1138439988 16:57028433-57028455 CCAGGGGGACTCTGGGACCTGGG - Intronic
1139483646 16:67244582-67244604 CCAGGGGAACTCTAGGGGCTAGG + Intronic
1140113393 16:72022148-72022170 CCAAGGGATCCCGTGGACATTGG - Intronic
1141934455 16:87227928-87227950 CCAAGGGACCGCCAGGACAGAGG + Intronic
1145933966 17:28704357-28704379 GCAAGGGGACTCGATGACATGGG + Exonic
1155443882 18:25890424-25890446 TTAAGGAAACTCCAGGACATTGG + Intergenic
1156328099 18:36092796-36092818 ACAAGGGCACTCTATGACCTCGG + Intergenic
1161387704 19:4005317-4005339 CAGAGGGAATTTTAGGACATTGG + Intergenic
1163287306 19:16356838-16356860 CTCAGGGAAGTCTGGGACATTGG - Intronic
1167100809 19:47403383-47403405 CCAAGGGCTCTCAAGGACACCGG - Exonic
926071153 2:9892879-9892901 AAAAGGGAACTCTTGTACATTGG - Intronic
934047305 2:88183282-88183304 CCAAGTGAGCTCTGAGACATTGG + Intronic
935697283 2:105781157-105781179 CAAAGGCACCTCTAGGAAATGGG - Intronic
935815224 2:106841243-106841265 CCGAGAGAACTCTGGAACATAGG + Intronic
937025873 2:118696766-118696788 CCAAGGGAAAACCAGGACATTGG - Intergenic
938175122 2:129118686-129118708 CCCAGGGAAGTCCAGGACAGAGG - Intergenic
942272591 2:174291894-174291916 CAATGAGAACTCTTGGACATAGG + Intergenic
946585937 2:221187735-221187757 CCAAGGGAACTGCAGGACTCCGG + Intergenic
948187152 2:236030444-236030466 CCAAGGGAGCTCTGAGACCTGGG + Intronic
948371262 2:237490387-237490409 CCAAGCAGCCTCTAGGACATTGG + Intronic
1170341601 20:15334288-15334310 CCAATGGAACTCTATGATAGAGG - Intronic
1171794278 20:29554412-29554434 ACAAGGGAAATCAAGGAAATAGG - Intergenic
1171854196 20:30329979-30330001 ACAAGGGAAATCAAGGAAATAGG + Intergenic
1173086804 20:39927636-39927658 CAAAGGGAAATCAAGGTCATCGG + Intergenic
1175488610 20:59363688-59363710 CCAAGGCAACTCCAGGGCTTTGG - Intergenic
1179316842 21:40251477-40251499 ACAAGGGAAGACTAGGAAATAGG - Intronic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
955042769 3:55333173-55333195 CAAAGGGGAATCTTGGACATTGG - Intergenic
956907889 3:73785916-73785938 GAAAGAGAACTCTAGGACAGAGG + Intergenic
957340370 3:78888107-78888129 CCAAGGGAATTTGAGGACAGAGG + Intronic
957604722 3:82382437-82382459 CTAAGGGACCTTTAGGAGATGGG - Intergenic
960705619 3:120477949-120477971 CCAAGGGAACACTATGAGGTCGG + Intergenic
962617226 3:137138609-137138631 GAAAGGGAACTTTAGGACCTTGG + Intergenic
963815335 3:149824641-149824663 CCAAAGGAAAACTAGGACAGAGG - Intronic
965500255 3:169447235-169447257 GCAGGAGAACTCTAGGGCATGGG - Intronic
965754406 3:172010837-172010859 CCTAGGGAAGTGTAGTACATTGG - Intergenic
968591035 4:1459805-1459827 CCAAGAGAACTCCAGGCCAGAGG + Intergenic
970111581 4:12643692-12643714 CCAGGGAGACTCCAGGACATGGG - Intergenic
975175029 4:71278563-71278585 CAAAGGGAACCCTTAGACATTGG - Intronic
978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG + Intergenic
979423084 4:120530577-120530599 CAATGGGAACACTTGGACATAGG - Intergenic
983376532 4:166935390-166935412 CCCATGGAACTTTGGGACATGGG + Intronic
984957325 4:185058375-185058397 CCAAGGGAGCTGTAGGAGAGTGG - Intergenic
985162644 4:187060663-187060685 CAGAGGCAACTCTAGGACGTTGG - Intergenic
986000645 5:3628204-3628226 CCAAGGGCCCTCTAGGCCAAAGG + Intergenic
987142567 5:14960579-14960601 CTGAGTGACCTCTAGGACATAGG + Intergenic
989166769 5:38440157-38440179 CAGAGGGAACTGCAGGACATTGG + Intronic
990001543 5:50899097-50899119 CCAAGGTGACACTAGGACAGAGG + Intergenic
992889736 5:81193167-81193189 CCAAGGGAACTCTAGGACATTGG - Intronic
996601478 5:125269233-125269255 CAAAGGGAACTCAAGGATATAGG - Intergenic
999111011 5:149121440-149121462 CCAAGGGAGCTCTTGGGCACAGG - Intergenic
1005270896 6:24162109-24162131 CCATGAAAGCTCTAGGACATTGG + Intergenic
1005285878 6:24326360-24326382 TCCAGGGAGCTCTAGGGCATGGG - Intronic
1007335211 6:41150668-41150690 CCCTGGGAATTCTAGGATATGGG + Intronic
1007969601 6:46037450-46037472 CCAAGGAAGCTCTCTGACATTGG - Intronic
1013191634 6:107808623-107808645 AAAAGAGAACTCCAGGACATGGG + Intronic
1015937872 6:138420725-138420747 CCAGGGGAACTCTGGGAAAAAGG - Exonic
1016902818 6:149118670-149118692 CCAAGAGAACTGTAAGACCTGGG - Intergenic
1020095550 7:5366887-5366909 CCAAGTGACCTCTAGGCCAGTGG + Intronic
1021304584 7:19016148-19016170 CCAAGTTAACTCTAGGACTTGGG + Intergenic
1023167120 7:37353940-37353962 CCAAGGGAAGGAAAGGACATTGG - Intronic
1026142092 7:67714932-67714954 CCAAGGTAAGTAAAGGACATGGG + Intergenic
1027411112 7:77918764-77918786 CCAAGGGAACAATAAGCCATAGG - Intronic
1029355591 7:100049477-100049499 CCAAGGGTACTCAGGGACCTTGG + Intergenic
1040007808 8:42635589-42635611 CCATGGGAACTCTAGGGCTAGGG + Intergenic
1044394729 8:91697451-91697473 CTGGGGAAACTCTAGGACATTGG - Intergenic
1054820388 9:69515930-69515952 CCAAGGGCACACAAGGCCATGGG + Intronic
1056273469 9:84969924-84969946 CTAAGAGCACTCTAGAACATTGG + Intronic
1057280353 9:93706606-93706628 CCATGGGAACTCTAGGGGACAGG + Intergenic
1060382495 9:123189644-123189666 CAATGAGAACTCTTGGACATAGG + Intronic
1060711909 9:125875103-125875125 CCAAAGAAACTCTAGTGCATGGG - Intronic
1061201391 9:129140470-129140492 CCACTGGAGCTCCAGGACATGGG + Intronic
1185530002 X:810114-810136 CCAATGAAGCTCTGGGACATGGG - Intergenic
1186393092 X:9180924-9180946 CCACGGGAACTCTAGGAGTCAGG - Intergenic
1187275272 X:17811305-17811327 CCAACCGAACTGTAGGGCATTGG - Intronic
1187590184 X:20709027-20709049 CCTAGGGTACTCTAGGAGCTGGG + Intergenic
1188334634 X:28915409-28915431 CAAAGGGAAATCTATGACTTTGG - Intronic
1192253213 X:69430966-69430988 CCAGGGAAACTCTGGGAAATGGG + Intergenic
1192940880 X:75910324-75910346 CGAAAGGAAGTCTAGGCCATAGG - Intergenic
1193659770 X:84243335-84243357 CAAGGGAAACTCTAGGGCATGGG + Intergenic
1197560040 X:128009662-128009684 CTAAGTGAACTCTAGGACGCTGG - Intergenic
1197737977 X:129866665-129866687 CCCAGGCAAGTCTAGGAAATTGG + Intergenic
1197850531 X:130853846-130853868 CCATTGAAACTCTAGGAAATGGG - Intronic
1197897733 X:131333327-131333349 ACAATGGAACTCATGGACATAGG - Intronic
1198702155 X:139408610-139408632 TCAGGGAAACTCTAGGACATTGG - Intergenic
1200683039 Y:6235491-6235513 CCAAGGGACCTCTAGGACCTGGG + Intergenic
1200832467 Y:7700388-7700410 CGAAGGCACCTCTAGGACCTGGG - Intergenic
1201049594 Y:9918891-9918913 CCAAGGGACCTCTAGGACCTGGG - Intergenic
1202162391 Y:21948864-21948886 CCAAGGGACCTCTAGGACCTGGG - Intergenic
1202186636 Y:22191695-22191717 CCAAGGTACCTCTAGGACCTAGG + Intergenic
1202204723 Y:22394701-22394723 CCAAGGTACCTCTAGGACCTAGG - Intronic
1202228965 Y:22637509-22637531 CCAAGGGACCTCTAGGACCTGGG + Intergenic
1202314189 Y:23558656-23558678 CCAAGGGACCTCTAGGACCTGGG - Intergenic
1202556613 Y:26111939-26111961 CCAAGGGACCTCTAGGACCTGGG + Intergenic