ID: 992890092

View in Genome Browser
Species Human (GRCh38)
Location 5:81195986-81196008
Sequence GCAGTTACACGCGTGAGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3505
Summary {0: 1, 1: 2, 2: 9, 3: 200, 4: 3293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992890092_992890097 1 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890097 5:81196010-81196032 GCACTTTGGGAGGCCAAGAAGGG 0: 229
1: 9261
2: 108369
3: 228330
4: 236982
992890092_992890099 20 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890099 5:81196029-81196051 AGGGCAGATCATTTGAAGTCAGG 0: 4
1: 140
2: 2239
3: 16072
4: 50521
992890092_992890096 0 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890096 5:81196009-81196031 AGCACTTTGGGAGGCCAAGAAGG 0: 3853
1: 66063
2: 153594
3: 157369
4: 93226
992890092_992890095 -9 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890095 5:81196000-81196022 TGTAACTGCAGCACTTTGGGAGG 0: 29
1: 877
2: 19623
3: 334266
4: 260398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992890092 Original CRISPR GCAGTTACACGCGTGAGCCA CGG (reversed) Intronic
Too many off-targets to display for this crispr