ID: 992890095

View in Genome Browser
Species Human (GRCh38)
Location 5:81196000-81196022
Sequence TGTAACTGCAGCACTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615193
Summary {0: 29, 1: 877, 2: 19623, 3: 334266, 4: 260398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992890092_992890095 -9 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890095 5:81196000-81196022 TGTAACTGCAGCACTTTGGGAGG 0: 29
1: 877
2: 19623
3: 334266
4: 260398
992890091_992890095 -2 Left 992890091 5:81195979-81196001 CCGGGCACCGTGGCTCACGCGTG 0: 1
1: 368
2: 21176
3: 92576
4: 136440
Right 992890095 5:81196000-81196022 TGTAACTGCAGCACTTTGGGAGG 0: 29
1: 877
2: 19623
3: 334266
4: 260398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992890095 Original CRISPR TGTAACTGCAGCACTTTGGG AGG Intronic
Too many off-targets to display for this crispr