ID: 992890096

View in Genome Browser
Species Human (GRCh38)
Location 5:81196009-81196031
Sequence AGCACTTTGGGAGGCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474105
Summary {0: 3853, 1: 66063, 2: 153594, 3: 157369, 4: 93226}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992890091_992890096 7 Left 992890091 5:81195979-81196001 CCGGGCACCGTGGCTCACGCGTG 0: 1
1: 368
2: 21176
3: 92576
4: 136440
Right 992890096 5:81196009-81196031 AGCACTTTGGGAGGCCAAGAAGG 0: 3853
1: 66063
2: 153594
3: 157369
4: 93226
992890092_992890096 0 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890096 5:81196009-81196031 AGCACTTTGGGAGGCCAAGAAGG 0: 3853
1: 66063
2: 153594
3: 157369
4: 93226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992890096 Original CRISPR AGCACTTTGGGAGGCCAAGA AGG Intronic
Too many off-targets to display for this crispr