ID: 992890097

View in Genome Browser
Species Human (GRCh38)
Location 5:81196010-81196032
Sequence GCACTTTGGGAGGCCAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583171
Summary {0: 229, 1: 9261, 2: 108369, 3: 228330, 4: 236982}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992890092_992890097 1 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890097 5:81196010-81196032 GCACTTTGGGAGGCCAAGAAGGG 0: 229
1: 9261
2: 108369
3: 228330
4: 236982
992890091_992890097 8 Left 992890091 5:81195979-81196001 CCGGGCACCGTGGCTCACGCGTG 0: 1
1: 368
2: 21176
3: 92576
4: 136440
Right 992890097 5:81196010-81196032 GCACTTTGGGAGGCCAAGAAGGG 0: 229
1: 9261
2: 108369
3: 228330
4: 236982

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992890097 Original CRISPR GCACTTTGGGAGGCCAAGAA GGG Intronic
Too many off-targets to display for this crispr