ID: 992890099

View in Genome Browser
Species Human (GRCh38)
Location 5:81196029-81196051
Sequence AGGGCAGATCATTTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68976
Summary {0: 4, 1: 140, 2: 2239, 3: 16072, 4: 50521}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992890091_992890099 27 Left 992890091 5:81195979-81196001 CCGGGCACCGTGGCTCACGCGTG 0: 1
1: 368
2: 21176
3: 92576
4: 136440
Right 992890099 5:81196029-81196051 AGGGCAGATCATTTGAAGTCAGG 0: 4
1: 140
2: 2239
3: 16072
4: 50521
992890092_992890099 20 Left 992890092 5:81195986-81196008 CCGTGGCTCACGCGTGTAACTGC 0: 1
1: 2
2: 9
3: 200
4: 3293
Right 992890099 5:81196029-81196051 AGGGCAGATCATTTGAAGTCAGG 0: 4
1: 140
2: 2239
3: 16072
4: 50521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992890099 Original CRISPR AGGGCAGATCATTTGAAGTC AGG Intronic
Too many off-targets to display for this crispr