ID: 992891553

View in Genome Browser
Species Human (GRCh38)
Location 5:81208857-81208879
Sequence CCATCAATTCTGTTTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992891553 Original CRISPR CCATCAATTCTGTTTAAAAG TGG (reversed) Intronic
900807376 1:4776348-4776370 CCAGCAATTCCTTTTACAAGTGG + Intronic
903911894 1:26733420-26733442 CCACCAACTCTGTTTCATAGGGG + Intronic
904830552 1:33303804-33303826 CAGTCATTTCTGTTTTAAAGGGG - Intergenic
908773273 1:67615449-67615471 CTATCATTTTTGTGTAAAAGAGG + Intergenic
909020122 1:70421727-70421749 TCATCATTTCTGTTTACTAGAGG + Intronic
910842369 1:91572570-91572592 CCTTCAAGTCTGTTGAGAAGAGG - Intergenic
912768334 1:112437460-112437482 CAAGCAATTCTATTAAAAAGTGG - Intronic
913356326 1:117926540-117926562 ACATCAATTCTGTTTAGAGATGG - Intronic
915060736 1:153182245-153182267 CAAACAATCCTGTTAAAAAGTGG - Intergenic
916591115 1:166191592-166191614 CCACAAATCCTGTTTAAAGGGGG + Intergenic
917004711 1:170401115-170401137 CAAAGAATCCTGTTTAAAAGTGG + Intergenic
917319508 1:173764892-173764914 CCATCAATTTTTTTTAAACTGGG - Intronic
918726417 1:187931019-187931041 TCATTAATTCTGTTTAAATCAGG + Intergenic
918872511 1:189993535-189993557 AAATCAATTTTGTTTAAAAGAGG - Intergenic
918996102 1:191762311-191762333 CCAACAATTCTTTTAAAAACTGG + Intergenic
919641198 1:200045986-200046008 ATTTCAATTCTTTTTAAAAGAGG + Intronic
922591040 1:226777246-226777268 CCATCAATTCTCATTATTAGAGG - Intergenic
923825451 1:237494750-237494772 CCCACATTTCTGTTTAAAACAGG - Intronic
1064451724 10:15447983-15448005 CCACCATTTTTGTTTAAAATTGG - Intergenic
1064607731 10:17061355-17061377 CCAGAAATTCTGATTAAAATAGG - Intronic
1065572312 10:27083747-27083769 CCATCTATCCTGTATATAAGAGG + Intronic
1066282872 10:33935041-33935063 CCTTAATTTCTGTTTCAAAGGGG + Intergenic
1066434431 10:35384073-35384095 CCATAAATTCTGATTAAAGGAGG + Intronic
1067498793 10:46783953-46783975 GCATCATTTCTGTTTCCAAGAGG - Intergenic
1067944220 10:50680217-50680239 CCATCAATACTGGGTTAAAGGGG - Intergenic
1068162740 10:53287429-53287451 CCATTCATCCTGTTTAAAAAGGG + Intergenic
1068217904 10:54007707-54007729 CCATCAAACCTGTTTAAAATTGG - Intronic
1070865715 10:79707087-79707109 CCATCAATACTGGGTTAAAGGGG - Intronic
1070879507 10:79845218-79845240 CCATCAATACTGGGTTAAAGGGG - Intronic
1071271348 10:84010352-84010374 CAATCACTTCTGTTCACAAGTGG + Intergenic
1071632617 10:87229308-87229330 CCATCAATACTGGGTTAAAGGGG - Intronic
1071646064 10:87361526-87361548 CCATCAATACTGGGTTAAAGGGG - Intronic
1073588799 10:104736248-104736270 CCATCTAATCAGTTTACAAGAGG - Intronic
1074888489 10:117714459-117714481 CCAAAAATTCTTTTTAAAAAAGG - Intergenic
1075989078 10:126817727-126817749 CCATAAAATCTGTCTAAAAAGGG + Intergenic
1076100252 10:127771966-127771988 ATATAAATTCCGTTTAAAAGAGG - Intergenic
1076278655 10:129226210-129226232 CCATCTCTTCTGTTTAAAGGAGG + Intergenic
1079764764 11:24378216-24378238 CCTTAAATGCTATTTAAAAGTGG - Intergenic
1080927727 11:36775496-36775518 ATTTCAATTCTGTTTAAAACTGG + Intergenic
1081803282 11:45874448-45874470 CCATCAATTCTTGATCAAAGAGG + Intronic
1082197292 11:49321720-49321742 CCCTTAATTCTCTTTTAAAGTGG - Intergenic
1090998987 11:131892628-131892650 CCCTCAAGTCTGTTAACAAGAGG - Intronic
1091134432 11:133176035-133176057 ACAGAAATTCTGTTTAATAGGGG - Intronic
1093198217 12:16154644-16154666 CCGTGACTTCTGTTTGAAAGTGG + Intergenic
1094195833 12:27748984-27749006 CTATCAATTCCTTTTCAAAGAGG - Intronic
1095161438 12:38921447-38921469 CCATTAATTCTTTTTAAAACAGG - Intergenic
1095235228 12:39786825-39786847 CCATCAGTTCTGTCTCACAGAGG - Intronic
1096424757 12:51491778-51491800 GCATCATTTCTGTTAAAGAGGGG - Intronic
1096699339 12:53371788-53371810 GCTTCACTTCTGGTTAAAAGAGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098230451 12:68367771-68367793 CCCTCAATTCTATTAAAAGGGGG - Intergenic
1098231909 12:68379805-68379827 CCATCAATTCTTTAGAAAATGGG + Intergenic
1098593018 12:72237012-72237034 CCAACAATTTTACTTAAAAGAGG - Intronic
1099552193 12:84060729-84060751 CCATTGATTCAGGTTAAAAGCGG + Intergenic
1101042718 12:100772766-100772788 CCTTGAATTCTTTTTAAAAATGG + Intronic
1101205159 12:102479601-102479623 CCAACTTTTCTGTTTAGAAGAGG - Intronic
1105684380 13:22764272-22764294 CAATCAACTTTGTTTAAAAAAGG - Intergenic
1106035522 13:26041257-26041279 GCATCTTTTATGTTTAAAAGGGG - Intergenic
1106150029 13:27091196-27091218 ACATCAATTTTGTAGAAAAGTGG + Intronic
1106300041 13:28455799-28455821 CAAACAACTCTGTTTAAAATGGG + Intronic
1107904893 13:45052798-45052820 CAATCAATTCTGTCTAGAAAGGG + Intergenic
1108031531 13:46235589-46235611 CCATAATTTTTGTTAAAAAGTGG - Intronic
1108928646 13:55786899-55786921 CAATCAATTATATTAAAAAGTGG - Intergenic
1109061272 13:57623433-57623455 CCATCAAATTTATTGAAAAGAGG + Intergenic
1110342747 13:74412563-74412585 CCATCAATTCCTTTCTAAAGGGG - Intergenic
1110764322 13:79265707-79265729 CCAACAATTCTGATTAAACAAGG + Intergenic
1110816193 13:79862450-79862472 CCAACCATTGTATTTAAAAGGGG + Intergenic
1112090584 13:96079013-96079035 CCATAAATTGTCTTGAAAAGAGG + Intergenic
1112115008 13:96342549-96342571 CTATCAATTGTGTTTTAGAGTGG + Intronic
1114437984 14:22723897-22723919 CAATCTACTCTGTTCAAAAGTGG - Intergenic
1115110979 14:29821702-29821724 CCATCAGTAATTTTTAAAAGAGG - Intronic
1115953522 14:38748947-38748969 TCATCATTTCTATTTAAAATGGG - Intergenic
1116190285 14:41656491-41656513 TCATCAAATCTTTTAAAAAGTGG - Intronic
1116492593 14:45523585-45523607 CAATTAATTCTATTTAAAAATGG - Intergenic
1116800601 14:49439563-49439585 CCCTAAATTCTGGTCAAAAGTGG + Intergenic
1117595325 14:57321221-57321243 CCACCAAGTATGTTTTAAAGTGG + Intergenic
1117858840 14:60067797-60067819 CTATCAATTTGGTTTAAAACAGG + Intergenic
1121607237 14:95249974-95249996 CCAGGAATGCTTTTTAAAAGGGG + Intronic
1122244284 14:100390791-100390813 CCATCATTTATGCGTAAAAGTGG + Intronic
1122684851 14:103497541-103497563 CGAAGAATTCTATTTAAAAGGGG - Intronic
1122894350 14:104748856-104748878 GCATCCATTCTGAATAAAAGTGG + Intergenic
1123153711 14:106205363-106205385 CCACCAGTTCAGTTTAGAAGGGG + Intergenic
1124011296 15:25840970-25840992 CAATGAATCCTGTTTAAAAATGG - Intronic
1124117656 15:26862190-26862212 CAATCAATTATTTTTAAAATAGG - Intronic
1125079730 15:35658137-35658159 CACTCTATTCTGTTTGAAAGAGG - Intergenic
1125504183 15:40257480-40257502 CCACCACTTCTGGTGAAAAGCGG + Intronic
1125770298 15:42160774-42160796 CCATTACTTCTGTTCCAAAGAGG - Exonic
1127393515 15:58525721-58525743 CCATCCAATCTGTTTAAATGAGG + Intronic
1127493537 15:59487817-59487839 CTATTAATTCTCTTTAAATGTGG - Intronic
1127962879 15:63902916-63902938 CTATCCCTTCTCTTTAAAAGGGG + Intergenic
1131496405 15:92915093-92915115 CCATAGATTCTGTTTAACACTGG + Intronic
1133458095 16:5960791-5960813 GCTTCAATTCTGCATAAAAGGGG - Intergenic
1133621019 16:7526400-7526422 CCCTCCATTCTGCTTACAAGCGG + Intronic
1135004507 16:18807051-18807073 CCATCACTTTTGTTTTAAAGTGG - Exonic
1136277182 16:29185957-29185979 CCATCTCTTCTGTTTAAGAAGGG - Intergenic
1141714791 16:85720556-85720578 CCAGCAATTCTGTTCAAGACAGG + Intronic
1143157555 17:4848004-4848026 ACCTCATCTCTGTTTAAAAGAGG + Intronic
1146659616 17:34656537-34656559 ACATCAATTTTGTTAAAATGAGG - Intergenic
1147921757 17:43921477-43921499 CCAACAATTTTTTTTAAAAATGG + Intergenic
1148050116 17:44765914-44765936 CCAACAATTCTGTTTTACCGAGG + Intronic
1149050293 17:52296408-52296430 CCATCACTTCTGCCTAGAAGTGG - Intergenic
1149215242 17:54346756-54346778 CCATTTATTCTGTCTGAAAGGGG - Intergenic
1159583288 18:70258431-70258453 GCATCAACCCTATTTAAAAGAGG + Intergenic
1168424458 19:56227746-56227768 CCAGCAATGCTTTTTAAAAAGGG + Intronic
1168552717 19:57311123-57311145 CCATCAATTCTGTTGAGGGGTGG + Intergenic
926021379 2:9498593-9498615 CCATCACTTTTGTTTGAAACTGG - Intronic
927760855 2:25752368-25752390 ATATAAATTCTGTTTAAAAGAGG - Intronic
928144959 2:28764978-28765000 CCATCTTTTCTGTTTTAGAGAGG + Intronic
928187824 2:29130016-29130038 CAACCTATTCTGTTCAAAAGGGG - Intronic
928596710 2:32865826-32865848 CCATCGATTCTGATTTAAAAAGG - Intergenic
928777328 2:34781238-34781260 CCAACCATTCTGTTGAAAACTGG - Intergenic
929642118 2:43592388-43592410 CTATTAATTCTATTTAAAATGGG - Exonic
930996871 2:57729927-57729949 CAAACAATTCTATTAAAAAGTGG - Intergenic
933569104 2:83988069-83988091 CAAACAATTCTATTTAAAAAGGG - Intergenic
933575842 2:84066505-84066527 CCCACAATGCTGTTTTAAAGAGG - Intergenic
934971227 2:98766132-98766154 CCAACAACTTTGTTTAAAAACGG - Intergenic
936259347 2:110945176-110945198 CAAACAATTCTGTTAAAAAGTGG - Intronic
936735430 2:115436594-115436616 CAATAAATAATGTTTAAAAGTGG - Intronic
937902884 2:127036018-127036040 GCATCAATTCTGTATAAAAGTGG - Intergenic
938814643 2:134888183-134888205 CCAACAATCCTATTTAAAAGTGG + Intronic
940457321 2:153916728-153916750 GCATAAATTCAGTTTAAGAGAGG + Intronic
940673213 2:156696331-156696353 CAATCATTCCTGTTTTAAAGGGG + Intergenic
942526539 2:176859175-176859197 CCAGTAATTCAGTTTAAAACTGG + Intergenic
943004168 2:182369394-182369416 CAATCAATTCTATTTTAAATAGG - Intronic
943446569 2:187994492-187994514 CCATGATTTCTGTTTCAATGAGG + Intergenic
945559047 2:211315416-211315438 CCAACAATTCCATTAAAAAGTGG + Intergenic
1173134700 20:40429114-40429136 CCATCAATGGCGCTTAAAAGTGG + Intergenic
1175356277 20:58371209-58371231 CCATATATTTTATTTAAAAGAGG - Intergenic
1177113792 21:17061154-17061176 CCTTCAATTCTGCTTCTAAGTGG - Intergenic
1177371225 21:20206345-20206367 CCATAAATTTTATTTAAAACTGG - Intergenic
1178388873 21:32182157-32182179 CCATCAATTCTGATTGATAGTGG + Intergenic
1179611334 21:42553417-42553439 CCATTAATTATCTTCAAAAGGGG + Intronic
1182343147 22:29640736-29640758 CCCTAAATTCTTTTTAAAAAAGG + Intronic
1183487834 22:38098914-38098936 CCATAAATTCTGTATACAACTGG - Intronic
949295379 3:2515839-2515861 CCATCTATTCCATTTAACAGTGG - Intronic
950824688 3:15805922-15805944 ACATCACTTCCGTTTCAAAGTGG + Intronic
953141989 3:40237641-40237663 CAAGCAGTTCTTTTTAAAAGGGG - Intronic
957459051 3:80493905-80493927 CCACAAATTATTTTTAAAAGAGG + Intergenic
958435645 3:94092559-94092581 GCATCAATTTTGTTGAGAAGAGG - Intronic
958605622 3:96355132-96355154 CCATAAATTTTTTTTATAAGTGG + Intergenic
959483504 3:106901467-106901489 CTATCAGTTCTGTTAATAAGTGG + Intergenic
960227809 3:115187131-115187153 CCATCAAACTTGTTTAAAAAAGG + Intergenic
960461945 3:117946767-117946789 TCATGCATTCTGTTTAATAGAGG + Intergenic
961602801 3:128073986-128074008 CTACCATTTGTGTTTAAAAGGGG + Intronic
963388516 3:144627699-144627721 TCAATAAATCTGTTTAAAAGAGG + Intergenic
964132538 3:153306043-153306065 CAATCAGCTCTGTTTATAAGGGG - Intergenic
964149161 3:153503256-153503278 CCATGCTTTCTGTTTTAAAGGGG + Intergenic
964737105 3:159928527-159928549 CCATCAATTCTGTAAAGCAGGGG - Intergenic
965204760 3:165707472-165707494 TCATCACTACTTTTTAAAAGCGG + Intergenic
967007897 3:185401625-185401647 ACATCAATTATTTTAAAAAGAGG - Intronic
967555568 3:190853483-190853505 TCATAAATTATTTTTAAAAGTGG + Exonic
967568875 3:191003891-191003913 CCATTAATGCTGATTAAAACAGG + Intergenic
967766845 3:193290353-193290375 CCAGAAATTGTGTGTAAAAGAGG + Intronic
971350653 4:25852886-25852908 CCTGGCATTCTGTTTAAAAGAGG - Intronic
973272638 4:48277252-48277274 CCATCTATTCTGCTGAACAGAGG - Intergenic
974085665 4:57258027-57258049 CCAACAATGCTATTAAAAAGTGG - Intergenic
975534329 4:75433569-75433591 CCATCACTGCTGTTTCTAAGTGG + Intergenic
975815419 4:78211678-78211700 ACAACAATTTTTTTTAAAAGAGG - Intronic
975834892 4:78412214-78412236 CTATCAATTCTGAGAAAAAGAGG - Intronic
975967230 4:79987934-79987956 CTATCAGTTATGTTTACAAGAGG + Intronic
976913340 4:90337114-90337136 CCATCAATTATGTTTGTAAAAGG + Intronic
976952228 4:90848270-90848292 CCATCAATTCCATGTAAAATTGG + Intronic
977053182 4:92156009-92156031 CTATCAATTCTGTTCAACATAGG - Intergenic
977528460 4:98172496-98172518 CCATCAACTTTGTGTTAAAGTGG - Intergenic
978287659 4:107098031-107098053 CCATCAATTTTGTTTGTAAAAGG + Intronic
979042805 4:115819464-115819486 CTATTAATTCAGTTTAAAAATGG - Intergenic
979618524 4:122771950-122771972 CCAGCAACTCTGTCTAAAACGGG + Intergenic
980136049 4:128859716-128859738 CCATAATTAATGTTTAAAAGAGG + Intronic
983873870 4:172853424-172853446 CCATCCAGACTGTTTTAAAGAGG - Intronic
986803195 5:11282679-11282701 CAATTAATTCTGATAAAAAGTGG + Intronic
987437870 5:17919381-17919403 CCATCAATTCTATTTCAACTTGG - Intergenic
988355300 5:30166114-30166136 CCATCAATTATATTTACAAGTGG + Intergenic
988382993 5:30523426-30523448 CCATGAATTTTGTACAAAAGTGG + Intergenic
988960376 5:36364866-36364888 CTCTCAATTCTGTTTTAAAAAGG + Intergenic
989798125 5:45500602-45500624 CCATAATATCTGTTTAAAATTGG + Intronic
991109137 5:62878711-62878733 CCATGACTTCTTTTTAAATGTGG - Intergenic
991235710 5:64394340-64394362 CCATCAATGCTGTTTATAAAAGG + Intergenic
992891553 5:81208857-81208879 CCATCAATTCTGTTTAAAAGTGG - Intronic
993029186 5:82684486-82684508 CCATCAATTTTGCTTCAAACTGG - Intergenic
993198739 5:84784287-84784309 GGATCATTTCTGATTAAAAGTGG - Intergenic
993395743 5:87385636-87385658 TCATTGATTATGTTTAAAAGTGG - Intronic
993514109 5:88808300-88808322 TCATGAAGTCTGATTAAAAGTGG - Intronic
993560551 5:89401982-89402004 ACATCATCTCAGTTTAAAAGTGG - Intergenic
995431333 5:112081392-112081414 TCCTCAATTCTGTTTGTAAGAGG - Intergenic
995515077 5:112946363-112946385 CTAATAATTCTGTTTAAAAATGG + Intergenic
996350986 5:122541359-122541381 CAAACAATTCTGTATAAAATGGG + Intergenic
997221034 5:132164663-132164685 CCAACAACTCAATTTAAAAGTGG - Intergenic
997921475 5:137983444-137983466 CCAGCAATTCTATTTATAAAGGG + Intronic
1002976362 6:2081783-2081805 CCATCATTTCTGTTCTAATGAGG + Intronic
1003351492 6:5321717-5321739 CAATCAAATCTGGTTAAATGTGG + Intronic
1004637727 6:17485165-17485187 CCATCAGTACTGTTTATAACAGG - Intronic
1005448099 6:25946172-25946194 CCAACAATTCATTTAAAAAGTGG - Intergenic
1008269893 6:49479292-49479314 CCAACAATCCTATTAAAAAGTGG + Intronic
1008481549 6:51991170-51991192 CCAAGAAATCTGTTTAAAAATGG + Intronic
1008914183 6:56769107-56769129 CAAACAACTCAGTTTAAAAGTGG + Intronic
1008936557 6:56998951-56998973 CAAATAATTCTGTTTAAAAATGG + Intronic
1009573947 6:65428115-65428137 CCATTATTGCTGTATAAAAGAGG - Intronic
1009646708 6:66412826-66412848 CCAAGAATTTTGTTTAGAAGAGG + Intergenic
1009740267 6:67734552-67734574 CCATCCACTCTGCTAAAAAGGGG - Intergenic
1013125472 6:107180127-107180149 CCATTAAAACTGTTTTAAAGTGG - Intronic
1014392962 6:120886903-120886925 AAATAAATTCTTTTTAAAAGCGG - Intergenic
1014743900 6:125177158-125177180 CCATCAAGTCTGATCAAGAGTGG - Intronic
1014794660 6:125710706-125710728 CCCTTCCTTCTGTTTAAAAGAGG + Intergenic
1014984105 6:127981153-127981175 CCATCAATTGTAATTAAAAAAGG + Exonic
1015040978 6:128718475-128718497 CCATCATTTGTATTAAAAAGAGG - Intergenic
1015122428 6:129714095-129714117 TCATTCATTCTGTTTAAATGAGG + Intergenic
1015853573 6:137599759-137599781 CCAGCAATTCTTTTTCAAAAAGG - Intergenic
1016545467 6:145218282-145218304 CTATCCATGCTGTTTGAAAGTGG + Intergenic
1017697584 6:157032826-157032848 CCATCAGTTTTTTTTAAAAAAGG - Intronic
1018660632 6:166083338-166083360 CAATTAATTCAATTTAAAAGTGG + Intergenic
1022210722 7:28206458-28206480 CCAACAATTCTATGTAAAAGTGG - Intergenic
1023064559 7:36364448-36364470 CTATCTATGCTGTTTAAAAATGG - Intronic
1023235667 7:38083420-38083442 CAATCAATGTTTTTTAAAAGAGG - Intergenic
1023486652 7:40694786-40694808 CCATGATGTCTTTTTAAAAGAGG - Intronic
1028286160 7:89003869-89003891 ATGTCAATTATGTTTAAAAGTGG + Intronic
1030858530 7:114592763-114592785 CATTCAATTATGTTTAAAATTGG + Intronic
1031023933 7:116659940-116659962 CCAACAATTCCATTAAAAAGTGG - Intergenic
1034987483 7:155525507-155525529 CCAAATATTCTGTTTAAGAGGGG - Intronic
1035560226 8:598664-598686 TCATCACTTGTGGTTAAAAGTGG - Intergenic
1038525741 8:28271627-28271649 CCAGCAAGGCTGTTGAAAAGAGG - Intergenic
1039365075 8:36920604-36920626 CCATCCATTCTGTACCAAAGTGG - Intronic
1040755914 8:50773681-50773703 CCATAATTTTTGTTTAAAACTGG - Intronic
1041594698 8:59634771-59634793 CCATCAATGATGTTTAAATGTGG - Intergenic
1042749112 8:72138765-72138787 TCATCAATTCTGTGTAAAGGAGG + Intergenic
1043213959 8:77561324-77561346 CTTGCAATTCTATTTAAAAGTGG - Intergenic
1043916146 8:85924715-85924737 ACATCAAATATGTTTAAAATTGG + Intergenic
1044025310 8:87162925-87162947 CTATCAAGTCTTTTTATAAGGGG - Intronic
1044050066 8:87490233-87490255 ATTTCAATTCTGTTTGAAAGAGG - Intronic
1045747291 8:105438413-105438435 GTATCACTTCTGTTTAACAGAGG + Intronic
1048169289 8:132090120-132090142 CCATCAGTTCCTTTAAAAAGGGG - Intronic
1050928123 9:11291554-11291576 CAAACAATCCTGTTAAAAAGTGG - Intergenic
1051092006 9:13420864-13420886 CCTTCTATTATGTTTAAATGAGG - Intergenic
1051493513 9:17693427-17693449 CCATTACTTCTGTGTAAAATAGG + Intronic
1052252945 9:26421423-26421445 CCACAAATTCTTTTTAAAATGGG + Intergenic
1052292283 9:26856110-26856132 CCAGTAATTTTTTTTAAAAGGGG + Intronic
1052343671 9:27387131-27387153 CCTTTCATTCTGTTTAAAGGAGG - Intronic
1053513474 9:38709350-38709372 CTATCAATTCTGTTCAAAGAGGG - Intergenic
1056079644 9:83078365-83078387 GCCTCATTTCTGTTTAATAGAGG - Intergenic
1058769732 9:108218657-108218679 CAAACAATTCTATTAAAAAGTGG + Intergenic
1189224369 X:39400278-39400300 ACATCAATCCTATCTAAAAGGGG - Intergenic
1189236577 X:39491674-39491696 CCATAAAAGCTGTTCAAAAGCGG - Intergenic
1192254370 X:69443183-69443205 GCATCAACCCTGTGTAAAAGGGG - Intergenic
1196516735 X:116622253-116622275 CTTTCAATTCTGCTTAAATGAGG + Intergenic
1197007744 X:121523165-121523187 CAAACAACCCTGTTTAAAAGTGG + Intergenic
1197773175 X:130103346-130103368 CAAACAATTCAGTTTAAAAATGG + Intronic
1198444378 X:136696921-136696943 CCTTCAACTCTGTGTAAAAGAGG + Intronic
1200846001 Y:7832793-7832815 CCACCAGTTCAGTTTACAAGAGG - Intergenic