ID: 992891878

View in Genome Browser
Species Human (GRCh38)
Location 5:81211220-81211242
Sequence TTGGGAATACACAGGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992891878_992891886 19 Left 992891878 5:81211220-81211242 CCATGCTGCCTGTGTATTCCCAA 0: 1
1: 1
2: 1
3: 23
4: 230
Right 992891886 5:81211262-81211284 CAACTTTGTGTTTCGCTGCATGG 0: 1
1: 0
2: 0
3: 14
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992891878 Original CRISPR TTGGGAATACACAGGCAGCA TGG (reversed) Intronic
900870346 1:5297755-5297777 TGGGGAATCCCCAGGCAGCAGGG - Intergenic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
902711363 1:18242195-18242217 CTGAGATGACACAGGCAGCATGG + Intronic
903276611 1:22226034-22226056 TGGGGATTAGACAGGCTGCAGGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
906790200 1:48652498-48652520 TGGTGGACACACAGGCAGCAGGG + Intronic
907401324 1:54226611-54226633 TTGGGCACAGACAGACAGCAGGG + Exonic
911117367 1:94259683-94259705 TAGGGACTACAGAGGCAGCATGG + Intronic
911270326 1:95794054-95794076 GTGAGAAGACACAGGCAGAAGGG - Intergenic
911434036 1:97831869-97831891 GTGGGAATACACAGGAAAAATGG + Intronic
913265145 1:117036175-117036197 TTGGGAAGAAACAGGCAGCAAGG - Intronic
913357906 1:117944305-117944327 CTGAGAATAAACAGACAGCAAGG - Intronic
913543521 1:119844131-119844153 TTTGGAAGACAGAGGTAGCAAGG - Intergenic
915277917 1:154802392-154802414 TTGAAAAAACACAGGGAGCAGGG + Intronic
916482945 1:165232047-165232069 TTGGGTATACCCAAGCACCATGG - Intronic
917201973 1:172526599-172526621 TTGTTAATACCCAGGCTGCAAGG - Intergenic
918163253 1:181920428-181920450 TTGGGAATTCCCAGGCAAGATGG + Intergenic
918652931 1:186988093-186988115 TTGGGAATAAAGTGGTAGCATGG - Intronic
919046910 1:192463960-192463982 TTTGTAATACAAAGGCATCAGGG - Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
921095840 1:211886737-211886759 TTAGGAAGACAGAGGCAGGAGGG - Intergenic
921999228 1:221457776-221457798 CTCGGAATACACAGGGAGAAGGG - Intergenic
922986866 1:229872783-229872805 ATGAGAATACCTAGGCAGCAGGG + Intergenic
923096316 1:230777901-230777923 GTGGGAATAGACAGCCAGGAGGG - Intronic
1063034571 10:2273093-2273115 TTTTAAATACACAGGTAGCATGG + Intergenic
1063053244 10:2475955-2475977 AAGGGAACACGCAGGCAGCAGGG - Intergenic
1064608030 10:17064506-17064528 TTGGGATTACCCCAGCAGCATGG - Intronic
1064733876 10:18360789-18360811 TGCTGAATACACAGCCAGCAAGG + Intronic
1065813096 10:29460430-29460452 TAGTGAATACACAGGGAGGATGG + Intronic
1066613568 10:37275388-37275410 TTGGGAAGGCTCAGGCCGCATGG + Intronic
1067225665 10:44374289-44374311 TTCGGACTCCACATGCAGCAGGG - Intronic
1068774668 10:60857007-60857029 ATGGGAAGACACGGCCAGCAGGG - Intergenic
1071747536 10:88438794-88438816 TTGGGAATGCACAGAGACCAAGG - Intronic
1071891960 10:90019055-90019077 TTGGGAATCCAAAGTTAGCAGGG - Intergenic
1072258992 10:93649479-93649501 GTGGATATACACAGGAAGCATGG + Intronic
1073457223 10:103644950-103644972 TTTTGAATGCACATGCAGCAGGG + Intronic
1075336274 10:121611198-121611220 TTGGGCATAGACAGGCGGGAAGG - Intergenic
1076107796 10:127837431-127837453 TTGGGAAAATACAGGGATCAAGG + Intergenic
1076421744 10:130336798-130336820 TGGGGAAAATACAGGCAGCATGG - Intergenic
1076924182 10:133473517-133473539 TTTGGGATCCTCAGGCAGCAGGG - Intergenic
1077598272 11:3553522-3553544 TTCTGAGGACACAGGCAGCAAGG - Intergenic
1081253377 11:40862671-40862693 TTGGGAATACAAGGACATCATGG + Intronic
1081534775 11:43988704-43988726 TTAGGAAGAAACAGGCTGCAGGG + Intergenic
1083901292 11:65644768-65644790 TTGGGAGTGCACAGGTAGGAAGG - Intronic
1084254350 11:67929388-67929410 TTCTGAGGACACAGGCAGCAAGG - Intergenic
1084818522 11:71666495-71666517 TTCTGAGGACACAGGCAGCAAGG + Intergenic
1084901988 11:72316495-72316517 TTGGGTCTGCACAGGCAGGAGGG + Intronic
1090082451 11:123623080-123623102 TTGGGAACACAGAAGCATCAAGG + Intronic
1091386813 12:101207-101229 TGGGCACGACACAGGCAGCAGGG - Intronic
1091901493 12:4147633-4147655 TTGGGAAGACAATGTCAGCAAGG - Intergenic
1092225417 12:6745206-6745228 TTGGGAACATAAAGGCAGGAAGG + Intergenic
1093558455 12:20507888-20507910 TTGTGAATACACAGTGAGGAAGG - Intronic
1096209056 12:49748366-49748388 TTGGGAAGACAGGGACAGCAGGG - Intronic
1096322699 12:50629354-50629376 TTGTTAATACACAGACTGCAGGG + Intronic
1096651123 12:53062426-53062448 CTGGGAATGCGCAGGCAGCAGGG - Exonic
1097548305 12:61032902-61032924 TGGGGAATACTCAGGCAAGAGGG - Intergenic
1101581699 12:106047681-106047703 TTGGGAATATAGAGGAAGCAAGG - Intergenic
1103367687 12:120394957-120394979 TTGGGGATGCAGAGGCAGGAAGG + Intergenic
1103976929 12:124708740-124708762 TTCAGAATACACAAGCAGAAGGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1106819655 13:33450768-33450790 TTGGGAAAACACAGGGAGAGGGG + Intergenic
1107001533 13:35551741-35551763 TTGTGAATACAAAGCCAACAGGG - Intronic
1107332383 13:39315126-39315148 TTGGGCATACACAGGTACAAAGG + Intergenic
1107846592 13:44520492-44520514 TTGGGTATGCAGAGGAAGCATGG + Intronic
1108300094 13:49064825-49064847 TTGGGAAAAAACAGGTTGCAAGG + Intronic
1109923017 13:69093713-69093735 TTGGGAATAGAAATGTAGCAAGG + Intergenic
1110924126 13:81129094-81129116 GTGGGAAAAGACAGACAGCAAGG - Intergenic
1111968051 13:94881019-94881041 TTTCGAATACACTGGCACCAAGG + Intergenic
1113657785 13:112079652-112079674 TTGAGAAACCACAGGCATCACGG - Intergenic
1113679989 13:112236671-112236693 TTCTGAATACACAGGCTGCCTGG + Intergenic
1115346391 14:32347680-32347702 TTGGTATTACAAAGACAGCATGG - Intronic
1117218906 14:53581655-53581677 TAGGGAAAAAACAGGCTGCAAGG - Intergenic
1120672204 14:87375454-87375476 TTGGAAATACCCTGGCAGAAGGG - Intergenic
1121903997 14:97723290-97723312 TGGGGAATGGACAGGGAGCAAGG + Intergenic
1122171579 14:99880394-99880416 GTGGGAATACAGAGGAAGAAAGG - Intronic
1123049027 14:105531760-105531782 ATGGGAACAGACAGGCAGCGTGG + Intergenic
1123488373 15:20760954-20760976 CTGGGAACACACAGCCATCAGGG - Intergenic
1123544870 15:21330027-21330049 CTGGGAACACACAGCCATCAGGG - Intergenic
1124031588 15:26017132-26017154 TTTGGAAAACACAAGCAACACGG + Intergenic
1125796110 15:42405078-42405100 TCTGGAAGACACAGGGAGCAGGG + Intronic
1126383834 15:48074117-48074139 TTGGGAAAATCCAGGGAGCACGG + Intergenic
1127625018 15:60771862-60771884 TTGGAAAAACATAGGTAGCACGG + Intronic
1128058277 15:64717036-64717058 GAGGGAATACACAGGGAACAGGG - Intergenic
1129393167 15:75230731-75230753 TGGGGAAGGCAGAGGCAGCAAGG - Intergenic
1129966617 15:79741955-79741977 TTGGGCACTCACAGGTAGCATGG + Intergenic
1130346201 15:83047898-83047920 GTGGGAAGACACTGGAAGCAAGG + Intronic
1202953216 15_KI270727v1_random:57298-57320 CTGGGAACACACAGCCATCAGGG - Intergenic
1135994640 16:27238791-27238813 TTGGGGATAGGCAGGAAGCATGG - Intronic
1137565677 16:49531173-49531195 CAGGGAATACACAGGCTGCTTGG + Intronic
1141278143 16:82606509-82606531 TATTGAAAACACAGGCAGCAGGG - Intergenic
1144177069 17:12717777-12717799 TGGAGAATACAGAGGTAGCAAGG - Intronic
1146649250 17:34596643-34596665 TTGGGAATAGCCAGGGACCAAGG - Intronic
1147846741 17:43409850-43409872 GTGGGCAGAGACAGGCAGCAGGG - Intergenic
1148380858 17:47195916-47195938 TTGAGAATACACAGGGAACAAGG - Intergenic
1152022282 17:77786484-77786506 TTGGAAAGACATTGGCAGCAAGG - Intergenic
1152445125 17:80338046-80338068 TTGGGAGTACACAGCCCTCACGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1153013109 18:558150-558172 TTTGAAATACACAGGCAGGGGGG - Intergenic
1153689997 18:7582655-7582677 TTGGGAAATCATGGGCAGCATGG + Intronic
1157186192 18:45541856-45541878 TTGGGAACACACAGTAAACAGGG - Intronic
1157487926 18:48101923-48101945 TTGGTATTAGACAGGCAGCTTGG - Intronic
1157766076 18:50298542-50298564 TTGTGGAGACACAGGCAGGAGGG - Intergenic
1157766651 18:50302528-50302550 TTGTGGAGACACAGGCAGGAGGG - Intergenic
1162615813 19:11799323-11799345 TTGGGAAAACACAGGATCCACGG + Intronic
1163889001 19:19994273-19994295 TTGGGGAGAGACAGACAGCATGG - Intergenic
1164903136 19:31945388-31945410 TTGGGAAGCCACAGAGAGCAAGG - Intergenic
1165726081 19:38113948-38113970 TTGAGAGTCCACAGGCTGCAGGG - Intronic
1166210882 19:41305915-41305937 CTGGGAATACACACCCAGGAGGG - Intronic
1167352206 19:48982481-48982503 TAGGTAATACAGAGGCATCACGG + Intronic
1167797141 19:51716860-51716882 TTGGGAACAAAGATGCAGCAGGG - Intronic
925380933 2:3425506-3425528 TTAGGACAACCCAGGCAGCAAGG - Intronic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
926976283 2:18519989-18520011 TTTGGAAGACAGGGGCAGCAAGG + Intergenic
928930062 2:36615293-36615315 TTGGGGAAAAACAGGCTGCAAGG - Intronic
930261659 2:49154091-49154113 TTGGAAAGCCACAGGCAGGAGGG + Intronic
930748827 2:54912605-54912627 TTGGGTACACACAGACAGGAAGG - Intronic
931703896 2:64931120-64931142 TTGGGAATTCATAGGCGACAGGG + Intergenic
932623661 2:73282354-73282376 TAGGGAATTCAAAGGCAGGATGG + Intronic
932929368 2:76015647-76015669 TTAGGAATTCACAGGTTGCAGGG + Intergenic
935225853 2:101052346-101052368 CTGGCAATACAGAGCCAGCAAGG + Intronic
937888286 2:126915414-126915436 TTGGGTATACAGAGGCACCAGGG - Intergenic
938610834 2:132945884-132945906 TTCGTAATACTGAGGCAGCATGG - Intronic
939694059 2:145301868-145301890 TTGGGGATACTAAGGCAGGAGGG + Intergenic
939865816 2:147471300-147471322 AAGGGAACACACAGGAAGCAAGG + Intergenic
942112462 2:172695713-172695735 TTGGGAAAAGACAGGTGGCAAGG + Intergenic
942129082 2:172860189-172860211 ATGGGACTACTCAGGCAACATGG - Intronic
943648935 2:190436289-190436311 TTTGTAATACACAGGCAAAAGGG - Exonic
947070895 2:226287133-226287155 TTGGGAATTCACTGCCAGCTGGG + Intergenic
948883899 2:240873623-240873645 TTGGGAGTTCTCAGGCAGGAAGG + Intronic
1169038830 20:2476138-2476160 TTGGGAATACAGAGAGAGCTGGG + Intronic
1170304482 20:14923147-14923169 TTGGGAAGAAACAGCCAGCGAGG - Intronic
1171278959 20:23880811-23880833 TTGAGAAGCCCCAGGCAGCAGGG + Intergenic
1172596152 20:36152560-36152582 TTGGGAAGGCTCAGCCAGCAGGG + Intronic
1173137250 20:40449431-40449453 TAGGGAATGCATATGCAGCAAGG - Intergenic
1173159212 20:40639838-40639860 TTTGGAACACACTGGCAGCATGG + Intergenic
1173461528 20:43246952-43246974 CTGGGAAGACACAGGCAGTATGG + Intergenic
1173838133 20:46138979-46139001 TTGGGGTTACTCAGGCAGCTTGG + Intergenic
1174208560 20:48858678-48858700 CTGAAAATAGACAGGCAGCAGGG + Intergenic
1176373587 21:6076659-6076681 TTGGAAACCCACAGGCAGTAGGG + Intergenic
1177013232 21:15753351-15753373 TTGGGAAAAAACAGGTGGCAAGG + Intronic
1179749890 21:43461584-43461606 TTGGAAACCCACAGGCAGTAGGG - Intergenic
1179988619 21:44934218-44934240 CTTGGAACACACAGGCAGCCAGG + Intronic
1180222368 21:46367181-46367203 GTGGAAACACACAGGCAGCGAGG - Intronic
1180875742 22:19174529-19174551 TTGGGGGTACAAAGGGAGCACGG - Intergenic
1181439989 22:22930801-22930823 TGGGGAGACCACAGGCAGCAGGG + Intergenic
1182041071 22:27239432-27239454 TTGGGAGGCCACAGACAGCAAGG - Intergenic
1182055656 22:27352588-27352610 TTGGGAATAAACACACAGCAGGG + Intergenic
1183155670 22:36073017-36073039 TTGGGTACAGACAGACAGCAGGG - Intergenic
1184590136 22:45476506-45476528 ATGGGAACCAACAGGCAGCATGG + Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949127752 3:466822-466844 ATGGAAATACAGAGCCAGCAAGG - Intergenic
949867426 3:8557922-8557944 CTGGGAAGACACACACAGCAGGG + Intronic
950752177 3:15138344-15138366 TTCTGAGGACACAGGCAGCAAGG + Intergenic
950918052 3:16665457-16665479 TTGGAAAAAAACAGGCTGCAGGG - Intronic
951937573 3:28038581-28038603 TTGAGACTTCACAGGCAACAAGG + Intergenic
952958846 3:38577198-38577220 CGGGCAACACACAGGCAGCAAGG + Intronic
953042682 3:39268935-39268957 ATGGGAGTCCACAGGCAGCCTGG - Intronic
953617798 3:44507659-44507681 TTAGGAAGAAACAGGCTGCAGGG + Intronic
954041452 3:47890977-47890999 TTGGGAACAAGCAGACAGCAAGG - Intronic
954699042 3:52442112-52442134 ATGGGAATGTTCAGGCAGCAGGG + Intronic
955664349 3:61334820-61334842 TTGGGAAAAAATAGGCTGCAAGG - Intergenic
960576201 3:119232513-119232535 TTGGGACTACCCAGGCACCAAGG - Intronic
961359888 3:126360454-126360476 TAGGGAATAGGCAGGCAGAAGGG + Intergenic
962493195 3:135914031-135914053 TTGGGAATGAACAGGCAGGAAGG - Intergenic
963079841 3:141381040-141381062 TTGGCAAAACACATTCAGCAAGG - Intronic
965779822 3:172273423-172273445 CGGGGAATATACAGGGAGCAGGG - Intronic
965784901 3:172325098-172325120 CTGGTCACACACAGGCAGCAGGG - Intronic
966670536 3:182521180-182521202 GTGGGAAGACAAAGGCAGGATGG - Intergenic
966685173 3:182685425-182685447 TTGAGAATAGCCAGGCAACATGG + Intergenic
968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG + Intronic
972048618 4:34700734-34700756 TTGAAAATACACAGTCAGAAAGG + Intergenic
972356166 4:38280977-38280999 ATGGGAAGTCGCAGGCAGCAGGG + Intergenic
972494302 4:39618925-39618947 TTGGGCATAAAATGGCAGCAGGG + Intronic
973978757 4:56288417-56288439 TTGGGAACACACAGACATTAGGG - Intronic
977979943 4:103309568-103309590 CTGGGAATACAAAGGCAGTCGGG + Intergenic
981240740 4:142473738-142473760 TTGGAAGTACCCAGACAGCAGGG + Intronic
982147325 4:152409512-152409534 CTGGGAATACTCTGGCAGAAGGG + Intronic
982758382 4:159251231-159251253 TCGGGAAGGCTCAGGCAGCACGG - Intronic
984001769 4:174255128-174255150 TTGGGAATACACAGTTAAAAAGG - Intronic
988268128 5:28978217-28978239 TTAGGAATACACAGGGGACAAGG - Intergenic
989213113 5:38877266-38877288 TTGGGTACACACATACAGCATGG + Intronic
990409250 5:55524431-55524453 TGGCGATTAAACAGGCAGCAAGG - Intronic
990954682 5:61331078-61331100 TTGTGAGTACACACGCCGCAGGG - Intergenic
991147488 5:63323916-63323938 TTGGGAAAAAACAGGCTGCAAGG - Intergenic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
994845623 5:104985716-104985738 TTGAAAATACACAGTCAGGATGG - Intergenic
998190679 5:140021667-140021689 TCCTGAATACACAGGCAACAAGG + Intronic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
1000383656 5:160652040-160652062 GTGTGATTAAACAGGCAGCAGGG - Intronic
1001561134 5:172669760-172669782 GCGGAAAGACACAGGCAGCACGG - Intronic
1001924046 5:175623307-175623329 TTGGGGAAAAACAGGCTGCAAGG - Intergenic
1002275374 5:178101077-178101099 TTGGGAAGAGACTGGCAACATGG + Intergenic
1002914650 6:1519134-1519156 TTGGGAATAGCCAGGCGTCATGG + Intergenic
1004886512 6:20056440-20056462 TTGAGAATAAAGAGGGAGCATGG + Intergenic
1005151300 6:22754333-22754355 TTACAAAAACACAGGCAGCAGGG - Intergenic
1006082470 6:31575356-31575378 TTGGGGACACACAAGCATCAAGG - Intergenic
1007328155 6:41079654-41079676 TTAGGAATAAACCAGCAGCAGGG - Intronic
1007843504 6:44735700-44735722 TTGGGAAAACACAGGCATGGAGG + Intergenic
1008504232 6:52213599-52213621 TTGGGAAGACAAAGGTAGAAAGG + Intergenic
1011681653 6:89789220-89789242 TTCAGAATACAAAGGCAACATGG + Intronic
1013924864 6:115459709-115459731 TTTGGAATAATCAGGCAGCCAGG + Intergenic
1016178277 6:141108092-141108114 TGGGGGATACAAAGACAGCAAGG - Intergenic
1016896462 6:149059063-149059085 TTCGGTAAATACAGGCAGCAGGG + Intronic
1017156930 6:151330876-151330898 TGGGGAACACATAGCCAGCAGGG + Intronic
1018105412 6:160481776-160481798 TTGGGATTACTCAGGTAGCTAGG - Intergenic
1018115145 6:160575921-160575943 TTGGGATTACAAAGGCAGCTGGG - Intronic
1019595578 7:1856882-1856904 CTGGGGACACACAGGCAGCGAGG - Intronic
1021054813 7:16034720-16034742 TTAGGAAGAAACAGGCTGCAGGG + Intergenic
1022803490 7:33798453-33798475 TTGGGAAGTCAAAGGCAGCACGG + Intergenic
1022857495 7:34329802-34329824 GAGGGAATACACATGGAGCATGG + Intergenic
1022999470 7:35793218-35793240 CTGGTAATAGACTGGCAGCACGG - Intergenic
1023685511 7:42730478-42730500 TTGGCAATACACAGGCAGCAAGG - Intergenic
1024521499 7:50308629-50308651 TTAGGAAAACACAGACAGGAAGG - Intronic
1024587461 7:50854321-50854343 TAGGGGATAGACAGGAAGCAAGG + Intergenic
1026560685 7:71445612-71445634 TTGGGAAGAAACAGGCTGCAAGG + Intronic
1029797672 7:102912026-102912048 TGGGAAATACAGGGGCAGCATGG - Intronic
1032348156 7:131135997-131136019 GTGGGATTACTCAGGCAGTAGGG + Intronic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035457939 7:159021391-159021413 TTGGGAATACAGAGGCAGACTGG - Intergenic
1036661941 8:10714580-10714602 CTCGGGAGACACAGGCAGCAGGG + Intergenic
1036710977 8:11078432-11078454 TGGGGAACACACAGGCAGAATGG - Intronic
1037710258 8:21349667-21349689 TTATGTATAGACAGGCAGCAAGG - Intergenic
1037743685 8:21627035-21627057 CTGTGAATACACTGGCTGCATGG - Intergenic
1038057751 8:23876987-23877009 TTGGGAAATCACGGGCAGAAGGG + Intergenic
1038128435 8:24700839-24700861 TTGGGAGGCCACAGACAGCAAGG - Intergenic
1039135699 8:34320710-34320732 TTAATTATACACAGGCAGCAAGG - Intergenic
1042155074 8:65836085-65836107 TTGAGAATACACAGGTAGGAAGG + Intronic
1044544924 8:93448964-93448986 TATGGAATACACAGACAGAAAGG + Intergenic
1046241312 8:111498099-111498121 TTGGAAATACACAATCACCATGG + Intergenic
1050632934 9:7579814-7579836 TTGGAAATACACAGGGACCCAGG + Intergenic
1052437637 9:28449008-28449030 ATGTGAATACATAGGCAGAATGG - Intronic
1053514770 9:38721578-38721600 TTGGGAAGACAGAGGCCGCATGG + Intergenic
1056200883 9:84275356-84275378 GTGGGAAGACACAGGCGGCTAGG + Intergenic
1056346356 9:85699635-85699657 TTAGGATTACACAGGATGCATGG + Intronic
1056409835 9:86314111-86314133 TTGGGATTGCACAGCCAGCAAGG + Intronic
1057246450 9:93459149-93459171 CTGGGAATACACACACAGCATGG + Intronic
1058899817 9:109432323-109432345 TTGGCAAAACAGTGGCAGCAAGG - Intronic
1061524987 9:131153016-131153038 TTGGGATTACAAAGACAGGAGGG - Intronic
1061561254 9:131405325-131405347 TTGGAAGAAAACAGGCAGCAAGG - Intronic
1061728502 9:132595036-132595058 TTCGGAATACTCAAGCGGCATGG - Exonic
1062003662 9:134228936-134228958 TTGGGCATGCACAGGAGGCAGGG - Intergenic
1062128429 9:134879565-134879587 TGGGGAAGACACAGGCTCCATGG - Intergenic
1062158580 9:135067447-135067469 TGGGGAAGACACACGCGGCAGGG + Intergenic
1062710782 9:137974105-137974127 AGGGGAATACACAAGCAGCTTGG - Intronic
1186205107 X:7192201-7192223 CTGGGAACACACTGCCAGCATGG - Intergenic
1189726642 X:43973844-43973866 TTGGAAATACAAAGGCAGTGTGG + Intergenic
1190130416 X:47743135-47743157 TTGTGAATACACACGCTACATGG - Intergenic
1192775618 X:74241252-74241274 TTGGGAATGCACTGGGACCAGGG + Intergenic
1192993544 X:76488145-76488167 TTGAGTCTACAGAGGCAGCATGG + Intergenic
1194462457 X:94188675-94188697 TTTAAAATACACAGACAGCAAGG - Intergenic
1194879422 X:99232751-99232773 TTGGGAATACACAGAAAATATGG - Intergenic
1196276485 X:113771774-113771796 TTGGGGATACAGAGGTAGTATGG - Intergenic
1197633141 X:128885273-128885295 TTGTGAACACACAGGCTCCAGGG + Intergenic
1197809307 X:130427386-130427408 CTTGGAACACAGAGGCAGCATGG + Intergenic
1198550855 X:137743555-137743577 GTGGGAATAGCCAAGCAGCAGGG + Intergenic
1200901800 Y:8440167-8440189 TTGTGGATACCCAGGCAGGAAGG + Intergenic