ID: 992892149

View in Genome Browser
Species Human (GRCh38)
Location 5:81213397-81213419
Sequence CTTCTATTCTCTGGCACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992892149_992892153 -10 Left 992892149 5:81213397-81213419 CCATTGGTGCCAGAGAATAGAAG 0: 1
1: 0
2: 0
3: 13
4: 181
Right 992892153 5:81213410-81213432 AGAATAGAAGGGTCTACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992892149 Original CRISPR CTTCTATTCTCTGGCACCAA TGG (reversed) Intronic
902875006 1:19335758-19335780 CTTCTGTTAGTTGGCACCAAGGG + Intergenic
905876757 1:41436351-41436373 ATTCTGTTCTCTGGCACCAGTGG - Intergenic
905876891 1:41437371-41437393 ATTCTGTTCTATGGCACCAGTGG + Intergenic
906670299 1:47649400-47649422 CTTTTATTCTTATGCACCAAAGG + Intergenic
908079677 1:60562745-60562767 CTTCTTCTCTCTGGCAGAAATGG - Intergenic
908644836 1:66266016-66266038 CTTCTTTTCTCTGTCTCCACAGG + Exonic
909196245 1:72628168-72628190 CTTCTATTCTCTGGGAGCACTGG + Intergenic
910557897 1:88556964-88556986 TTTCTATTCTCTGCTACTAAAGG + Intergenic
911683405 1:100745531-100745553 CTTCTAGTCACTGTAACCAAAGG - Intergenic
911809318 1:102253667-102253689 CTTCTATGCAATGGCTCCAATGG + Intergenic
911977923 1:104525440-104525462 CTTCTATTCTCTTTCATCACAGG - Intergenic
912598688 1:110904716-110904738 CTTCTATGCTCGGACACTAAAGG + Intergenic
914929573 1:151919099-151919121 CTTCAGTTCTCTGACACCAATGG + Intergenic
914981787 1:152421260-152421282 CTTTAATTCTCTGGCACTACTGG - Intergenic
915083634 1:153369404-153369426 CTGCTACTCTTTAGCACCAAGGG + Intergenic
917587523 1:176442849-176442871 CTTTTATTCTCTTTCTCCAAGGG + Intergenic
918197404 1:182235058-182235080 CTAGGTTTCTCTGGCACCAAAGG - Intergenic
918916580 1:190648052-190648074 CTTCTCTTGTCTGCCACCACAGG + Intergenic
920903435 1:210135486-210135508 CTTCTATTGTCTTGAACCATGGG + Intronic
921303603 1:213773252-213773274 CTCCCATTCTCTCGCTCCAAAGG - Intergenic
921760613 1:218909603-218909625 CTTCTGTTCTTTGCAACCAAGGG - Intergenic
922909625 1:229204758-229204780 TTTCTCTTCTCTGGCACATATGG + Intergenic
923502091 1:234573504-234573526 CTTCTATTTTCTGTAACAAATGG + Intergenic
924620137 1:245653227-245653249 CTTCTATTCACTTCCTCCAAGGG - Intronic
1066401751 10:35083573-35083595 CTTCTATTTTCTGACATCATAGG - Intronic
1069881413 10:71596049-71596071 CTGGTTTTCCCTGGCACCAAGGG + Intronic
1071980435 10:90999635-90999657 TTTCTATTTTCTGGCACACAAGG + Intergenic
1073832474 10:107401641-107401663 CTTCTATTCTCTATCTCCATGGG + Intergenic
1077555303 11:3223085-3223107 CTTCTGTCCTCTGTAACCAAGGG + Intergenic
1077852024 11:6082396-6082418 CTTGTATTCTCTGTGACCACAGG - Intergenic
1078559656 11:12359683-12359705 CTTCTCTTCTTTGGCCCCCATGG - Intergenic
1081527433 11:43936477-43936499 CTTCTACACACTGGCACCCAGGG + Intronic
1081527439 11:43936506-43936528 CTTCTACACACTGGCACCCAGGG + Intronic
1081527445 11:43936535-43936557 CTTCTACACACTGGCACCCAGGG + Intronic
1081527451 11:43936564-43936586 CTTCTACACACTGGCACCCAGGG + Intronic
1083095350 11:60244809-60244831 TTTCTATTCTCTAGCAAAAAGGG - Intergenic
1085773507 11:79345174-79345196 ATTCTATTCTCTGAACCCAAAGG + Intronic
1086181958 11:83962978-83963000 CATCTACTCTCTGGCAACAATGG - Exonic
1086562744 11:88187078-88187100 CTTCTCTTGTCTGCCACCATGGG + Intergenic
1087532345 11:99400202-99400224 CTTCTACTCTCTATCTCCAAGGG + Intronic
1087674573 11:101145252-101145274 CTTCTAGTCTCTAGCACTATCGG - Intergenic
1090083802 11:123633384-123633406 CTTCCATTCTCTTGCAGTAATGG + Exonic
1090838548 11:130471080-130471102 CTTCTATGTGCTGGCACCCAAGG + Exonic
1097410714 12:59249195-59249217 CTCCACTACTCTGGCACCAAAGG + Intergenic
1097477409 12:60075233-60075255 GTTCTCTTCTTTGGCACCAGTGG + Intergenic
1098082994 12:66809522-66809544 ACTCTGTTCTCTGGCACTAATGG + Intergenic
1099524490 12:83702940-83702962 ATTCTATTCTCTAGCTCCATGGG - Intergenic
1100858686 12:98781489-98781511 CTTCTTTTCCCTGACACTAAAGG + Intronic
1101219761 12:102626325-102626347 ATTCTACTCTCTGCCTCCAAGGG - Intergenic
1101286781 12:103322230-103322252 CTTCCCTTCTCTGGCTGCAATGG + Intronic
1104443490 12:128814484-128814506 CCTTTATAATCTGGCACCAAAGG + Intronic
1108589186 13:51897051-51897073 CCTTTGTTCTCTGGCACCACAGG + Intergenic
1110175421 13:72550041-72550063 GTTCTATTCTCTGGAAACAGCGG - Intergenic
1111072432 13:83186813-83186835 CTTCTCTTGTCTGCCACCATGGG + Intergenic
1111714011 13:91854581-91854603 CTTCTATTCTCTATCTCCATGGG + Intronic
1112594151 13:100792511-100792533 CTTCTCTTTTCTGCCACCACAGG + Intergenic
1115519399 14:34218241-34218263 CTTCTATTCTCTCGTAACAGTGG - Intronic
1115635485 14:35286833-35286855 CTTCTACCCTCTGGAACCAATGG - Intronic
1115964330 14:38870201-38870223 TTTCTTTTCTCAGCCACCAATGG - Intergenic
1118917233 14:70117816-70117838 CCTCTACTGTCTGGCACCAGGGG - Intronic
1119157863 14:72428100-72428122 CATCTGTTCTCTGGCTCCATTGG - Intronic
1119945242 14:78686502-78686524 CTCTTATTCTCTCTCACCAATGG - Intronic
1120072360 14:80117953-80117975 CTTCTATTCTCTAGCATGCATGG + Intergenic
1120393684 14:83941164-83941186 CTAATATTCTTTGTCACCAAAGG - Intergenic
1120537936 14:85720316-85720338 CCTCTATTCTCTGACACCTCAGG + Intergenic
1125007802 15:34837728-34837750 CATCTATCCTTTGGCACCACTGG - Intergenic
1125476545 15:40051572-40051594 CAACTATTCTCTGACACCAACGG + Intergenic
1128671918 15:69580144-69580166 CATCTGTTGTCTGGCAGCAACGG + Intergenic
1130199531 15:81812057-81812079 CTTCATTTCTCTGGCAGCACTGG - Intergenic
1130931233 15:88429494-88429516 CTGCTCTTCTCTGGGACAAAGGG + Intergenic
1131504622 15:93005570-93005592 CTTCCATCCTGTGGCAGCAAAGG + Intronic
1135107760 16:19665361-19665383 CTTCTACTCTCTGTCTCCATGGG + Intronic
1137760309 16:50935064-50935086 CTTCTTTTCTTGGGCACCAAGGG + Intergenic
1138035865 16:53605390-53605412 CTTCTTTTTGCTGGCTCCAAGGG - Intronic
1142260734 16:89041435-89041457 CTCCTTTTCTCTGACACCACAGG + Intergenic
1142685905 17:1576802-1576824 CCACCCTTCTCTGGCACCAACGG - Intronic
1146483657 17:33225819-33225841 TTTGTGTTCCCTGGCACCAAAGG + Intronic
1147195598 17:38764558-38764580 ATTCTAAGCTCTGGCATCAATGG - Intergenic
1147422147 17:40327197-40327219 TTTCTCTTCTCTGGGAGCAAGGG + Intronic
1148446936 17:47743532-47743554 CATCTATTCCCTGGGACCACAGG - Intronic
1151958949 17:77394931-77394953 CTCCTATTCTCAAGCACCTACGG - Intronic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1152681787 17:81672191-81672213 CTTCTGTTCCCTGGCAGCACTGG - Intronic
1155128105 18:22900871-22900893 CTTGTGATCTCTGGCAACAAAGG - Intronic
1161371472 19:3914323-3914345 CTTCTCTTCTCTGCCGCCATGGG - Intronic
1162042177 19:7977676-7977698 CTTCTCCACTCTGCCACCAAGGG + Intronic
925122295 2:1428592-1428614 CTTCTTTTGCCTGGCACCCATGG - Intronic
925529516 2:4843802-4843824 CTTCTTGTCTCTGACAACAATGG - Intergenic
928042084 2:27888931-27888953 ATTTTATGCTCTGTCACCAAAGG + Intronic
928555635 2:32421679-32421701 ATTATATTCTCTGACAGCAATGG - Intronic
929664839 2:43825953-43825975 CTCCAATTCTCTAGCACTAACGG + Intronic
931692971 2:64850983-64851005 CTTCCACTCTCTGGCAACATAGG + Intergenic
933527306 2:83458009-83458031 CTTTTATTCTCTGGCAGAAAGGG + Intergenic
935953822 2:108354841-108354863 CTCCCAATTTCTGGCACCAATGG + Intergenic
936660596 2:114538764-114538786 CTTCTTGTCACTGCCACCAAAGG + Intronic
938639946 2:133267166-133267188 CTTCTATTGTCTGCCCCTAACGG + Intronic
938902684 2:135811299-135811321 GTTATATTCACTGGCACCACGGG - Intronic
939019261 2:136939621-136939643 CTTCTTTTCTCTCTGACCAATGG + Intronic
943880420 2:193137538-193137560 CTTCTCTTGTCTGACACCATGGG + Intergenic
944189134 2:196982665-196982687 CTTGGATTGTCTGGCAACAAGGG - Intronic
944362589 2:198875733-198875755 CTTCTGTTATCTGCCACCAAAGG + Intergenic
945436596 2:209825668-209825690 CTTATATTCTCTAGCAACAGAGG + Intronic
945978896 2:216292765-216292787 TTTCTATTCGCTGGCCCCATTGG - Intronic
946618048 2:221530708-221530730 ATTCTGTTCTCTGGCTCCATGGG + Intronic
948655752 2:239475846-239475868 CTTCTGCTCTGTGGCAGCAAGGG + Intergenic
1169774823 20:9241010-9241032 CTTCAATTCTCTGTCTCCAATGG + Intronic
1174166309 20:48586012-48586034 CTTCTATGCTTTCCCACCAAAGG - Intergenic
1174807033 20:53613288-53613310 CTTCTATTATCTGGAACACAAGG + Intergenic
1177903244 21:26943477-26943499 CTTATCTTCTGTGGAACCAAAGG + Exonic
1181858419 22:25799505-25799527 GTTCTATGCTCTGGGCCCAAAGG - Intronic
1182100363 22:27653530-27653552 CTTCTACTCTCTGTCTCCATGGG - Intergenic
1182908669 22:33960763-33960785 CTTCTAATCTCTGTCTCCACGGG + Intergenic
1183675779 22:39298147-39298169 CTTCTATCCTCTGGGACAATGGG - Intergenic
950677174 3:14561344-14561366 CTGCTATTCTCTGGCCTCCATGG + Intergenic
952362403 3:32643932-32643954 CTTCTATTTTTTAGCACCATGGG + Intergenic
953546085 3:43864511-43864533 TTTCTATTCTCTGGACCCAGAGG + Intergenic
956606719 3:71080447-71080469 CTCCTATTCTCTGTCTCCATAGG - Intronic
956994287 3:74806238-74806260 CTTCATTTCTCTTGCTCCAAAGG - Intergenic
960052276 3:113250377-113250399 CATCTACTCTCTGGGAACAAAGG + Intronic
962197324 3:133375646-133375668 CCTCTCTTCTTTGGCACAAAAGG - Intronic
962455985 3:135566173-135566195 CTTCTCTTCACTGACCCCAAAGG - Intergenic
963230277 3:142902574-142902596 CTTCTCTTCTCTTTCTCCAAGGG + Intergenic
964415886 3:156446983-156447005 CTTCTCTTCTCTGGCCACACTGG + Intronic
964490739 3:157233228-157233250 TTTCCATTCTCTGGCTCCATTGG - Intergenic
965897081 3:173591661-173591683 CAGCTATTCTCTGGCAACAAGGG + Intronic
966087067 3:176080602-176080624 CTTCTTTCCTCTGGCAGAAAAGG + Intergenic
966096308 3:176207587-176207609 CTTCTATTCTATGAAAACAAAGG - Intergenic
966238171 3:177725967-177725989 CTTCTTTTCTTTGGCATTAAGGG + Intergenic
967805747 3:193713346-193713368 CTTCCAAGCTCTGGCATCAAAGG + Intergenic
972811961 4:42599327-42599349 CTACTCTTTTCTGGCACCTATGG - Intronic
974206650 4:58711855-58711877 CTTCTATTCTCTTATACCAGTGG - Intergenic
974514854 4:62896724-62896746 CATTTATTGTCTGGCACAAAAGG + Intergenic
975921678 4:79398228-79398250 CTTCTAATCTCTGGCACTGTTGG - Intergenic
976479144 4:85519233-85519255 CTACTAATGTGTGGCACCAAAGG - Intronic
978117669 4:105040882-105040904 CTTCTATTCTCTATCTCCATGGG - Intergenic
979056526 4:116001136-116001158 TTTCTATCTTCTGGTACCAAGGG - Intergenic
983354034 4:166632635-166632657 CTTCTATTGTCTGGAAGAAATGG + Intergenic
987477841 5:18414315-18414337 CTTCTATTCTCTTGTATAAACGG + Intergenic
987933819 5:24436986-24437008 AATCTATTCTCGGGCACCATGGG - Intergenic
988840183 5:35075602-35075624 CAGCTATTCTCTGGCCCCAGAGG - Intronic
990493367 5:56322833-56322855 CTTCTCTCCTCTGGCCCCAGTGG + Intergenic
992137365 5:73760912-73760934 CTACTTTTGTCTGGCAACAATGG + Intronic
992892149 5:81213397-81213419 CTTCTATTCTCTGGCACCAATGG - Intronic
993399511 5:87431601-87431623 CTTCTATACACTGCCACCAGAGG + Intergenic
993814324 5:92522509-92522531 CTTCTACTCTCTGGTCCCCAGGG - Intergenic
1000487079 5:161860439-161860461 CTTCTACTCTCTGTCTCCATGGG - Intronic
1003050242 6:2774048-2774070 TTTCTATTCAATGGCACAAAAGG - Intronic
1004481021 6:16019378-16019400 CTTCTTTTCTCAGGCAGGAATGG - Intergenic
1006848103 6:37077427-37077449 CTTAGATTCACAGGCACCAAAGG + Intergenic
1010277283 6:73984037-73984059 TTTCTATTCTCTTTCTCCAATGG - Intergenic
1012800896 6:103826415-103826437 ATTCTATTCTCTATCTCCAAGGG - Intergenic
1012907821 6:105088461-105088483 CTTCTCTTGTCTGCCACCATGGG + Intergenic
1014081868 6:117296613-117296635 CTTCTACTCTCTGTCTCCATGGG - Intronic
1014783315 6:125589302-125589324 CTTCCATTCTTTGGGAACAATGG + Intergenic
1015797276 6:137025544-137025566 CATTTATGCTCTAGCACCAAAGG + Intronic
1019324041 7:429328-429350 CTTCTATCCTCAGGCACGACGGG + Intergenic
1019752776 7:2742831-2742853 TTTCTATTCACTAGCAACAAAGG - Intronic
1020798513 7:12704783-12704805 CTTCTACTCTCTAGCTCCATGGG + Intergenic
1021858430 7:24880948-24880970 CTTCTGTGCTCAGACACCAAAGG - Intronic
1022014651 7:26338986-26339008 CATGTAGTCTCTGGCTCCAAGGG - Intronic
1022227180 7:28375322-28375344 CTTCTACTCTCTGTCTCCATGGG - Intronic
1022266922 7:28765858-28765880 CTGCAGTTCTCTGCCACCAATGG - Intronic
1028199226 7:87941136-87941158 CGTCTATTCACTGACAACAAAGG - Intronic
1031909381 7:127498885-127498907 CTTATATTCTCTGCCAACCAAGG - Intergenic
1032400105 7:131618844-131618866 GTTCTCTTCTCTGGCACCCTGGG - Intergenic
1035120961 7:156566575-156566597 ATTCTAATCTCTGCCTCCAAGGG - Intergenic
1040868829 8:52079272-52079294 GTTCTTTTCTCTGCCTCCAAAGG - Intergenic
1042445649 8:68882426-68882448 ATTCTATCCTATGGCACTAATGG - Intergenic
1043557616 8:81450642-81450664 CTTCTACTCTCTGTCTCCATGGG + Intergenic
1044462829 8:92465937-92465959 TTTCTATTTTCAGGAACCAATGG + Intergenic
1044780377 8:95737570-95737592 CTTCTAATTTCTGTCACCATAGG + Intergenic
1047787683 8:128169495-128169517 TTTCTAGGCTCTGGCCCCAAAGG - Intergenic
1048403644 8:134096386-134096408 CCTCTGTTCTCTGTCAGCAAAGG - Intergenic
1051617095 9:19016671-19016693 TTTCTAATCTGTGGCACCAATGG - Intronic
1053608192 9:39681412-39681434 CTGGCATTCTCAGGCACCAATGG + Intergenic
1053866033 9:42437772-42437794 CTGGCATTCTCAGGCACCAATGG + Intergenic
1054245339 9:62660997-62661019 CTGGCATTCTCAGGCACCAATGG - Intergenic
1054559467 9:66695528-66695550 CTGGCATTCTCAGGCACCAATGG - Intergenic
1055424803 9:76183218-76183240 CTTCTAGGCTCTGGAAACAACGG - Intronic
1055863575 9:80785187-80785209 CTTTTATTTTCTGGCACTATAGG + Intergenic
1058254298 9:102742188-102742210 CTCCTAATCTCTGGCAACCATGG + Intergenic
1059767604 9:117398597-117398619 CTTCCCCTCTTTGGCACCAAAGG + Intronic
1061516788 9:131094811-131094833 GATCTATTCTCTGGCCCCAGAGG + Intergenic
1061797776 9:133098358-133098380 CTTCTGCTCTCTGGAACCAGAGG - Exonic
1186628023 X:11316020-11316042 CTTCCACTCTCTATCACCAATGG + Intronic
1186915747 X:14218304-14218326 CTTCTATTCTCTATCTCCATGGG + Intergenic
1187569560 X:20487159-20487181 CAACAATCCTCTGGCACCAAAGG - Intergenic
1187575398 X:20548690-20548712 CTTCTATTTTCTGGGATCTAGGG + Intergenic
1188223883 X:27573562-27573584 CCTCTATCTTCTGTCACCAATGG - Intergenic
1189702709 X:43728285-43728307 CGGATATTCTCTGTCACCAATGG + Exonic
1192919800 X:75694661-75694683 CTTTTATTCTCTGACCCCCAAGG - Intergenic
1195116614 X:101705592-101705614 GTTCTATTCTCTGGAAGAAAAGG + Intergenic
1196626604 X:117884411-117884433 CTTCTATTCTCTATCTCCACAGG - Intergenic
1197966075 X:132063265-132063287 CTTCTATTCTCTATCTCCAAGGG + Intergenic
1198979734 X:142381317-142381339 CTTCACTTCTCTGGCACTACTGG - Intergenic