ID: 992892974

View in Genome Browser
Species Human (GRCh38)
Location 5:81221017-81221039
Sequence CAGGGTTAGCCTGGGGTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 12, 3: 75, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992892967_992892974 6 Left 992892967 5:81220988-81221010 CCACTGTGGAAATCTGTCAGATG 0: 1
1: 0
2: 4
3: 41
4: 299
Right 992892974 5:81221017-81221039 CAGGGTTAGCCTGGGGTTATGGG 0: 1
1: 1
2: 12
3: 75
4: 304
992892966_992892974 7 Left 992892966 5:81220987-81221009 CCCACTGTGGAAATCTGTCAGAT 0: 1
1: 0
2: 1
3: 21
4: 161
Right 992892974 5:81221017-81221039 CAGGGTTAGCCTGGGGTTATGGG 0: 1
1: 1
2: 12
3: 75
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992892974 Original CRISPR CAGGGTTAGCCTGGGGTTAT GGG Intronic
900164658 1:1239873-1239895 CAGGGTCGGCCTGCGGTTCTGGG + Intergenic
900634265 1:3654243-3654265 CAGAGGTAGCCTGGGGTGAACGG + Intronic
900812247 1:4815593-4815615 CAGAGTTTGCCTGGGGTCAAGGG + Intergenic
901451095 1:9337508-9337530 CAGGGTGAGGCTGGGGGTAGGGG + Intronic
902978625 1:20107611-20107633 CAGGGCTAGGCTGGGGTGAGAGG - Intergenic
903335530 1:22621931-22621953 TAGGGCCAGCCTGGGGTGATGGG - Intergenic
905070090 1:35217924-35217946 CATGATTAGACTGGAGTTATGGG + Intergenic
906371832 1:45260505-45260527 CATGGTTAGACTGGGGTCATAGG - Intronic
906466148 1:46081583-46081605 TGGGGTTAGGCTGGGGGTATTGG - Intronic
909077066 1:71061857-71061879 CACGATTAGACTGGGATTATGGG - Intergenic
909614986 1:77597628-77597650 CATGATTAGACTGGGGTTATGGG - Intronic
910219167 1:84872961-84872983 CATGATTAGCCTGGGGTTATGGG - Intronic
910750046 1:90619556-90619578 CACGATTAGACTGGGGTGATGGG - Intergenic
910945381 1:92586045-92586067 CATGGTAAGACTAGGGTTATGGG + Intronic
910953824 1:92679819-92679841 CATGATTATACTGGGGTTATTGG + Intronic
911419514 1:97622326-97622348 CATGATTAAACTGGGGTTATGGG - Intronic
912038674 1:105355941-105355963 CATTGTTAGGCTGAGGTTATTGG - Intergenic
916276339 1:162997953-162997975 CATGGTGAGACTGGAGTTATGGG - Intergenic
916533666 1:165682352-165682374 CAGGGTGAGCCTGGTGTATTGGG - Intronic
917152842 1:171963351-171963373 CAGTGGTTGCCTGGGGTTAGGGG + Intronic
917198963 1:172495750-172495772 CTGGCTAAGCCTGGTGTTATAGG - Intergenic
919143805 1:193607683-193607705 CAGGATTAGACTGAAGTTATAGG - Intergenic
919300384 1:195755917-195755939 CATGATTAGATTGGGGTTATAGG + Intergenic
919719992 1:200823552-200823574 CATGGTTAGACTGGAGTTACAGG + Intronic
921301213 1:213753200-213753222 CAGGGTTGGCCTGGGGACATAGG + Intergenic
921811355 1:219518015-219518037 CAAGGTCAGCCTGGGCATATAGG - Intergenic
922933165 1:229405690-229405712 CATGATTAGCCTGGGGTTGTGGG - Intergenic
1064190864 10:13204472-13204494 CAAGGGTAGCCTGGAGCTATAGG - Intronic
1064215760 10:13399139-13399161 CATGGTTAAATTGGGGTTATGGG + Intergenic
1065160752 10:22918844-22918866 CATGGTTAGACTGGGGTCATGGG + Intergenic
1065246892 10:23767841-23767863 CTGGGTTTGCATGGGGGTATAGG - Intronic
1065376453 10:25048289-25048311 AAATGTTAGCCTTGGGTTATAGG + Intronic
1065621111 10:27582737-27582759 CAGTGGTTGCCTGGGGTGATAGG - Intergenic
1067363604 10:45604371-45604393 CATGGTTACACTGGGGTTGTGGG + Intergenic
1067735874 10:48849999-48850021 CATGATTATCCTTGGGTTATGGG + Intronic
1069193716 10:65522291-65522313 CATGATTAGTCTGGGGTTATAGG - Intergenic
1069429563 10:68322167-68322189 CAGGATTAGACAGGGGTTATGGG - Intronic
1069954594 10:72042345-72042367 CCTGGTTAGACTGGAGTTATGGG - Intergenic
1070335569 10:75452188-75452210 CAGGATTTGCCTGGGGTCCTGGG + Intronic
1071563914 10:86661987-86662009 CAGGGAGAGCCTGGGGATGTTGG - Intronic
1072678690 10:97489804-97489826 CATGTTTAGACTGGGGTTATGGG + Intronic
1072749442 10:97966822-97966844 CAGGGTTAGACTGGGGTTAGTGG + Intronic
1075838041 10:125473105-125473127 CGTGGTTAGACTGGGGTTATGGG + Intergenic
1077948604 11:6929599-6929621 CATTATTAGACTGGGGTTATGGG + Intronic
1079142680 11:17823208-17823230 CATAGTTAGACTGGGATTATGGG + Intronic
1079303220 11:19298050-19298072 CATGATTACACTGGGGTTATGGG + Intergenic
1079991280 11:27249298-27249320 CTGGGTTAGGCTGGGGTTTCTGG - Intergenic
1081312205 11:41587664-41587686 AAGGTTCAACCTGGGGTTATAGG - Intergenic
1082696127 11:56366983-56367005 CATGATTAGACTGGGGTAATTGG - Intergenic
1083715880 11:64576760-64576782 CATGATTAGACTGGGGTTACAGG - Intergenic
1084008227 11:66334248-66334270 CAGGGGAAGACTGGGGGTATGGG + Intronic
1085585070 11:77694917-77694939 CATGATTAGACTGGGGTTCTGGG + Intronic
1085916111 11:80890224-80890246 TATGGTTAGGCTGGGATTATGGG + Intergenic
1088124132 11:106403694-106403716 CATGATTAGACTGGGGTTTTGGG + Intergenic
1088491274 11:110390224-110390246 CATGGTTAGTCTTGGGTTACGGG + Intergenic
1088802516 11:113319187-113319209 CACGGTTAGACTGGAGTTACAGG - Intronic
1089006512 11:115095992-115096014 TATGGTTAGACTGGGGTGATGGG - Intergenic
1089050469 11:115540733-115540755 CCTGGTTAGCCTGGGGTTCTTGG - Intergenic
1089230792 11:116973764-116973786 CATGATTAGATTGGGGTTATAGG - Intronic
1090693654 11:129214003-129214025 CATGGTTAGACTGGAGTTACGGG - Intronic
1091201457 11:133783995-133784017 CAGGGATGGACTGTGGTTATGGG + Intergenic
1092008636 12:5090062-5090084 CATGATTAGGCTGGGGTTGTGGG + Intergenic
1092171011 12:6374150-6374172 CTGGGTGAGCCTGGGGTGCTAGG + Intronic
1095265452 12:40151349-40151371 CATGATTAGACTGGAGTTATGGG - Intergenic
1096870622 12:54589993-54590015 CAGGGTAAGGCTGGGGTTATGGG + Intergenic
1097729537 12:63112195-63112217 CATGGTTAGAATGGGGTTAAGGG + Intergenic
1099275010 12:80563670-80563692 CTGGGTTAGCTTGGGATTTTTGG + Intronic
1099738362 12:86600303-86600325 CAGGTTGAGCCTGTGGGTATAGG + Intronic
1100752252 12:97711495-97711517 CATGATTAGATTGGGGTTATGGG - Intergenic
1103764197 12:123270074-123270096 CAGGCTTACCCTGGTGTCATTGG - Intronic
1103989501 12:124789255-124789277 CATGATTAGACTGGGGTGATGGG - Intronic
1104719960 12:131039732-131039754 CAGCGTGAGCCTGGGCTTAGCGG - Intronic
1104834927 12:131783408-131783430 CAGAGTTAGCCTGGGCTTCTGGG + Intronic
1105303114 13:19152539-19152561 CAGGCTGAGCCTGGGGCCATGGG + Intergenic
1105531786 13:21227379-21227401 CATGATTAGAATGGGGTTATGGG + Intergenic
1106023178 13:25933592-25933614 CAGGTGTAGCCAGTGGTTATGGG + Intronic
1106414769 13:29537323-29537345 CATGGTTAGCCTGGGGCTGTGGG - Intronic
1107453019 13:40529072-40529094 CATGTTTAGACTGGGATTATGGG - Intergenic
1107643633 13:42471419-42471441 TATGATTAGGCTGGGGTTATGGG + Intergenic
1108047042 13:46393005-46393027 CAGGCTTACCCTGGGGATAATGG - Intronic
1108444156 13:50490070-50490092 CAAGATTCGACTGGGGTTATGGG + Intronic
1110822196 13:79929154-79929176 CATGGTTAGATTGGGGTTATGGG - Intergenic
1111578710 13:90194190-90194212 CATGATTAGACTGGGGTTATGGG + Intergenic
1111683142 13:91468541-91468563 CAGGGGTTGCCTGAGGTTACCGG + Intronic
1112744760 13:102514239-102514261 CATGATTAGCCTGAGATTATGGG - Intergenic
1113728561 13:112623787-112623809 CATGGTTCGACTGGGGTTCTGGG - Intergenic
1121218566 14:92267353-92267375 CATGGTTAGACTGGGATTATGGG + Intergenic
1121260457 14:92562172-92562194 GATGGTTAGACTGGGGTTAGGGG + Intronic
1122439473 14:101720091-101720113 CATGGTTAGACTGGGGTTATGGG - Intergenic
1122691067 14:103532398-103532420 CAGGGCTAGCCTGGGGCTTTAGG + Intronic
1122755774 14:103978657-103978679 CATGGTTAAACTGAGGTTATTGG + Intronic
1122807731 14:104269045-104269067 CATGGTTAGACTGGAGTTACAGG + Intergenic
1123875769 15:24622269-24622291 CACGGTGAGCCTTGGGTAATGGG + Intergenic
1124350263 15:28950171-28950193 CATGGTTAGACTGGAGTTATGGG + Intronic
1125090541 15:35786440-35786462 CATGATTAGGCTGGGTTTATGGG + Intergenic
1125683804 15:41550391-41550413 CATGATTAGACTGGGGTTATAGG + Intergenic
1126009999 15:44293607-44293629 CAGGATTAGACTGGAGTTGTGGG + Intronic
1126522024 15:49605845-49605867 GAGGGATAGCCTGGGGCTGTGGG + Intronic
1126522385 15:49610736-49610758 CTGACTTCGCCTGGGGTTATTGG - Intronic
1127085135 15:55417498-55417520 CAGGGTTAGCCTGGGTATGTGGG - Intronic
1127932755 15:63607891-63607913 CAGGGTGAGCCTGTGTTTCTGGG - Intergenic
1127957012 15:63862602-63862624 GAGGGTGAGCCTGGAGTGATGGG - Intergenic
1128060495 15:64732474-64732496 CAGGGAAAGCTGGGGGTTATTGG - Intergenic
1128198606 15:65784109-65784131 CATGGTTAGACTGGGATTATGGG - Intronic
1128840316 15:70845421-70845443 CATGATTAGACTGGGATTATGGG + Intronic
1129208399 15:74051051-74051073 CAGGCTGAGCCTGGGGCTAGGGG + Intergenic
1129273371 15:74430954-74430976 CAGGTTGAGACTGGGGATATGGG + Intronic
1129459674 15:75694202-75694224 CTGGGCTTGCCTGGGGTTAGTGG + Intronic
1129520098 15:76180417-76180439 CAGGGTAAGCCTGGGGTTGTGGG + Intronic
1129893828 15:79089674-79089696 CGGAGTTGGGCTGGGGTTATGGG - Intronic
1130464662 15:84185834-84185856 CTGGGCTTGCCTGGGGTTAGTGG - Intergenic
1130499603 15:84487703-84487725 CTGGGCTTGCCTGGGGTTAGTGG + Intergenic
1130703079 15:86205129-86205151 CAGTGGTTGCCTGGGGTTAAAGG - Intronic
1131391608 15:92053717-92053739 CATGGTTAAACTGGGGTTATGGG + Intronic
1132389574 15:101428458-101428480 CAGGGTAAGCATGGTGTTGTAGG - Intronic
1132410636 15:101575855-101575877 CAGTGGTAGCCTGGGGTTGGGGG + Intergenic
1133150646 16:3826589-3826611 CATGGTAAGACTGGGCTTATGGG - Intronic
1134324607 16:13195757-13195779 CATGATTAGATTGGGGTTATGGG - Intronic
1135896817 16:26413215-26413237 CATGATTAGACTGGGATTATAGG - Intergenic
1138324640 16:56154341-56154363 CATGATTAGGCTGGGGTTGTGGG + Intergenic
1139684453 16:68592020-68592042 CTGGGTGACCCTGGGTTTATTGG - Intergenic
1140306789 16:73810202-73810224 CAGGGCTAGGCTTGAGTTATAGG - Intergenic
1140368513 16:74399399-74399421 CAGGGTGGGCCAGGTGTTATAGG - Intergenic
1140663467 16:77209348-77209370 CAGGGTTGGCCAGAGGTAATAGG - Intronic
1141156950 16:81603768-81603790 GATGGTTAGACTTGGGTTATGGG + Intronic
1141407492 16:83807376-83807398 CAGGGTTAGACTGTGGGTTTGGG - Intergenic
1141748425 16:85941950-85941972 CATGGTTAAACTGGGGTTATCGG + Intergenic
1141896318 16:86960949-86960971 CAGGGTTGGCCTGGGGTGCTTGG - Intergenic
1143107413 17:4536585-4536607 CAGGGTCAGCCTGGAGCTGTGGG + Intronic
1143433875 17:6908135-6908157 CAGTGGTTGCCTGGGGTCATAGG - Intronic
1144019301 17:11225927-11225949 CATGGTTAGGCAGGAGTTATGGG - Intergenic
1146765871 17:35521055-35521077 CATAGTTAGGCTGGAGTTATAGG - Intronic
1148802867 17:50243473-50243495 CATGGTTAAACTAGGGTTATCGG + Intergenic
1148850498 17:50552194-50552216 CAGGGCTAGTCTGGGGTCCTGGG + Intronic
1148910073 17:50937493-50937515 CATGTTTAGACAGGGGTTATGGG + Intergenic
1150536074 17:66042440-66042462 CATGATTAGACTGGGGTTGTGGG - Intronic
1150636771 17:66918651-66918673 CTGGGTCAGCCTGGGGTTCAAGG - Intergenic
1152968676 18:140682-140704 CAGTGGTTGCCTGGGGTTAGGGG + Intergenic
1156037440 18:32781740-32781762 CATGATTAGACTGGGATTATGGG + Intergenic
1156453667 18:37280868-37280890 CAGAGTTAGACTGGGGTTTAAGG - Intronic
1157655777 18:49386494-49386516 CATGCTTAGACTGGGGTTATAGG - Intronic
1157918007 18:51688464-51688486 CATGATTAGGCTGGGGTTATAGG + Intergenic
1158428823 18:57365007-57365029 TAAGGTTACCCTGGGGTTCTGGG + Exonic
1158711572 18:59842425-59842447 CATGATTAGACTGGGGTAATGGG - Intergenic
1158729595 18:60008527-60008549 CATTGTTACGCTGGGGTTATGGG + Intergenic
1158919831 18:62179091-62179113 CATGGTAAGTCTGGGGTTATGGG + Intronic
1159638031 18:70829711-70829733 CATGATTAGACTGGGATTATGGG + Intergenic
1159693829 18:71527958-71527980 CACAGTTAGCCTGGGGTTATGGG + Intergenic
1159874716 18:73797669-73797691 CATTATTAGACTGGGGTTATGGG - Intergenic
1160254194 18:77233607-77233629 CACGCTTATGCTGGGGTTATGGG + Intergenic
1162014635 19:7838425-7838447 CATGGTTAGACTGGGGTCTTGGG + Intronic
1163258752 19:16173748-16173770 CAAGGTGAGGCTGGGGTTATGGG + Intergenic
1164418619 19:28067388-28067410 CAGGGCTGTCCTGGGGTCATGGG - Intergenic
1164726825 19:30471146-30471168 CATGGTTAGACTGGAGTTATGGG + Intronic
1167234313 19:48304268-48304290 CAGGGCCAGCCTGGGGTCACAGG + Intronic
925416423 2:3673034-3673056 CATGGGTAGCCTGGGGGAATTGG + Intronic
925439026 2:3867997-3868019 AAGGGTGAGCCTGGGCTGATGGG - Intergenic
925833733 2:7922496-7922518 CTGGGTTAGACTGGGCTTACAGG - Intergenic
925966103 2:9067698-9067720 CATGATTAGACTGGGGTTTTAGG + Intergenic
926285152 2:11482524-11482546 CAGGGTAAGACTGGGGTTCCAGG + Intergenic
927062237 2:19434418-19434440 CATGATTAAACTGGGGTTATGGG + Intergenic
927828419 2:26326743-26326765 CATGGTAAACCTGTGGTTATGGG - Intronic
929096254 2:38265953-38265975 CCTGGTTAGACTAGGGTTATAGG + Intergenic
929103317 2:38338841-38338863 CATGGTTAGACTGGGGTGATGGG - Intronic
931422737 2:62143222-62143244 CAGGGTCAGCCTGGGGCTCCAGG - Intronic
932663171 2:73674675-73674697 CAGGGTTAGACTAGGGTAACAGG - Intergenic
932887526 2:75560850-75560872 CAGGGCTGGCCTGGGGATGTGGG + Intronic
933215210 2:79621867-79621889 CATGGTTATACTGGGGTTATGGG - Intronic
933647226 2:84822575-84822597 CTGGGTAAGCCTGAGGTCATGGG - Intronic
933929193 2:87131209-87131231 CTGGGATTGCCTGGGGTTATAGG + Intergenic
934000523 2:87707005-87707027 CTGGGATTGCCTGGGCTTATAGG + Intergenic
936363743 2:111832167-111832189 CTGGGATTGCCTGGGGTTACAGG - Intronic
936653932 2:114462530-114462552 CATAATTAGACTGGGGTTATGGG + Intronic
937542962 2:122981812-122981834 CATGGTTAGACTGGGGCTATGGG - Intergenic
939007558 2:136806960-136806982 CATGATTAGACTGGGGTTTTTGG + Intronic
941215974 2:162709666-162709688 TAGAGTTTGCCTTGGGTTATTGG - Intronic
942187749 2:173440436-173440458 CATGATTAGCCTGGGGTTGTGGG + Intergenic
942309027 2:174636774-174636796 CTTGGTAAGACTGGGGTTATGGG + Intronic
943988386 2:194653867-194653889 CATGGTTAGTCTGAGGTTATTGG - Intergenic
944282861 2:197918177-197918199 CATGATCAGACTGGGGTTATGGG - Intronic
946002559 2:216494954-216494976 CATGATTAGACTGAGGTTATGGG + Intergenic
946006602 2:216530580-216530602 CATGATTAGCCTGGGGTTTTGGG + Intronic
946127552 2:217577180-217577202 CATGGTTAGACTAGAGTTATGGG - Intronic
947137081 2:226986079-226986101 CATGGTTAGACTGGGGTTATGGG - Intronic
947891394 2:233624384-233624406 CATGGTTAAACTGGGGTTATAGG + Intronic
947894708 2:233658631-233658653 CATGGTTAGACTGGGGTTATAGG + Intronic
948635867 2:239337048-239337070 CATGGTTGGACTGGGGCTATGGG + Intronic
949063758 2:241976596-241976618 CATGGTTAGCCTGAGGTGGTGGG + Intergenic
1169167825 20:3439746-3439768 CAGGACTAGACTGGGCTTATGGG - Intergenic
1170186987 20:13602180-13602202 CATGATTAGAATGGGGTTATGGG - Intronic
1170263593 20:14440676-14440698 CAAGGTTGGCCTGGGGACATGGG + Intronic
1172044698 20:32071871-32071893 CAGGGTGAGCTTGGGGTGAAAGG + Intronic
1173723147 20:45277634-45277656 TATGGTTAGACTGGGGTTATGGG - Intergenic
1173898845 20:46572165-46572187 CAGGGTGAGCCTGGGTGTGTGGG - Intronic
1174377707 20:50137490-50137512 CATGATTAGACTGGGGTTACGGG - Intronic
1175142083 20:56868272-56868294 AAGGGTTCGCCTGGGGCTAGAGG + Intergenic
1175627611 20:60501592-60501614 CAGGGATAGGATGAGGTTATGGG + Intergenic
1175673141 20:60923426-60923448 CATGGTTAGACTGGAGTTATGGG + Intergenic
1175677172 20:60956839-60956861 TGTGGTTAGACTGGGGTTATGGG + Intergenic
1176334881 21:5587112-5587134 CAGAGTTAGGCTGGGGTAACAGG + Intergenic
1176392876 21:6233836-6233858 CAGAGTTAGGCTGGGGTAACAGG - Intergenic
1176468543 21:7082338-7082360 CAGAGTTAGGCTGGGGTAACAGG + Intronic
1176492104 21:7464116-7464138 CAGAGTTAGGCTGGGGTAACAGG + Intergenic
1176508538 21:7674267-7674289 CAGAGTTAGGCTGGGGTAACAGG - Intergenic
1176612280 21:8994024-8994046 CAGGGTTTGTCCGTGGTTATGGG + Intergenic
1177824145 21:26064009-26064031 CATGCTTTGCCTGGGGTTATTGG - Intronic
1178290429 21:31363295-31363317 CAGGGTAAGGCTGGGGTTAGGGG - Intronic
1178377740 21:32081860-32081882 CTTGGTTAGACTGGGGTTATGGG + Intergenic
1180910952 22:19449510-19449532 CAGGGTTAGCCCTGGCTCATGGG + Intergenic
1180970854 22:19814672-19814694 CAGGTTAAGACTGGGGTGATGGG - Intronic
1181495243 22:23283929-23283951 CAGGGCCAGCCTGGGGTGATGGG - Intronic
1182923759 22:34103735-34103757 CAGGGCTAGACTGGGGCAATGGG + Intergenic
1184225236 22:43125882-43125904 CAGGATTTGCCTGGGGTTTCAGG + Intronic
1184427242 22:44418244-44418266 CAGGATTAGAGTGGGGTTTTGGG + Intergenic
1185104256 22:48858294-48858316 CAGGGATGGCCTGGGGTTTCTGG - Intergenic
1185110886 22:48899554-48899576 CAGGGTTATCCTGAGGTTCAAGG - Intergenic
1185153629 22:49180312-49180334 CAGAGGGAGCCTGGGGTTTTGGG - Intergenic
949463718 3:4322004-4322026 CATGATTAGTCTTGGGTTATGGG - Intronic
949581086 3:5389153-5389175 CATGGTTAGACCAGGGTTATGGG + Intergenic
950342588 3:12260593-12260615 CACGGTTCGACTGGGGTTGTGGG - Intergenic
951841149 3:27035495-27035517 CATGATTAGACTGGGGTTGTGGG - Intergenic
952367059 3:32684403-32684425 CATGGTTAGACTGGGGTTTTGGG - Intergenic
953854064 3:46487289-46487311 CACGATTAGACTGGGGTTACAGG + Intergenic
953895674 3:46798062-46798084 TATGATTAGCCTGGAGTTATGGG - Intronic
954695987 3:52426632-52426654 CATGATTAGACTGGGGTTATGGG + Intergenic
954847812 3:53575081-53575103 CATGGTTGGCCTGGGGTGTTTGG + Intronic
955497833 3:59554556-59554578 CAGTGTGAGCCTGGGCTTAGGGG + Intergenic
959546735 3:107605231-107605253 CAGAGTTAGATTGGGGTTCTAGG - Intronic
959961151 3:112300165-112300187 CATTATTAGACTGGGGTTATGGG + Intergenic
960250995 3:115453254-115453276 AATGGTTAGACTGGGGTTACTGG + Intergenic
961920114 3:130416754-130416776 CAGGGTTCTCCTGGGCTAATGGG + Exonic
963073728 3:141327430-141327452 CACGGTTGGACTGGGGTCATGGG - Intronic
963347026 3:144107127-144107149 CATGATTAGGCTGTGGTTATGGG + Intergenic
963478942 3:145843849-145843871 CATAATTAGACTGGGGTTATGGG + Intergenic
963907552 3:150785406-150785428 CATGATTAGACTGGGGTTATTGG + Intergenic
966139552 3:176739991-176740013 CATGGTTAGACTGGGGTTAAGGG - Intergenic
966280020 3:178215231-178215253 CATGGTTAGACTGGGGCTATTGG - Intergenic
966685739 3:182692600-182692622 CACAATTAGACTGGGGTTATGGG - Intergenic
967216584 3:187215735-187215757 CATGATTAGCCTGGGGTTATGGG + Intergenic
968309275 3:197669475-197669497 CATGATTAGACTGAGGTTATGGG + Intergenic
969118421 4:4889012-4889034 CAGGTTTAAGGTGGGGTTATGGG + Intergenic
970017148 4:11524794-11524816 CATGATTAGACTGGAGTTATGGG + Intergenic
970387021 4:15566309-15566331 CATGTGTAGCTTGGGGTTATTGG + Intronic
971142857 4:23943845-23943867 CATGGTTAGCCTGGATTTATAGG - Intergenic
972295299 4:37732142-37732164 CATGATTAGACTGGAGTTATGGG - Intergenic
973014615 4:45122526-45122548 CATGCTTAGACTGGCGTTATGGG + Intergenic
973196483 4:47448608-47448630 CATGATTAGACTTGGGTTATGGG - Intergenic
973295574 4:48516612-48516634 CTGGGCTAGTCTAGGGTTATAGG - Intronic
973664954 4:53149775-53149797 CATGGTTAGACTAGGGTTATGGG - Intronic
973728593 4:53801394-53801416 CAGGGTTATCTTGGTTTTATAGG + Intronic
978614950 4:110585070-110585092 CATGATTAGTCTAGGGTTATGGG - Intergenic
979860660 4:125688946-125688968 CATGGGTAGACTGGGGTCATAGG - Intergenic
980650402 4:135706593-135706615 CATGTTTAGACTGGAGTTATGGG - Intergenic
981101211 4:140831230-140831252 AATGGTTAGAGTGGGGTTATAGG + Intergenic
981962464 4:150557686-150557708 CATGGTTAGAATGGGGTTACAGG + Intronic
982604578 4:157498188-157498210 CATGTTTAGACTGGAGTTATAGG + Intergenic
984390191 4:179121243-179121265 CATGATTAAACTGGGGTTATGGG - Intergenic
984929178 4:184831487-184831509 TACGATTAGACTGGGGTTATAGG + Intergenic
985067605 4:186138698-186138720 CATGGTGAGACTGGGGTTATGGG + Intronic
985930768 5:3055933-3055955 CATGGTTTGACTGGGGTCATAGG + Intergenic
986857499 5:11887867-11887889 CATGATTAGACTGAGGTTATGGG + Intronic
989553505 5:42763645-42763667 CATGATTAGACTAGGGTTATGGG - Intronic
989810900 5:45673195-45673217 CATGATTAGACTGAGGTTATGGG + Intronic
991221264 5:64222179-64222201 CATGATTAGACTGGGCTTATCGG + Intronic
992100353 5:73401735-73401757 CATGGTTAGGCTGGGGTTATAGG - Intergenic
992892974 5:81221017-81221039 CAGGGTTAGCCTGGGGTTATGGG + Intronic
993088680 5:83396790-83396812 CATGATTAGACTGAGGTTATGGG - Intergenic
993658588 5:90602510-90602532 CATGATTAGACTGGGGTTATGGG - Intronic
994280450 5:97896138-97896160 CATGATTAGACTGGGGTTATGGG + Intergenic
994520481 5:100828156-100828178 CTGGGAGAGCCTGGGGTTCTGGG + Intronic
994955735 5:106529396-106529418 CAGGTTTAGATTGGGGCTATGGG - Intergenic
995328418 5:110918785-110918807 CATGATTAAACTGGGGTTATGGG + Intergenic
998006480 5:138660553-138660575 CAGGGTTAGCAAGGAGTTAAAGG - Intronic
998820058 5:146049926-146049948 CAGGGTTTGCTTGGGCTGATCGG - Intronic
999529936 5:152451876-152451898 CATGATTAGACTAGGGTTATGGG + Intergenic
1000787730 5:165566909-165566931 CATGGCTGGACTGGGGTTATGGG + Intergenic
1001434175 5:171686536-171686558 CAGGTTTAGCGTGGGGCTCTGGG - Intergenic
1001611663 5:173007797-173007819 CAGGGTTTGCCTGGAGTTTCTGG + Intronic
1003659055 6:8043439-8043461 CATGACTAGACTGGGGTTATGGG - Intronic
1004009938 6:11674708-11674730 CATGATTAGACAGGGGTTATGGG + Intergenic
1004239134 6:13902869-13902891 CAGGGTTAGGCTGGGGCTGGAGG - Intergenic
1004496710 6:16171137-16171159 CACGATTAGGCTAGGGTTATGGG - Intergenic
1004665892 6:17748318-17748340 CATAATTAGACTGGGGTTATGGG + Intergenic
1004890119 6:20092763-20092785 CAGGGCTGTCCTGGGCTTATTGG + Intergenic
1005097628 6:22135027-22135049 TAGGGTTTGACTGGGGTTATGGG - Intergenic
1005372208 6:25145541-25145563 CATGGTTAGACTGGGATTATGGG - Intergenic
1005927377 6:30454602-30454624 CATGGTTAGACTATGGTTATGGG + Intergenic
1007404782 6:41628510-41628532 CATGATTAGACTGGGCTTATGGG - Intergenic
1007757333 6:44108453-44108475 CTGGGTTAGCCTGTGGGGATGGG + Intergenic
1008590879 6:52992609-52992631 CATGATTAGACTGAGGTTATGGG - Intronic
1008713807 6:54263693-54263715 CAGAGTTAACCTTGGGTAATAGG - Intronic
1009574148 6:65430598-65430620 TAGGGTTAGCCTGGGTCTAGGGG - Intronic
1009927843 6:70141890-70141912 CAGGGAGAACCTGGGGTAATAGG + Exonic
1010129851 6:72478722-72478744 TAGGCCTAGCCTGGGGTTGTGGG - Intergenic
1011000057 6:82577986-82578008 CATGGTTAAGCTGGGGTTATGGG - Intergenic
1011003859 6:82622180-82622202 CATGATTTGACTGGGGTTATGGG - Intergenic
1011334685 6:86247226-86247248 CAGGGGTAGCCATGGGGTATGGG + Intergenic
1011425345 6:87222942-87222964 CATGATTAGACTGGGGTTATGGG + Intronic
1012290976 6:97455065-97455087 CATGGTTAGATTGAGGTTATGGG - Intergenic
1012987534 6:105890899-105890921 CATGATTAGACTGGGGTTATGGG - Intergenic
1013000614 6:106018666-106018688 TATGATTAGTCTGGGGTTATGGG + Intergenic
1013184410 6:107745467-107745489 CATGATTAGACTAGGGTTATGGG + Intronic
1013283654 6:108662210-108662232 CATGCTTAGACTGAGGTTATGGG + Intronic
1013341892 6:109222975-109222997 CATGGTTACACTGGGGTTATGGG + Intergenic
1013538545 6:111085701-111085723 GATGGTTAGCCAGGGATTATGGG + Intergenic
1014324008 6:119968077-119968099 CATGATTAGACTGGGGTTACAGG - Intergenic
1014977816 6:127911030-127911052 CATGGTTCACCTTGGGTTATGGG + Intronic
1014977915 6:127911995-127912017 CATGGTTCACCTTGGGTTATGGG + Intronic
1015553250 6:134434290-134434312 CATGATTAGACTGGGGTTATGGG + Intergenic
1015567857 6:134592095-134592117 CATGTTTAGACTGGGGTTTTGGG - Intergenic
1015972762 6:138759455-138759477 CATAGTTAGACTGGGGTGATAGG - Intronic
1016141690 6:140620336-140620358 CATGGGTAGACTGGGGTTATTGG + Intergenic
1016185829 6:141196625-141196647 CAAGGGCAGCCTGGGGTTAGGGG + Intergenic
1017037515 6:150279847-150279869 CATGATGAGACTGGGGTTATGGG + Intergenic
1018153446 6:160962591-160962613 CATGGTTAGACTAAGGTTATGGG - Intergenic
1018162163 6:161055688-161055710 CATGATTAGACTGGGGTGATGGG + Intronic
1020369855 7:7419934-7419956 CAGGGAGAGCCTGGGGTCAGAGG - Exonic
1020410023 7:7881853-7881875 CATGGTTAGACTAGGGATATCGG + Intronic
1021261837 7:18467991-18468013 CATGGTTAGACTTAGGTTATAGG + Intronic
1022869768 7:34463984-34464006 CATGATTAGCCTGGGGTTATGGG + Intergenic
1023148674 7:37178762-37178784 CATGATTAGACTGGGGTTATAGG - Intronic
1023865127 7:44234845-44234867 CAGGGCTGTCCTGGGGTGATGGG - Intronic
1023902762 7:44496490-44496512 CATGATTAGACTAGGGTTATGGG - Intergenic
1024424039 7:49205001-49205023 CATAATTAGACTGGGGTTATGGG + Intergenic
1024762910 7:52621803-52621825 CATGATTAAACTGGGGTTATAGG + Intergenic
1026670633 7:72387604-72387626 CATGATTAGACTGGGGTGATGGG - Intronic
1028331098 7:89593119-89593141 CATGATTAGCCTTGGGTTATGGG - Intergenic
1028558833 7:92151357-92151379 CATTATTAGACTGGGGTTATGGG + Intronic
1029598436 7:101549929-101549951 CAGGGCGAACCTGGGGTTAGGGG - Intronic
1030310192 7:108061083-108061105 CATGATTAGACTGGGTTTATAGG - Intronic
1031540261 7:122987067-122987089 CATGGTTAGTCTGGGTTTTTAGG + Intergenic
1032474500 7:132202918-132202940 CAGTGCCAGCCTGGGGTGATGGG + Intronic
1033188388 7:139251596-139251618 CAGGGTTAGGCTGGGGTTATAGG + Intronic
1034763286 7:153693942-153693964 CAGGGTTTGCCAGGGGCTGTCGG - Intergenic
1034947431 7:155272032-155272054 CACCGTTAGACTGGGGTTGTGGG - Intergenic
1036177479 8:6552933-6552955 CAGGGTTTGCCAGGGGTTAAGGG + Intronic
1036227146 8:6969164-6969186 AGGAGTTAGCCTGGGTTTATAGG + Intergenic
1036402445 8:8422068-8422090 CATGGTTAGACTGGGGTTGTGGG + Intergenic
1036496653 8:9276266-9276288 CAGGGATGGCCTGAGGTTGTAGG - Intergenic
1037743428 8:21625148-21625170 CATGTTTAGGCTGGAGTTATGGG - Intergenic
1037923491 8:22826018-22826040 CAGGGTTGGCGTGGGGTGGTGGG + Intronic
1038287829 8:26221607-26221629 CAGGATTAGGGTGGGGTGATTGG - Intergenic
1040573544 8:48630423-48630445 CATGGTTAGACTGGTGTTGTGGG + Intergenic
1041887511 8:62828229-62828251 CAGTGTTTGCCAGAGGTTATAGG + Intronic
1042136936 8:65641770-65641792 CATGATTAGACTGTGGTTATAGG - Intergenic
1043753948 8:83978559-83978581 CATGGTTAGACTAGGGTTACAGG - Intergenic
1044109423 8:88253513-88253535 CATGATTAGACTGGGGTTGTAGG - Intronic
1045323325 8:101098284-101098306 CAGGGTGATGCTGGGGTTAGTGG - Intergenic
1046128278 8:109938016-109938038 CATGATTAGACTGGGGTTATGGG + Intergenic
1047308631 8:123673958-123673980 CATGGCTAGACTGGGGTTATGGG - Intergenic
1047552389 8:125889191-125889213 CATGATTAGACTGGAGTTATGGG + Intergenic
1048861041 8:138724649-138724671 CAGGGTTTGCCTGGAGAGATCGG - Exonic
1050928602 9:11297256-11297278 CCTGGTAAGCCTGGGGATATGGG + Intergenic
1052913042 9:33901233-33901255 CATGATTAGTCTAGGGTTATAGG + Intronic
1053030572 9:34773710-34773732 CATAATTAGACTGGGGTTATGGG - Intergenic
1053328334 9:37177748-37177770 CATGGTTAGGCTGTGGTTATGGG - Intronic
1054924193 9:70572643-70572665 CATGATTAGACTAGGGTTATGGG + Intronic
1056011625 9:82337080-82337102 CAGTGTTTGCCTGGGGCTAGGGG + Intergenic
1056236884 9:84603538-84603560 CATAGTTAGCCTAGGATTATGGG + Intergenic
1057481150 9:95446833-95446855 CAAGGTTCTCCTGGGGTTCTCGG - Intronic
1057841877 9:98492746-98492768 CATGGTTAGACTGGGGTTATGGG + Intronic
1057931670 9:99198987-99199009 CATGATTAGATTGGGGTTATGGG + Intergenic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061562736 9:131416786-131416808 CATGATTATCCTGAGGTTATGGG + Intronic
1062534235 9:137014541-137014563 CGGGGTTAGCCTGCGGTCCTAGG - Intronic
1062697227 9:137881603-137881625 CAGGGTTGGCATGGGGGTGTCGG - Intronic
1186045133 X:5527684-5527706 CATGATTAGCCTGGGTTTATGGG + Intergenic
1186117480 X:6320302-6320324 CATGTTTAGGCTAGGGTTATAGG - Intergenic
1186240985 X:7566113-7566135 CAGGATTAGACTGGGTTTATAGG + Intergenic
1186839552 X:13471432-13471454 CAGAGTGAGCCTGGGGTGAGGGG + Intergenic
1187649703 X:21389049-21389071 CATGGTTAGAATGGGGTTATGGG - Intronic
1187743221 X:22379138-22379160 CATGATTAAACTGGGGTTATGGG + Intergenic
1187795304 X:22997374-22997396 CATGATTAGACTGGGGTTATGGG - Intergenic
1188504497 X:30867045-30867067 CATGGGTAGAATGGGGTTATGGG - Intronic
1189391102 X:40577520-40577542 CATGATTACACTGGGGTTATGGG + Intergenic
1189891848 X:45610857-45610879 CATGGTAAGCCTGGGGGAATGGG + Intergenic
1191206105 X:57835422-57835444 CAGGGACAGTTTGGGGTTATTGG - Intergenic
1192192899 X:69004366-69004388 CATGATTAGACTGGGGTTATGGG + Intergenic
1192226940 X:69235651-69235673 CATGATCAGACTGGGGTTATGGG + Intergenic
1192329347 X:70162252-70162274 CAGAATTAGACTAGGGTTATGGG - Intronic
1192387728 X:70689992-70690014 CATGATTAGACTGGGGTTATGGG - Intronic
1192690197 X:73354346-73354368 CATGGTGAGCCTTGGGTGATGGG + Intergenic
1193466729 X:81857263-81857285 CATGGTTAGACAGGGTTTATAGG - Intergenic
1194577072 X:95626344-95626366 CAGGGTTAGACTGGGGTTTGGGG - Intergenic
1195699431 X:107691502-107691524 CAGGGCTTGCCAGGGGTTAATGG - Intergenic
1198486779 X:137095249-137095271 CAGGGTTAGCTAGGAGTGATTGG + Intergenic
1198748908 X:139919279-139919301 TAGGGTTTTCCTGGGATTATAGG - Intronic
1198941402 X:141960686-141960708 ATGAGTTAGACTGGGGTTATGGG + Intergenic
1199475912 X:148244993-148245015 CATGAGTAGACTGGGGTTATGGG - Intergenic
1199627717 X:149756570-149756592 CATGATTAGGCTGGGGTTATGGG - Intergenic
1201480125 Y:14429579-14429601 CATGTTTAGTCTAGGGTTATAGG + Intergenic
1202370556 Y:24192839-24192861 CTGGGCTTGCCTGGGGTTAGTGG + Intergenic
1202500228 Y:25477278-25477300 CTGGGCTTGCCTGGGGTTAGTGG - Intergenic