ID: 992893936

View in Genome Browser
Species Human (GRCh38)
Location 5:81231173-81231195
Sequence GCAATGGACTGAGCTGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992893936_992893943 16 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893943 5:81231212-81231234 CCTGAATGGGTGGTGGAGAGAGG No data
992893936_992893941 9 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893941 5:81231205-81231227 CAACGCTCCTGAATGGGTGGTGG No data
992893936_992893944 29 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893944 5:81231225-81231247 TGGAGAGAGGAGAAGCCGCCAGG No data
992893936_992893940 6 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893940 5:81231202-81231224 GCTCAACGCTCCTGAATGGGTGG No data
992893936_992893945 30 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893945 5:81231226-81231248 GGAGAGAGGAGAAGCCGCCAGGG No data
992893936_992893938 2 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893938 5:81231198-81231220 AGCAGCTCAACGCTCCTGAATGG No data
992893936_992893939 3 Left 992893936 5:81231173-81231195 CCTGGAACAGCTCAGTCCATTGC No data
Right 992893939 5:81231199-81231221 GCAGCTCAACGCTCCTGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992893936 Original CRISPR GCAATGGACTGAGCTGTTCC AGG (reversed) Intergenic
No off target data available for this crispr