ID: 992897226

View in Genome Browser
Species Human (GRCh38)
Location 5:81255504-81255526
Sequence TTCCCATTTATCAACAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992897226_992897229 16 Left 992897226 5:81255504-81255526 CCTAGCTTGTTGATAAATGGGAA 0: 1
1: 0
2: 1
3: 7
4: 141
Right 992897229 5:81255543-81255565 TCCTGTCTGTGTCCAGAAGATGG No data
992897226_992897228 -10 Left 992897226 5:81255504-81255526 CCTAGCTTGTTGATAAATGGGAA 0: 1
1: 0
2: 1
3: 7
4: 141
Right 992897228 5:81255517-81255539 TAAATGGGAACAGTTAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992897226 Original CRISPR TTCCCATTTATCAACAAGCT AGG (reversed) Intronic
906121279 1:43393064-43393086 TCCCCATTTCTTAACAAGGTAGG - Intronic
906882956 1:49612738-49612760 TTCCCTTTTCTCCACAACCTTGG - Intronic
911388776 1:97212454-97212476 TTACCATTCATCAACCTGCTAGG + Intronic
911900434 1:103496525-103496547 TTCCCTTTTCTCCACAACCTTGG - Intergenic
915700608 1:157790916-157790938 TTCCCTTTTCTCTACAACCTTGG - Intergenic
915802351 1:158808038-158808060 CTCACAATTACCAACAAGCTGGG + Intergenic
916193871 1:162205114-162205136 TACTCATTTATCAAGAAGCTAGG - Intronic
921533648 1:216317075-216317097 TTCCCTTTTCTCCACAACCTTGG - Intronic
923054711 1:230417328-230417350 TACTCATTTCTCAACATGCTTGG + Intronic
923886823 1:238166473-238166495 TTCCCACTCATTAACAAGCAGGG - Intergenic
924854669 1:247864464-247864486 TTCCCATTTTGCCACAGGCTTGG - Intronic
1067276299 10:44837992-44838014 TTCCCATTCAGGAACATGCTTGG + Intergenic
1067277079 10:44845607-44845629 TTCCCAATTAGCAACACACTTGG - Intergenic
1067569872 10:47363612-47363634 GTCCCAATTATCACCAGGCTGGG - Intergenic
1072367892 10:94733018-94733040 TCCCGGTTTATCATCAAGCTTGG - Intronic
1073568648 10:104557200-104557222 TCCCCATTTTTCATTAAGCTTGG - Intergenic
1077266198 11:1651818-1651840 TTGCCATTTTGCAACAAGGTCGG - Intergenic
1082137827 11:48570163-48570185 CTGCCATATTTCAACAAGCTAGG + Intergenic
1085902522 11:80718745-80718767 TTCCCATTGTTCAGTAAGCTTGG + Intergenic
1085990464 11:81836832-81836854 TTCCCATTTCTCCACATCCTTGG + Intergenic
1090063270 11:123481893-123481915 ATCGTTTTTATCAACAAGCTGGG + Intergenic
1090376225 11:126291626-126291648 TCCCCATTTAGCGACAATCTAGG + Intronic
1095282983 12:40378283-40378305 TACCCATTTACCCACCAGCTAGG - Intergenic
1095429728 12:42120324-42120346 TTCCCATTTACCAAATATCTAGG + Intronic
1095801453 12:46273405-46273427 CCCCCATTTTGCAACAAGCTAGG - Intergenic
1097348021 12:58516798-58516820 TTCCCTTTTATCCACAGGCATGG - Intergenic
1099153448 12:79144542-79144564 TTCCCATTTACAAACAAACTGGG + Intronic
1102072430 12:110032436-110032458 TTCCCATGTAGCAACAAAGTTGG + Intronic
1104943815 12:132406846-132406868 TTCCCATTTAACAAAGAGCAGGG - Intergenic
1108146478 13:47482851-47482873 TTCCCACTTAGCAACAAGAATGG - Intergenic
1109701345 13:66028604-66028626 GTTCCATTTATCAACTAGTTAGG + Intergenic
1110153147 13:72279188-72279210 TTCCCATTTATCTCCTAGTTAGG + Intergenic
1116009680 14:39336234-39336256 TTCCCTTTTCTCTACAACCTTGG + Intronic
1118047914 14:61992471-61992493 TGGCTATTTATCAACCAGCTTGG - Intergenic
1123959124 15:25376271-25376293 TTCCCAATTATCAACAACATGGG + Intronic
1126925700 15:53584127-53584149 TTACCATTTATTGACAAGTTTGG - Intronic
1127814809 15:62598548-62598570 TTCCCATTTACCAGCAGGGTTGG - Intronic
1133988188 16:10684491-10684513 TTCCCACCTATCAGGAAGCTCGG + Intronic
1134517270 16:14897196-14897218 TTCCCACCTATCAGCTAGCTTGG + Intronic
1134704937 16:16295850-16295872 TTCCCACCTATCAGCTAGCTTGG + Intergenic
1134962604 16:18416264-18416286 TTCCCACCTATCAGCTAGCTTGG - Intergenic
1134966901 16:18498863-18498885 TTCCCACCTATCAGCTAGCTTGG - Intronic
1140170817 16:72601952-72601974 TTCCCAATTTTAAACAAGCAGGG + Intergenic
1142326713 16:89420476-89420498 TTCCCATGTATGAAGAAACTGGG + Intronic
1144533756 17:16066636-16066658 TTCCCCTTCATCTAGAAGCTAGG + Intronic
1147792196 17:43021003-43021025 TTCTCATTTATCATTAATCTTGG - Intronic
1148570506 17:48664453-48664475 TTCCCTTTTATCCAAAACCTGGG - Intergenic
1149666952 17:58371545-58371567 TTCCCATTTCTCAGGAGGCTGGG + Intronic
1151452240 17:74205082-74205104 TTCCCCTGTATGTACAAGCTGGG - Intronic
1152178812 17:78805126-78805148 TTCTCATTTGTCAATGAGCTGGG + Intronic
1158244713 18:55419114-55419136 TTCCAATTTGTTAACAAGGTAGG - Intronic
1159522209 18:69540497-69540519 TTACCATTTGTCCACAATCTTGG + Intronic
1166984244 19:46649933-46649955 TTCCCATTTCTCATCCAGCCCGG + Intronic
1168427985 19:56254702-56254724 TTCCCATTTCTCCACATCCTTGG + Intronic
1202645186 1_KI270706v1_random:132836-132858 TTCCCTTTTTTCCACAAACTCGG - Intergenic
929764606 2:44833581-44833603 TTCCCATTTTTCCTCAACCTTGG - Intergenic
932502745 2:72198332-72198354 TTCCCCTTTCTCTACTAGCTGGG + Intronic
934214723 2:90020869-90020891 ATCCCATTTATCAGCTAACTTGG - Intergenic
935213407 2:100957149-100957171 TTCACATTTATTAAAAATCTAGG - Intronic
938566162 2:132520995-132521017 TTCCCATCTAACAAGAAGCCTGG + Intronic
939994230 2:148905487-148905509 TTCCCATTTAGCAAAAAGACTGG + Intronic
944679497 2:202064268-202064290 TTCCCAGCCAGCAACAAGCTGGG - Intergenic
945183737 2:207118530-207118552 TTCCCCTTTATTAGTAAGCTTGG + Intronic
945573295 2:211498518-211498540 TTCCCATTCATCAAAATTCTAGG + Intronic
948495581 2:238346466-238346488 TTCCCCTTGATCCACAAGCTTGG + Intronic
1170860605 20:20099771-20099793 TCCCCATTTCTGAACAATCTTGG - Intronic
1173218813 20:41114188-41114210 TTTCCATTATTCAACAAGCATGG + Intronic
1175187390 20:57187914-57187936 TTCCCCTTTGTCACCAAGTTTGG + Intronic
1176606705 21:8839907-8839929 TTCCCTTTTTTCCACAAACTTGG + Intergenic
1177631851 21:23739146-23739168 TTCCCATTTTTCAACTACCAGGG + Intergenic
1180356777 22:11849608-11849630 TTCCCTTTTTTCCACAAACTCGG + Intergenic
1180381483 22:12142723-12142745 TTCCCTTTTTTCCACAAACTCGG - Intergenic
1184402826 22:44283736-44283758 TTCTCAGCTATCAAAAAGCTTGG + Intronic
949834380 3:8252223-8252245 TTCCCTTTTCTCCACAACCTTGG + Intergenic
950396678 3:12738851-12738873 TTCCCAATTATGAAAAAGTTTGG + Intronic
952771345 3:37003895-37003917 TTCCCCTTTATAACCAAGATTGG - Intronic
953092736 3:39745910-39745932 TTCCCATTTCTCAAGAAGGCTGG - Intergenic
953159992 3:40409913-40409935 TTACCATTTATCTAAAAGTTGGG + Intronic
953585080 3:44192508-44192530 TTCACATTTCTCATCAAGTTTGG - Intergenic
953594135 3:44291951-44291973 GTCCCATTTATTAACTAGTTAGG + Intronic
956922427 3:73944082-73944104 TTTCCATTTGTTAACAAGGTGGG + Intergenic
957333805 3:78800137-78800159 TTCTCATTTATCTTCAAGGTGGG + Intronic
958014739 3:87925805-87925827 TTACCATTTCTCTACAATCTTGG + Intergenic
960383676 3:116994061-116994083 TCCCCATTTATTCACCAGCTTGG + Intronic
963053814 3:141166175-141166197 TTGCCATTTCTCATCAAGCTTGG + Intergenic
968019283 3:195369893-195369915 TTCCCTTTTCTCCACAACCTTGG + Intronic
968033331 3:195522928-195522950 TTCCCCTCTACCCACAAGCTTGG + Intronic
970372572 4:15423010-15423032 TTCACATTTATCCACAAGGATGG + Intronic
971480449 4:27109854-27109876 TTTCCAGTTTTCATCAAGCTGGG + Intergenic
971710931 4:30111634-30111656 TTCCCATTTTTCCACACTCTTGG - Intergenic
972072669 4:35039919-35039941 TTTCCATTAATGAGCAAGCTCGG + Intergenic
972206690 4:36781937-36781959 TTCCCATTTATAATTAAGTTTGG + Intergenic
973371407 4:49251250-49251272 TTCCCTTTTTTCCACAAACTCGG - Intergenic
973389601 4:49544061-49544083 TTCCCTTTTTTCCACAAACTCGG + Intergenic
975042788 4:69764560-69764582 TTCCCATTTGTCTACATACTTGG + Intronic
976518996 4:86004885-86004907 TTCCCATTGATTCTCAAGCTGGG + Intergenic
981843601 4:149140787-149140809 TTCCCATTTTTACAGAAGCTTGG - Intergenic
984223971 4:177012857-177012879 TTCCCAGTTTTCAACAAGAGGGG - Intergenic
985156354 4:186991969-186991991 TTCCCTTTTCTCCACAACCTTGG - Intergenic
986862266 5:11940761-11940783 TTCCCATTTCTCCACATCCTTGG - Intergenic
987968963 5:24917119-24917141 TTCCCTTTTCTAAACCAGCTTGG - Intergenic
991421910 5:66450769-66450791 TTTCCATTTATGAAAAATCTGGG - Intergenic
991519792 5:67483278-67483300 TTCCTATTTAACAAAAAACTTGG - Intergenic
992786926 5:80178997-80179019 TTCCCAATTAACAATAAGCTGGG + Intronic
992897226 5:81255504-81255526 TTCCCATTTATCAACAAGCTAGG - Intronic
992966770 5:82010429-82010451 TTCCCTTTTAGGAACATGCTAGG + Intronic
993235179 5:85296592-85296614 TTCACATTTATCAACACATTTGG - Intergenic
994490083 5:100430563-100430585 TTCCCAAATATTAAAAAGCTGGG - Intergenic
995632003 5:114144364-114144386 TTGCCATTTATCCACAAAATGGG + Intergenic
995652603 5:114386835-114386857 CCCGCATTTATCAACAAGGTTGG + Intronic
995889338 5:116933577-116933599 TTACCATTTACCAAGAAGCCTGG + Intergenic
995910185 5:117177386-117177408 TTGCCTTGTATCAACATGCTTGG - Intergenic
999955607 5:156698092-156698114 CTCCAATTTATAAACAAGCAGGG - Intronic
1000870288 5:166568982-166569004 TTCCCTTGTATCATCAGGCTTGG + Intergenic
1003729295 6:8802944-8802966 TACCAATCTATCAACAAACTGGG - Intergenic
1008642519 6:53479147-53479169 TTCCCTTTTCTCCACAACCTTGG + Intergenic
1010979607 6:82356764-82356786 TGCCTACTTATAAACAAGCTAGG + Intergenic
1011946337 6:92908620-92908642 TTTTCCTTTACCAACAAGCTGGG + Intergenic
1012567491 6:100677042-100677064 TTCCCATTTTTCAAAAACATGGG + Intronic
1014023720 6:116619419-116619441 TTCTCATTTATCCCCAAGATAGG - Intronic
1016238054 6:141891712-141891734 TTCCCTTTTTTCCACAACCTTGG - Intergenic
1019662371 7:2232226-2232248 TTTCCATTTAACAAGAACCTTGG + Intronic
1026831723 7:73614439-73614461 TTTCCATTTATCTACATGCCAGG - Intronic
1028329371 7:89569957-89569979 TTCCCTTTTCTCCACAACCTGGG - Intergenic
1028791702 7:94860616-94860638 TTCCCCTTGAGCAACCAGCTTGG - Intergenic
1030579208 7:111331905-111331927 TTCCCAGTTAATAACAAGTTGGG - Intronic
1031705187 7:124972163-124972185 TTCACATATATAAACAAGTTTGG - Intergenic
1033505731 7:141997815-141997837 TTCCCATTCACCAAGCAGCTGGG + Intronic
1033677854 7:143561525-143561547 TTGCCATTTAAAAACAATCTCGG + Intergenic
1034221603 7:149450810-149450832 TTCCCATTAATCAACAAGTTGGG + Intronic
1037259928 8:16997092-16997114 TTTCCATTTATCAGTAAACTGGG + Intronic
1038952507 8:32431368-32431390 TTCCCGTTTATCAGCAAGGGTGG - Intronic
1041755801 8:61312088-61312110 TCCCCAGTTCTCAACAAGCCAGG + Intronic
1047161681 8:122387516-122387538 TCCAGATTTATCAACAACCTAGG - Intergenic
1048227039 8:132597725-132597747 TCCCCAGTTGACAACAAGCTGGG + Intronic
1052383092 9:27793107-27793129 TTCCCCTTTCTCCACAATCTTGG - Intergenic
1060296658 9:122347813-122347835 GTCCCATTCCTCAACCAGCTGGG - Intergenic
1203695832 Un_GL000214v1:96192-96214 TTCCCTTTTTTCCACAAACTCGG - Intergenic
1203741838 Un_GL000218v1:10121-10143 TTCCCCTTTTTCCACAAACTCGG + Intergenic
1203702028 Un_KI270742v1:4712-4734 TTCCCTTTTTTCCACAAACTCGG + Intergenic
1203554010 Un_KI270743v1:190767-190789 TTCCCTTTTTTCCACAAACTCGG + Intergenic
1203640441 Un_KI270751v1:7871-7893 TTCCCTTTTTTCCACAAACTCGG + Intergenic
1188399017 X:29721273-29721295 TTCCTATATGGCAACAAGCTAGG + Intronic
1188649444 X:32613564-32613586 CTCTCATTTATCATCAAGCTTGG + Intronic
1192246135 X:69373190-69373212 GTCCAATCTATCAACAATCTTGG + Intergenic
1192279728 X:69672229-69672251 TTCCCATTTAAAAACATGGTAGG - Intronic
1195206620 X:102605992-102606014 TTCCAATTTATCCACATTCTTGG + Intergenic
1195230946 X:102846299-102846321 TTCCCATTTATCTCCCAGATGGG + Intergenic
1197392706 X:125887029-125887051 TTCCCTTTTCTCAACAGCCTTGG + Intergenic
1199330110 X:146549476-146549498 TTCCCTTTTCTCTACAACCTTGG + Intergenic