ID: 992897229

View in Genome Browser
Species Human (GRCh38)
Location 5:81255543-81255565
Sequence TCCTGTCTGTGTCCAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992897226_992897229 16 Left 992897226 5:81255504-81255526 CCTAGCTTGTTGATAAATGGGAA 0: 1
1: 0
2: 1
3: 7
4: 141
Right 992897229 5:81255543-81255565 TCCTGTCTGTGTCCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992897229 Original CRISPR TCCTGTCTGTGTCCAGAAGA TGG Intronic
No off target data available for this crispr