ID: 992901223

View in Genome Browser
Species Human (GRCh38)
Location 5:81298883-81298905
Sequence CCTAATATTCAGAGAGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992901218_992901223 10 Left 992901218 5:81298850-81298872 CCTATTGGTCACTTCATCTAGGG No data
Right 992901223 5:81298883-81298905 CCTAATATTCAGAGAGAATCTGG No data
992901216_992901223 18 Left 992901216 5:81298842-81298864 CCTCATCACCTATTGGTCACTTC No data
Right 992901223 5:81298883-81298905 CCTAATATTCAGAGAGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992901223 Original CRISPR CCTAATATTCAGAGAGAATC TGG Intergenic
No off target data available for this crispr