ID: 992901587

View in Genome Browser
Species Human (GRCh38)
Location 5:81301953-81301975
Sequence CTACGTACGTGGGAAGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992901587_992901598 13 Left 992901587 5:81301953-81301975 CCTCCCCCTTCCCACGTACGTAG 0: 1
1: 0
2: 0
3: 5
4: 85
Right 992901598 5:81301989-81302011 TACTTCCTTTTGAACAGCTTCGG 0: 1
1: 0
2: 0
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992901587 Original CRISPR CTACGTACGTGGGAAGGGGG AGG (reversed) Exonic
900093643 1:931429-931451 CTAGGAGGGTGGGAAGGGGGAGG - Intronic
901849061 1:12003832-12003854 CTTCTTACCTGGGAAGGGGAAGG + Intronic
903822187 1:26111417-26111439 CTCGGTAGGTCGGAAGGGGGCGG + Intronic
903976638 1:27154588-27154610 CTCCGGGCCTGGGAAGGGGGAGG + Exonic
905332748 1:37218397-37218419 CCACTTAAGTGGGAAGTGGGAGG - Intergenic
907976025 1:59432198-59432220 CAAGGTATGTGGGAAGGGGTGGG - Intronic
917719177 1:177769842-177769864 CTAAGTAGGTGGGGTGGGGGTGG - Intergenic
924133432 1:240937091-240937113 CTAATTAGGTGGGAAGGGAGAGG - Intronic
1069021869 10:63497797-63497819 CTAAGTACCTGGGAAAGTGGAGG + Intergenic
1072631758 10:97151344-97151366 ATGCGTACGTGGGAGGGGGAGGG + Intronic
1077052998 11:576077-576099 CTACGTGCGTGGGGGCGGGGTGG + Intergenic
1077515497 11:2999496-2999518 CCACGTTCGTGCGGAGGGGGAGG - Intergenic
1077726753 11:4682606-4682628 CTACATACATGGAAAGGAGGGGG + Exonic
1080074591 11:28134371-28134393 ATACGCACGGGGGAATGGGGTGG - Intronic
1091303530 11:134523138-134523160 CTGGGGAGGTGGGAAGGGGGAGG - Intergenic
1094223564 12:28021446-28021468 CTAGCTACTTGGGAAGTGGGAGG - Intergenic
1096050398 12:48602403-48602425 CTAACTAGGTGGGAAGAGGGAGG - Intergenic
1096613151 12:52816155-52816177 CTAAGTAAGTGGAGAGGGGGTGG + Intergenic
1099228468 12:79996178-79996200 CTACATACATGGAAAGGGAGAGG - Intergenic
1104602161 12:130161699-130161721 CTAAGAAGGCGGGAAGGGGGAGG - Intergenic
1105748458 13:23399504-23399526 CTAATTAGGTGGGAAGGGAGAGG - Intronic
1105837888 13:24226260-24226282 GTACCTAGGTGGGAAGGGGCGGG - Intronic
1106006555 13:25775453-25775475 GTACTTACGTGGGAAGGGTGTGG + Intronic
1106918299 13:34538597-34538619 CTGGGTAGGAGGGAAGGGGGTGG + Intergenic
1108959230 13:56202636-56202658 CTGCCTACGTGGGATGGGTGTGG + Intergenic
1109358001 13:61257438-61257460 CTGTGTATGTGGGAGGGGGGTGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1131245211 15:90786102-90786124 CTAGCTACTTGGGAAGTGGGAGG - Intronic
1140106830 16:71968271-71968293 GTACCTAAGTGGGAAGGAGGTGG - Intronic
1141809919 16:86368960-86368982 CTTCTTACGTGTGGAGGGGGAGG - Intergenic
1143250119 17:5517352-5517374 CTGTGTATGTGGGAGGGGGGGGG - Intronic
1143251491 17:5526430-5526452 CTGAGTAGGTGGGCAGGGGGAGG + Intronic
1146240614 17:31219625-31219647 CTACTTAGGGGGGAGGGGGGAGG - Intronic
1151436485 17:74100720-74100742 CTATGTAAGTGGGGAGGGTGAGG + Intergenic
1151564993 17:74892993-74893015 CTAGGTGAGTGGGGAGGGGGTGG - Intronic
1162737629 19:12755295-12755317 GTAGGTACGTGGGATGGAGGTGG - Intronic
1163290254 19:16374639-16374661 TTAGGTACGTGGGGAGGCGGGGG + Intronic
1165354154 19:35293544-35293566 CTCTGTCCGTGGGAAGAGGGCGG + Intronic
1168630223 19:57950491-57950513 GTTCCTACGTGGGAAGGGGTGGG - Intergenic
929797288 2:45069846-45069868 GTAGGTACTTTGGAAGGGGGGGG + Intergenic
930008308 2:46915474-46915496 CTAGGGACCAGGGAAGGGGGCGG + Intronic
930161671 2:48164708-48164730 CCAGGTAGGTGGGAAGGTGGGGG + Intergenic
937974489 2:127574069-127574091 CTCCCGACCTGGGAAGGGGGAGG - Intronic
938036185 2:128036983-128037005 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938036991 2:128043051-128043073 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
1169263755 20:4155400-4155422 CGGCGTACGTGGGAGTGGGGGGG + Intronic
1169421494 20:5464500-5464522 GTACCTAGGTGGGAAGGGGTGGG + Intergenic
1169617263 20:7462605-7462627 GTATGTACGTGGGTAGGGGGAGG - Intergenic
1172477222 20:35248076-35248098 CTAAGGAGGTGGGAAGGGAGGGG + Intronic
1181375245 22:22452994-22453016 CTAATTAGGTGGGAAGGGAGAGG - Intergenic
1181376057 22:22459180-22459202 CTAATTAGGTGGGAAGGGAGAGG - Intergenic
1183374700 22:37456503-37456525 CTGCGTACCTGGGAAAGGAGAGG - Intergenic
1184653728 22:45930973-45930995 CTCCGTAGGTGTGCAGGGGGTGG - Intronic
949971018 3:9404681-9404703 CTAATTATCTGGGAAGGGGGAGG - Intronic
950385514 3:12656075-12656097 TTATGTAAGTTGGAAGGGGGCGG - Intronic
950602561 3:14047283-14047305 CCAAGTAGGTGGGAAGGGAGAGG + Intronic
950963571 3:17130330-17130352 CTACATAGATGGGAGGGGGGGGG + Intergenic
951359297 3:21705548-21705570 CTACCTACGTGGGCATGGGAAGG + Intronic
955294845 3:57725476-57725498 AAAGGTACCTGGGAAGGGGGAGG - Intergenic
958026876 3:88059209-88059231 CTAGGGAGGAGGGAAGGGGGAGG + Intronic
967985643 3:195093930-195093952 CCACGGACGTGGGCTGGGGGAGG - Intronic
970073275 4:12187673-12187695 CTGGGAAGGTGGGAAGGGGGAGG - Intergenic
977309971 4:95373762-95373784 TTACAAATGTGGGAAGGGGGTGG + Intronic
980086241 4:128393205-128393227 TTACCTAAGTGGGGAGGGGGAGG + Intergenic
983938552 4:173519486-173519508 CTGTGTGCGTGGGGAGGGGGCGG - Intergenic
988476304 5:31589093-31589115 CTAATTAGGTGGGAAGGGAGAGG + Intergenic
990315420 5:54578498-54578520 CTACGTACTTGGGAATAGGCAGG + Intergenic
992891888 5:81211310-81211332 CTAGGTAGGTGGGAAGGGGAGGG - Intronic
992901587 5:81301953-81301975 CTACGTACGTGGGAAGGGGGAGG - Exonic
996827697 5:127703795-127703817 TTACTGATGTGGGAAGGGGGAGG + Intergenic
998138263 5:139685728-139685750 CTACGGAGGTGGGAAGTGGGAGG - Intergenic
1002061709 5:176629519-176629541 CTACGTCGGTGGGTAAGGGGCGG - Exonic
1007330164 6:41100856-41100878 CTAAGAATGTGGGAAGGTGGTGG + Intergenic
1011574599 6:88782036-88782058 CTAGGTAAGTGGGCACGGGGAGG - Intronic
1018935541 6:168271711-168271733 GTACCTGGGTGGGAAGGGGGCGG - Intergenic
1024788740 7:52938425-52938447 ACAAGTACATGGGAAGGGGGTGG + Intergenic
1026560309 7:71443262-71443284 CTGGGTACGTGGGGAGAGGGAGG + Intronic
1029801439 7:102951694-102951716 CTACTTAGGTGGGAGGTGGGAGG + Intronic
1032475741 7:132210515-132210537 CTATGTAGGTGTGAAGGTGGTGG + Intronic
1032775993 7:135113631-135113653 CTACATACTTGGGAAGTGGGTGG - Intronic
1033661847 7:143408187-143408209 CTACCTGCCTGGGAAGTGGGGGG + Intronic
1035344559 7:158189658-158189680 TAACATACGAGGGAAGGGGGAGG - Intronic
1036173620 8:6514814-6514836 CTACGTAAGGGGGGAGTGGGGGG - Intronic
1038677299 8:29634961-29634983 ATGCGTATGTGAGAAGGGGGAGG + Intergenic
1048965080 8:139609244-139609266 CTAGGTAGGTGGGGGGGGGGTGG - Intronic
1062441533 9:136571844-136571866 CTAAGGACGTGAGAAGGGCGAGG - Intergenic
1186294299 X:8132123-8132145 GTACGTACATGTGAAGGGGCTGG + Intergenic
1195318823 X:103704738-103704760 GTACATATGTGGGAAGGGTGAGG + Intergenic