ID: 992902400

View in Genome Browser
Species Human (GRCh38)
Location 5:81310989-81311011
Sequence CAGGTGCAAGAAGCAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992902396_992902400 -8 Left 992902396 5:81310974-81310996 CCTACTTCTCAAGGCCAGGTGCA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 406
992902392_992902400 18 Left 992902392 5:81310948-81310970 CCTTCCATCATATCTCATTTCTT 0: 1
1: 0
2: 2
3: 45
4: 579
Right 992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 406
992902393_992902400 14 Left 992902393 5:81310952-81310974 CCATCATATCTCATTTCTTTTTC 0: 1
1: 2
2: 9
3: 145
4: 1275
Right 992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG 0: 1
1: 0
2: 1
3: 32
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992902400 Original CRISPR CAGGTGCAAGAAGCAGTGGG TGG Intronic
900500058 1:2999952-2999974 CAGGTGCCAGGAGGAGTGCGAGG + Intergenic
900876936 1:5349542-5349564 CATGTGCAAGAAGCAGGATGAGG + Intergenic
900908282 1:5576139-5576161 CAGGTGCGAGAGGCAGTTTGGGG - Intergenic
901449819 1:9329155-9329177 CAGTTGTATGAAGCAGTGTGAGG + Intronic
901985841 1:13074556-13074578 CAGGGACAAGAAGCAGGGAGGGG + Intronic
901995968 1:13152211-13152233 CAGGGACAAGAAGCAGGGAGGGG - Intergenic
902567619 1:17322852-17322874 CAGAAGAAAGAAGAAGTGGGAGG - Intronic
903330634 1:22595309-22595331 CATCTGCAAGAAGAGGTGGGTGG + Exonic
904839258 1:33361193-33361215 CAGGTGCAGTGGGCAGTGGGGGG + Intronic
905272114 1:36793969-36793991 CAGGTCCAGCAAGGAGTGGGGGG - Intergenic
905408798 1:37754214-37754236 CGGGTGCAGGAAGCCGAGGGCGG + Exonic
905516105 1:38563235-38563257 CAGGGGCAAGAGGAAGTGGTGGG - Intergenic
905766705 1:40607531-40607553 CAGGTGGAAGAAGTAGGGTGAGG - Intergenic
909157590 1:72098139-72098161 AAAGAACAAGAAGCAGTGGGAGG + Intronic
909683486 1:78319370-78319392 AAGCTGCAAGAGGCAGTGAGAGG + Intronic
910206575 1:84754390-84754412 CAGGTGCGATGGGCAGTGGGGGG - Intergenic
912457565 1:109807984-109808006 CAGGTGCATGTGGCTGTGGGTGG - Intergenic
914975476 1:152356961-152356983 CAGGTTCAGGAGACAGTGGGAGG - Exonic
915304970 1:154971874-154971896 CAGTGGCAGGAAGCCGTGGGTGG - Intronic
915763030 1:158334741-158334763 CAGGGGCAGGAAGCAGGTGGTGG + Intergenic
919177073 1:194032754-194032776 CAGGAGCAAGAAGGAATGGAGGG + Intergenic
920697868 1:208195461-208195483 GAGGTGCAAAAAGTAGGGGGTGG - Intronic
922060513 1:222086268-222086290 CTTGTGCAAGAGGGAGTGGGGGG + Intergenic
922624712 1:227027428-227027450 CAGGTGCAAGAATTACTTGGGGG - Intronic
922653974 1:227364818-227364840 TAGGTGGCAGAAGCAGTGGGAGG + Intergenic
923794372 1:237139364-237139386 CAGGGGCTAAAGGCAGTGGGAGG + Intronic
923988588 1:239409418-239409440 CAGGTGCAACAAGGATTAGGTGG - Intronic
1062954320 10:1530113-1530135 AAGGTGGCAGGAGCAGTGGGTGG - Intronic
1063726551 10:8643323-8643345 AAAGTGCAAGAACCATTGGGAGG + Intergenic
1065942805 10:30580296-30580318 AATGTGCACGAAGCAGTTGGTGG - Intergenic
1066954429 10:42150631-42150653 TAGGGGCAAGAAGCCGTGGCAGG + Intergenic
1067289072 10:44928370-44928392 CAGGTGGATGAAGAGGTGGGTGG - Intronic
1067345215 10:45433325-45433347 CAGGTGCATGTTGCAGTGGGCGG + Intronic
1067476499 10:46570867-46570889 CAGCTGGAAGAAGAAGAGGGTGG + Intergenic
1067618239 10:47770914-47770936 CAGCTGGAAGAAGAAGAGGGTGG - Intergenic
1067731039 10:48811796-48811818 GAGCTGGAAGAAGCAGAGGGAGG - Intronic
1068132225 10:52909081-52909103 CAGGTGCAAGAAGGACGAGGAGG + Intergenic
1068210803 10:53917907-53917929 CAGGAGCAAGAGGGAGGGGGAGG - Intronic
1068562757 10:58534330-58534352 CCTTTGAAAGAAGCAGTGGGCGG + Intronic
1068598785 10:58933893-58933915 CATGTGCAAGGAGCAGGGGCTGG + Intergenic
1069299137 10:66884758-66884780 GAGGGGCAAGAAACAGAGGGAGG + Intronic
1069782591 10:70966084-70966106 CAGGTGGGAGCAGGAGTGGGGGG - Intergenic
1070755614 10:78990883-78990905 CAGGTGGAAGTTGCAGTGAGTGG + Intergenic
1070923903 10:80205554-80205576 CAGGTGCCAGAGGCAGTGCAAGG + Exonic
1071116474 10:82227147-82227169 CAAGTACAAGCTGCAGTGGGTGG - Intronic
1072196539 10:93121247-93121269 CAGGTGGAGGGAGCAATGGGTGG + Intergenic
1072725768 10:97812659-97812681 CAGGTTGAAGAAGCAGGGGCCGG - Intergenic
1074780681 10:116799942-116799964 CAGGTGAATGAAAAAGTGGGTGG + Intergenic
1075206605 10:120454680-120454702 TAGGTGCAAGGAGCAGAAGGTGG - Intergenic
1075778274 10:125001773-125001795 CAGGTACCGGAAGCACTGGGTGG - Intronic
1076375737 10:129983509-129983531 GGGGTAGAAGAAGCAGTGGGAGG + Intergenic
1077072836 11:684926-684948 CAGGTGCAAGAGGCAGCGTGAGG + Exonic
1077416733 11:2427444-2427466 CAGGTGCCAGGAGTTGTGGGCGG - Intergenic
1078897981 11:15615067-15615089 CAGGTGAAAAAAGCACTGTGAGG - Intergenic
1079133775 11:17764639-17764661 CCGGCGCAAGGGGCAGTGGGCGG - Intronic
1079680705 11:23293853-23293875 CAGGAGCAAGAAACAGAGTGGGG + Intergenic
1079871486 11:25803668-25803690 CAGGTGGAAGTTGCAGTGAGTGG - Intergenic
1081642499 11:44765961-44765983 CATGTACAAGAAACAGTGCGGGG - Intronic
1081915539 11:46728076-46728098 CGGGTACAGGAGGCAGTGGGCGG - Exonic
1082080137 11:48006402-48006424 CAGGTGCAGGCAGGTGTGGGAGG + Intronic
1083470344 11:62880135-62880157 CAGGTGCTAGCAGCTGGGGGTGG + Intronic
1083570534 11:63759408-63759430 CAGCTGCAAAAAGTAGTGGAAGG + Exonic
1085263976 11:75225466-75225488 CAGCTGCAGGACACAGTGGGGGG + Intergenic
1085324086 11:75593510-75593532 CAAGGGCAGGAATCAGTGGGAGG - Intronic
1086642417 11:89176085-89176107 CAGGTACATGGAGCAGTGTGTGG - Intergenic
1086913858 11:92505088-92505110 CAGGTGGATGGAGCAGTGAGTGG + Intronic
1087051980 11:93895650-93895672 CAGGAGCAAGAAGGAGAAGGGGG + Intergenic
1087407945 11:97752769-97752791 CAGGTGCCAGGAGCAGGGAGAGG + Intergenic
1087910949 11:103752798-103752820 CAGCTGCCAGAAGCTGGGGGAGG + Intergenic
1088172646 11:107016699-107016721 CAGGTGCAAGAAGTACAGAGCGG + Intronic
1088172652 11:107016789-107016811 CAGGTGCAAGAAGTACAGAGAGG + Intronic
1088172658 11:107016879-107016901 CAGGTGCAAGAAGTACAGAGCGG + Intronic
1088741799 11:112773621-112773643 CAGGTTCAAGAGACAGTGGTGGG + Intergenic
1088853624 11:113726216-113726238 CAGGTGAAAGAGGCAGTGTTAGG - Intergenic
1089300861 11:117497888-117497910 CATCTGCAAGCAGCAGGGGGAGG - Intronic
1089634604 11:119804191-119804213 CAGGTGCAAGGAGAGGTGGAAGG + Intergenic
1089736055 11:120550877-120550899 CAGGTGCACAGAGCAGTGGCTGG + Intronic
1090794078 11:130119226-130119248 GAGATGCAGGAAGCAGTGGCAGG - Intronic
1093305287 12:17509443-17509465 CAGGTGGAAGAAGAGGTGGATGG + Intergenic
1093426181 12:19031891-19031913 TGGCTGCAGGAAGCAGTGGGGGG + Intergenic
1096099137 12:48958214-48958236 CAGGTGCAAAACGGAGTGTGAGG - Intergenic
1096492635 12:52021121-52021143 CTGGGACCAGAAGCAGTGGGAGG - Intergenic
1096513267 12:52143577-52143599 TAAGTTCTAGAAGCAGTGGGTGG + Intergenic
1096748828 12:53745935-53745957 GAGAGGCAAGAAGCAGTGGTGGG + Intergenic
1096851722 12:54443303-54443325 GAGGTGAGAGAAGCAGTGGGAGG - Intergenic
1096882858 12:54686638-54686660 GCAGTGGAAGAAGCAGTGGGGGG + Intergenic
1097140610 12:56899939-56899961 GAAGTGCAAGAAGTAGTGGCAGG + Intergenic
1098290928 12:68956230-68956252 CAGGTGCCAGGAGCAGGGAGAGG + Intronic
1099578258 12:84406849-84406871 CAGGTTCAGGAATCAGGGGGTGG + Intergenic
1101543268 12:105684085-105684107 CGGGTCCAAGAATCAGGGGGTGG + Intergenic
1101551943 12:105771422-105771444 CAGGAGAAAGAAGCAGTTTGGGG + Intergenic
1102015867 12:109647628-109647650 CTGATGCCAGAAGCAGTGAGGGG + Intergenic
1102193137 12:111004411-111004433 CAGATGCAGGAAGGAGAGGGAGG - Intergenic
1103563900 12:121805924-121805946 CATGTGCAAGAAGTATGGGGAGG + Exonic
1104461417 12:128959395-128959417 CAGCTTCATGAGGCAGTGGGGGG + Intronic
1105424418 13:20282663-20282685 CAGGTGCCAGGAGCAGAGAGAGG - Intergenic
1106032817 13:26018048-26018070 CAGGAGGAAGAGACAGTGGGCGG - Intronic
1108275686 13:48807403-48807425 CAGGTGCAGGCTTCAGTGGGGGG - Intergenic
1108754643 13:53485201-53485223 CAGGAGCAAGAGGCAGGGGGAGG - Intergenic
1108904470 13:55451407-55451429 CAGGTCCAGGAAGCAAGGGGTGG + Intergenic
1109134194 13:58625960-58625982 CTGGTGACAGTAGCAGTGGGTGG - Intergenic
1110411293 13:75206108-75206130 CAGGAGCAAGAGACAGTGAGGGG + Intergenic
1110440253 13:75518879-75518901 CAGGTGCCAGGAGCAGGGGGTGG - Intergenic
1111000001 13:82165836-82165858 CAGCTGCAAGATGCCCTGGGAGG + Intergenic
1111274842 13:85935439-85935461 CAGGAGCTATAAACAGTGGGAGG + Intergenic
1112089990 13:96072947-96072969 AAGGTTCAGGAAGCAGTGAGTGG - Intergenic
1112250448 13:97774472-97774494 CAGATGGAAGAAGGAGAGGGAGG - Intergenic
1112326619 13:98446142-98446164 CGGGTGGCAGAAGCTGTGGGTGG + Exonic
1113692788 13:112323632-112323654 CAGGGGCAGGAAGCGGAGGGAGG - Intergenic
1114644848 14:24249617-24249639 CAGGAGGAAGAAGCAGGAGGTGG + Intronic
1115474691 14:33801242-33801264 CAGGTGAAAGAAAGAGGGGGTGG - Intronic
1115475576 14:33810154-33810176 CAGGTGAAAGAGGCAGGTGGAGG + Intergenic
1115648185 14:35384615-35384637 CAGGTTCAAGATGCACTGTGAGG - Intergenic
1115851242 14:37591964-37591986 CAAGTGCGAGAAGCAGCCGGGGG - Exonic
1119172134 14:72543742-72543764 CTGTCTCAAGAAGCAGTGGGAGG - Intronic
1119718361 14:76874511-76874533 CAGGGGCCAGCAGCACTGGGGGG + Intergenic
1121210648 14:92206080-92206102 CAGGGGAAGGAAGCAGTGGAAGG - Intergenic
1121690912 14:95876621-95876643 TTGGGGCAGGAAGCAGTGGGGGG + Intergenic
1121734650 14:96209622-96209644 CATGTGAAAGAAGCAGGTGGAGG + Intronic
1121911787 14:97798486-97798508 CTGGTGCAGGAGGCTGTGGGAGG - Intergenic
1121963000 14:98278392-98278414 CAAGTGCATGAAGCTGTGTGAGG - Intergenic
1122003363 14:98682903-98682925 CAGGTGCCAGAAACATTGAGAGG + Intergenic
1125326096 15:38537398-38537420 CAGGAGCAAGAGGGAGAGGGAGG + Intronic
1125598682 15:40903618-40903640 GAGGTGCTAGAGGCAGGGGGTGG - Exonic
1126185788 15:45829545-45829567 CAGGTGCTAGGAGCAGAGAGAGG + Intergenic
1126878531 15:53070162-53070184 CAGGTGAAGGAAGCACTGGGTGG + Intergenic
1126916151 15:53468309-53468331 CATGTGCAAGAAATAATGGGAGG - Intergenic
1127329523 15:57924882-57924904 AAGGTCCTAGAAGCAGAGGGAGG + Intergenic
1128130509 15:65224191-65224213 GAGGTGCGAGGAGCAGTGGTCGG - Intergenic
1128147249 15:65338587-65338609 CAGGTGCAAGAGGGAGGGTGTGG + Intronic
1128259463 15:66222430-66222452 TAGGTGCAAGAGGCTGTGGGTGG - Intronic
1129525800 15:76213476-76213498 CAGGTGCATGAGGCAGTGAGGGG - Intronic
1130083887 15:80761202-80761224 GAGGTGCAGGAAGCAGTGACGGG + Intergenic
1130706399 15:86236987-86237009 CAAGGGCAAGAAGATGTGGGTGG + Intronic
1131929858 15:97429731-97429753 CAGGAGCAAGAAGGGGAGGGAGG - Intergenic
1132678646 16:1130863-1130885 CGGGGGCCAGATGCAGTGGGGGG + Intergenic
1132694656 16:1196514-1196536 TAGGGGCCAGAAGCAGTGGCGGG - Intronic
1133929243 16:10218706-10218728 GAGGTGCTGGAAGCACTGGGTGG - Intergenic
1134460114 16:14423192-14423214 CAGGGGCAAGAAGAAGAGAGGGG + Intergenic
1135414460 16:22258146-22258168 CTGGTCCAAGTAGCAATGGGAGG - Intronic
1137218784 16:46427228-46427250 CGGGGGCAAAAAGCAGCGGGAGG + Intergenic
1137566408 16:49535262-49535284 GAGGTGCAAGCAGCCCTGGGTGG + Intronic
1138198753 16:55073683-55073705 CAGGAGCAGGATTCAGTGGGGGG + Intergenic
1138458021 16:57132467-57132489 CAGGTGGTAGAGGCAGCGGGTGG - Intronic
1139084084 16:63562757-63562779 CAGGAGCAAGAGAGAGTGGGAGG - Intergenic
1139183290 16:64771813-64771835 CAGGAGGAAGAGGCAGCGGGAGG + Intergenic
1139244259 16:65426081-65426103 CTGCTGGAAGAAGCAGTCGGTGG + Intergenic
1141079817 16:81040304-81040326 AAGGCCCCAGAAGCAGTGGGTGG + Intronic
1141096298 16:81165472-81165494 CAGGCCCAAGGAGCAGTGGCTGG + Intergenic
1141343656 16:83226475-83226497 CAGGTGCAAAGACCAGTGTGGGG - Intronic
1141413364 16:83851658-83851680 AAGGTGCAAGAAGCAGAGGAGGG - Intergenic
1141432430 16:83977367-83977389 CAGGTGGAAGGAGCTGAGGGTGG + Intronic
1141469451 16:84228614-84228636 CAGCTGCTAGAAGGAGTGGGCGG - Intronic
1141617934 16:85220889-85220911 AAGCTGGAGGAAGCAGTGGGGGG - Intergenic
1142696952 17:1639066-1639088 CAGGGGCAAGAACCTGTGGAGGG - Intronic
1143432470 17:6897137-6897159 GAGGAGGAAGAAGAAGTGGGAGG + Intronic
1143769348 17:9158146-9158168 CAGCTCCAAGAAGCAGGGGAGGG + Intronic
1143904870 17:10199892-10199914 GAGGTGGAAGTTGCAGTGGGCGG + Intergenic
1143991309 17:10964793-10964815 CAGGAGCAAGAAACAGGGTGTGG - Intergenic
1144204951 17:12973664-12973686 CAAGTGCAAGACGAGGTGGGAGG - Intronic
1144671599 17:17135861-17135883 TAGGGGCAAAAAGCAGAGGGTGG + Intronic
1144939525 17:18928369-18928391 AAGTAGCAAGAAGAAGTGGGGGG + Intronic
1145302420 17:21649900-21649922 CAGAAGGAAGAAGCAGAGGGAGG - Intergenic
1145347900 17:22053412-22053434 CAGAAGGAAGAAGCAGAGGGAGG + Intergenic
1145415693 17:22711970-22711992 CAGAAGGAAGAAGCAGAGGGAGG - Intergenic
1147150217 17:38510018-38510040 CAAGCGCAAGAAGCGGCGGGAGG + Exonic
1147419680 17:40316310-40316332 CAAGGGCATGAAGCAGAGGGTGG - Intronic
1147770835 17:42866888-42866910 AAGGTGCAAGAGGAAGTGGGGGG - Intergenic
1148529583 17:48376956-48376978 CAGGCCCAAGATGCAGAGGGAGG + Intronic
1148683170 17:49486214-49486236 CAGGTACAGGAAGTGGTGGGAGG + Intergenic
1148843914 17:50517553-50517575 AAGGGGAAAGAAGCTGTGGGTGG - Intronic
1150007639 17:61479576-61479598 CAGGAGAAAGAATCAGAGGGTGG + Intronic
1150448535 17:65246343-65246365 CAGGAGGAGGAAGCAGTGTGGGG + Intergenic
1151388307 17:73768985-73769007 CAGGTGCTACAAGCTGTGGCGGG + Intergenic
1151937566 17:77272208-77272230 CAGGTGTCAGAGGCAGTGGCGGG + Intergenic
1152196905 17:78923809-78923831 GTGGGGCAAGAAGCCGTGGGCGG + Intronic
1152268364 17:79309403-79309425 CAGGTGTGAGAAGCAGCAGGAGG - Intronic
1152374962 17:79914233-79914255 CAGATGCAAAATGCAGGGGGTGG - Intergenic
1153410702 18:4789459-4789481 CAAGTGGAGGATGCAGTGGGAGG - Intergenic
1154086713 18:11312825-11312847 CAGGTGCAGGAAGCCGAGGCCGG + Intergenic
1154204162 18:12323310-12323332 CAGATGCACGTAGGAGTGGGAGG - Intronic
1156115347 18:33780722-33780744 CAGGAGCAAGCAAGAGTGGGGGG + Intergenic
1158626359 18:59075131-59075153 CAGGGGAAAGACCCAGTGGGAGG + Intergenic
1158820225 18:61150719-61150741 CAGGTGCAGAAAGGAGTGAGAGG + Intergenic
1159767117 18:72503349-72503371 CTGGTGCTAGCCGCAGTGGGCGG - Intergenic
1160477806 18:79208351-79208373 CAGGTGGCAGAAACAGTGTGAGG + Intronic
1160680072 19:408415-408437 CAGGGGTCAGGAGCAGTGGGGGG + Intronic
1161631483 19:5358865-5358887 CAGGTGCAAGATGCAGCTGAGGG - Intergenic
1162239472 19:9337684-9337706 CATGTGCCAGAAACAGTGGTAGG - Intronic
1163811703 19:19436605-19436627 CAGCTCCAAGAACCAGTGTGGGG - Intronic
1164683222 19:30149806-30149828 CAGGTGGGAGAAGGAGTGGCAGG + Intergenic
1165061310 19:33206584-33206606 AAGGCCCTAGAAGCAGTGGGCGG - Exonic
1165401089 19:35600785-35600807 CAGGGGCAAGATGGAGAGGGAGG - Intergenic
1166435308 19:42762396-42762418 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166448174 19:42876386-42876408 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166464856 19:43023165-43023187 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166470976 19:43079347-43079369 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166482132 19:43183263-43183285 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166484615 19:43202381-43202403 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166491738 19:43266262-43266284 TAGGGGCAAGAGGTAGTGGGGGG + Intronic
1166824531 19:45600875-45600897 CAGATGGAAGAAGCATTGGAGGG - Intronic
1167655092 19:50758603-50758625 CAGGTGGAAGAAGCAGACGGTGG - Intergenic
1167656894 19:50770830-50770852 CAGGTGGAAGAAGCAGACGGTGG - Exonic
925131032 2:1494181-1494203 TAGGTTAAAGAAGCTGTGGGTGG - Intronic
925776048 2:7337250-7337272 CAGGGGCAGGAAGCACTAGGTGG + Intergenic
927256671 2:21045458-21045480 CAGGTGCAGGAAGCAGGCGAAGG - Intergenic
927477015 2:23421149-23421171 CAGGTGGAAGAAACATTGAGTGG - Intronic
927686964 2:25177922-25177944 GTGGAGGAAGAAGCAGTGGGAGG + Intergenic
928317745 2:30258930-30258952 CCCTTGCAGGAAGCAGTGGGAGG - Exonic
929766750 2:44850132-44850154 CAGGTGAGAGGAGCAGTGGATGG - Intergenic
930164833 2:48194772-48194794 CAGGTGCAGGAAGAATTGGCAGG - Intergenic
930310994 2:49739334-49739356 CAGGTGCAAGAGGGAAAGGGAGG + Intergenic
930477518 2:51902203-51902225 CAGGTGCAGGAAGCAGGGGATGG + Intergenic
931627228 2:64267739-64267761 CAGTTGCAAGAAGCAGGATGGGG - Intergenic
933154524 2:78958530-78958552 CAGGAGCACGAAGCTGTGGAAGG + Intergenic
933571862 2:84023287-84023309 CAGGTGCAAGAAGGCCTTGGAGG + Intergenic
934035639 2:88086578-88086600 CACGTGCAGGAAGCAGGGAGGGG - Intronic
934557473 2:95294969-95294991 CAGGTGCTAGCTGCAGTGGGAGG + Intergenic
934718832 2:96558823-96558845 CAGCTTCAAGAAGCAGTTGTGGG - Intergenic
936146555 2:109984444-109984466 CAGGAGCAAGAAGCTGGTGGCGG - Intergenic
936198135 2:110387035-110387057 CAGGAGCAAGAAGCTGGTGGCGG + Intergenic
938149345 2:128868672-128868694 CAGGTGAAGGTAGAAGTGGGTGG - Intergenic
938157945 2:128957461-128957483 CAGAAGTAAAAAGCAGTGGGAGG + Intergenic
938314989 2:130319057-130319079 CAGGTACATCCAGCAGTGGGAGG - Intergenic
938604716 2:132880557-132880579 GAGGTGCAGGATGCAGTGAGTGG + Intronic
939306684 2:140420835-140420857 GGGGTGCAGGAAGCAGTGGGAGG + Intronic
939376555 2:141375754-141375776 CATAGGCAAGAAGCCGTGGGTGG + Intronic
939661101 2:144891027-144891049 AAGCTTTAAGAAGCAGTGGGTGG + Intergenic
939705260 2:145444953-145444975 CATGCCCAAGAAGCAGTGAGAGG - Intergenic
939779729 2:146430914-146430936 CAGGAGCAAGAGAGAGTGGGGGG - Intergenic
940026203 2:149211084-149211106 CAGGAGCAAGAAAGAGAGGGGGG + Intronic
941855747 2:170228591-170228613 TAGGTGCAAAAATCAGTGTGTGG + Intronic
943639164 2:190340555-190340577 CGGGAGCAAGAAGGAGTTGGGGG - Intronic
944351279 2:198730165-198730187 CAAGTCAAAGAGGCAGTGGGTGG - Intergenic
944932050 2:204529859-204529881 CAGGGGCAACAAGCAGAGGCTGG - Intergenic
946126327 2:217566223-217566245 CTGGAGCAGGAAGAAGTGGGGGG + Intronic
946198299 2:218053100-218053122 CAGGTGCAAGACACAGTGCCTGG + Intronic
946403441 2:219480788-219480810 GCAGTGCAAGAAGGAGTGGGGGG - Intronic
946782514 2:223205817-223205839 TGGGTGCCAGCAGCAGTGGGTGG - Intergenic
948664471 2:239526477-239526499 CAGGAGAAAGATGCAGTGTGCGG - Intergenic
948943445 2:241207668-241207690 CAGGTACGAGAAGAGGTGGGTGG + Exonic
1170389977 20:15861687-15861709 CAGGGGCAAGAAGTAGGGGCTGG - Intronic
1171322951 20:24262403-24262425 GAGGTGATAGAAGCACTGGGTGG - Intergenic
1171425114 20:25044092-25044114 CAGGTGCAGGAAGCAGCCTGAGG - Intronic
1172681218 20:36716822-36716844 CAGGTACAAGAGGCAGTAGATGG + Intronic
1173173788 20:40748570-40748592 CAGGTGCAAAAAAGAGTGGATGG + Intergenic
1173444003 20:43101666-43101688 CAGGTGTTACAAGTAGTGGGAGG + Intronic
1173837932 20:46138086-46138108 CAGGGGCAAGAAGCAGGAGTGGG - Intergenic
1174098705 20:48110023-48110045 CAGGTGCATGAATGAGTGGATGG - Intergenic
1175302749 20:57954383-57954405 CATGGGCAAGATGCAGTGGGAGG + Intergenic
1175352284 20:58332426-58332448 AAGGTGCAAGAATCCATGGGTGG + Intronic
1176653150 21:9567726-9567748 CAGAAGGAAGAAGCAGAGGGAGG - Intergenic
1177606461 21:23384945-23384967 AAGGTGGAAGAAGCAGAGTGGGG - Intergenic
1178325444 21:31641767-31641789 CAAGGGCAAGAAGAAGAGGGTGG + Intergenic
1179615729 21:42582153-42582175 CAGGAGCGGGAAGCATTGGGTGG - Intergenic
1180161610 21:46000870-46000892 CAGGTGCAGGGAGCTGCGGGCGG - Intronic
1180611582 22:17101695-17101717 CGGGGACAAGAAGCTGTGGGTGG + Intronic
1180966281 22:19789475-19789497 CAAGAGCAAGACCCAGTGGGGGG + Intronic
1181019912 22:20094318-20094340 CAGGTGGCAGCAGCAGTGGCTGG - Intronic
1183181628 22:36264037-36264059 CAGGTCCAGCAAGCAGTGGGTGG + Intronic
1183337198 22:37256574-37256596 CAGGTGTAGGAAGCAGGGGTGGG - Intergenic
1183488275 22:38102008-38102030 CATGTGGATGGAGCAGTGGGAGG + Intronic
1184022737 22:41832331-41832353 GAGGTGCTTGAAGGAGTGGGTGG + Intergenic
1184531052 22:45056012-45056034 CGGATGCACGAAGAAGTGGGAGG + Intergenic
950150399 3:10682399-10682421 CAGGTGCATGAAGGAGCTGGGGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950668752 3:14512746-14512768 CAGGGGCAAACAGCAGCGGGAGG + Intronic
950705987 3:14782118-14782140 CAGGAGCAAGAGAGAGTGGGTGG - Intergenic
950707160 3:14790027-14790049 CAGGTGCAAGAGGCAGGGACAGG + Intergenic
951925852 3:27908166-27908188 CAGGAGCAAGAACGAGTGTGAGG + Intergenic
952144028 3:30512086-30512108 CAGGAGCAAGAAGGAGAGAGAGG - Intergenic
953289759 3:41649511-41649533 GAGGTGCCAGGAGCAGGGGGAGG - Intronic
953391017 3:42533806-42533828 CAGGTCCAGGAAGGAGTGGGAGG + Intronic
954022487 3:47754677-47754699 CAGGTGCAAAAATCAAAGGGAGG + Intronic
954461880 3:50631549-50631571 CAGGTGCCAGCAGCACTGGCAGG + Intronic
955238396 3:57159869-57159891 CAGGCTGAAGAGGCAGTGGGGGG + Intronic
955774134 3:62415483-62415505 CAGGTGCATTAAGGAGTTGGGGG - Intronic
956080126 3:65549034-65549056 CAGGTGCAAGGAGACGCGGGCGG - Intronic
956400424 3:68873722-68873744 CATTTGCAAGAAATAGTGGGAGG - Intronic
956606595 3:71079106-71079128 CAGGGGCAAGACAGAGTGGGTGG - Intronic
957201838 3:77146209-77146231 CAGGTGCTGGGAGCAGGGGGCGG - Intronic
958498476 3:94875175-94875197 CAGGTGCTGGAAGCAGGGAGAGG + Intergenic
959143792 3:102519548-102519570 CAGGAGGAAGAAGCAGAGGATGG - Intergenic
959257126 3:104029852-104029874 CAGGTGGAAGAAGGGGTGAGGGG - Intergenic
960349713 3:116577147-116577169 CAGGTGCAGGAATCAAGGGGTGG + Intronic
960549809 3:118962529-118962551 CAGGTGGAAGAAGTATTTGGGGG + Intronic
960724865 3:120659927-120659949 CAGGAGCAAGAGAGAGTGGGGGG + Intronic
962441853 3:135427289-135427311 CAGGTGCAAGACAGAGTGAGGGG - Intergenic
963009614 3:140756716-140756738 GAGGAGCAAGAGGCAGTGTGGGG + Intergenic
963129784 3:141847551-141847573 CATGTGCAAGAAGCAGCTGCAGG - Intergenic
964784061 3:160374103-160374125 GAAGTGGAAGAAGCACTGGGAGG + Intronic
966258692 3:177949739-177949761 CCAGTGCAAGAAGCCGTGTGGGG - Intergenic
967297345 3:187978312-187978334 AAGGTGAAAGAGTCAGTGGGTGG + Intergenic
967327620 3:188257959-188257981 CAGGTGAAAGTAGGAGTGTGTGG - Intronic
967812407 3:193771917-193771939 CGGCTGTGAGAAGCAGTGGGCGG + Intergenic
967999375 3:195193215-195193237 GAGGTGGAGGATGCAGTGGGCGG + Intronic
968059564 3:195717035-195717057 CAGGTGCCAGCTGCAGTGCGTGG - Intergenic
968838410 4:2982033-2982055 CAGGTGCCAGGAGCAGTGAGAGG + Intronic
968841240 4:3007434-3007456 CATGTGCAAGACACAGTGGAAGG - Intronic
968904807 4:3446273-3446295 CCTGTGGGAGAAGCAGTGGGCGG - Exonic
969458946 4:7317491-7317513 CAGGAGCAAAAAGCACAGGGCGG - Intronic
969853108 4:9977558-9977580 CAGGTGTCAGGAGCAGGGGGAGG - Intronic
970704423 4:18783061-18783083 CAGGTCCAAGAATCAAGGGGTGG + Intergenic
971092352 4:23360551-23360573 CAGGTGCTGGGAGCAGTGAGAGG - Intergenic
971527013 4:27632717-27632739 CAGGTGGATTAAGCATTGGGGGG + Intergenic
973142135 4:46781988-46782010 CAGGTGCCACAAGCAGGGGGCGG - Intronic
977453515 4:97227861-97227883 CAGGTGCAAGAAAAGGAGGGAGG + Intronic
977553985 4:98470270-98470292 CAGGTGTCAGAATCACTGGGAGG - Intergenic
978353910 4:107850122-107850144 CAGGATCAAGAGACAGTGGGAGG - Intronic
979595510 4:122530170-122530192 CAGGTTCAAGAATCACAGGGTGG - Intergenic
981049671 4:140297769-140297791 GAGGTGCAGGAGACAGTGGGGGG + Intronic
981287389 4:143034506-143034528 CAGGAGCAAGAAGGAGGGGAGGG + Intergenic
981494629 4:145377495-145377517 CAGCTGCAAAAAGTAGTGGAAGG + Intergenic
981588358 4:146328439-146328461 CAGGTGTCAGCAGCAGTAGGTGG - Intronic
982158134 4:152540889-152540911 CAGGTGCTAGGAGCAGGGAGAGG + Intergenic
985073264 4:186189822-186189844 CAGGTGCAGGATGAGGTGGGTGG - Intergenic
986048368 5:4063243-4063265 CAGGAGCAAGAAACAGAGTGAGG - Intergenic
986207598 5:5640056-5640078 CAAGAGCAAGAAACAGTGTGTGG + Intergenic
986387044 5:7244799-7244821 CAGAAGCAAGGAGCAGGGGGAGG + Intergenic
986501378 5:8403528-8403550 CAGGAGAAAGAAGCAGGGTGAGG - Intergenic
987032228 5:13986635-13986657 AAGGTGCAAGAAGCAGATGCAGG - Intergenic
987934294 5:24443918-24443940 AATGTGCAAGAGGCAGTGGAAGG + Intergenic
990663222 5:58042345-58042367 CAGGTGAAAGAAGCCCTTGGAGG - Intergenic
991946347 5:71901568-71901590 CAGGTCCAAGAATCAAGGGGTGG + Intergenic
992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG + Intronic
995145939 5:108787156-108787178 CAGGCGCCAGAAGCAGGGAGAGG - Intronic
995441977 5:112202392-112202414 AAGGTGCAAAAAGCAGAGAGTGG - Intronic
995933572 5:117481892-117481914 CAGGTGCAGTAAGCAGCAGGTGG + Intergenic
997147978 5:131458205-131458227 CAGGGGAAGGACGCAGTGGGAGG + Intronic
997443344 5:133924390-133924412 CAGATGCAAGACACAGAGGGAGG - Intergenic
998401234 5:141850125-141850147 CAGGTGCAGGATGGGGTGGGAGG - Intergenic
998662426 5:144254676-144254698 CAGTTGCCAGAGGCTGTGGGAGG - Intronic
998711722 5:144833541-144833563 CAGGAGCAAGAAAGAGGGGGAGG - Intergenic
999195441 5:149778538-149778560 CAGCCGCAAGCAGCTGTGGGAGG - Intronic
999315224 5:150579254-150579276 CAGGTGCCAGGAGCAGGGAGAGG - Intergenic
1000300366 5:159951022-159951044 CAGGGGCACTAAGCAGTTGGTGG + Intronic
1000594869 5:163203113-163203135 CAGGTTAAAGAAGTAGTGGAGGG + Intergenic
1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG + Intronic
1001228843 5:169968491-169968513 CAGGTGGAAGAAACATTGGGGGG + Intronic
1001252124 5:170154507-170154529 CACTTGCCAGAAGCAGTGGCAGG - Intergenic
1002436417 5:179234556-179234578 CAGTTGCAGGCAGCAGGGGGCGG - Intronic
1002636634 5:180612018-180612040 CTGGAGCAAGAAGCAGGGGGTGG - Intronic
1004026510 6:11824403-11824425 GAGGTGGAAGTTGCAGTGGGCGG + Intergenic
1004165733 6:13255171-13255193 CAGGAGCAAGAGGCAGTGAGGGG + Intronic
1004703900 6:18104838-18104860 CAGGAGCAGGAAGGAGAGGGAGG + Intergenic
1007043251 6:38745187-38745209 CAGGTGCAAGCATCAGTGTGTGG + Intronic
1007509845 6:42366512-42366534 CAGGTGCAGGAAGAGGAGGGAGG - Intronic
1007833157 6:44654232-44654254 CAGTTGCAAGAAGCAGGAAGAGG + Intergenic
1008034301 6:46730041-46730063 CTGGTGCAGAATGCAGTGGGAGG - Intronic
1009550038 6:65078900-65078922 CAGGAACAAGAGGGAGTGGGAGG - Intronic
1011504791 6:88029517-88029539 CAGGAGCAAGAAGGAGTGGGAGG + Intergenic
1012402900 6:98859072-98859094 CAGGTCCAGGAATCAATGGGAGG - Intergenic
1013399544 6:109778887-109778909 CAGCTGCAAGAAGCCGGGCGCGG - Intronic
1014057274 6:117030850-117030872 CAGGTGAAAGAAACAGTGTTTGG - Intergenic
1014458269 6:121664236-121664258 CAGGTTCAAGAAGCACAGGGAGG + Intergenic
1014677347 6:124383495-124383517 TAGGTTCAAGGAGCTGTGGGAGG - Intronic
1014756534 6:125307574-125307596 CAGCTGCCAGAGGCAGTGGCAGG - Intergenic
1015156934 6:130107074-130107096 CAGGAGTGAGAAGCAGTGGTAGG + Intronic
1015455700 6:133424467-133424489 CAGGTGCCAGGAGCAGAGAGAGG + Intronic
1016417762 6:143851012-143851034 TAGGTGGAAGAAGGAGGGGGAGG + Intronic
1016900517 6:149096691-149096713 TAAGGGCAAGAAGCTGTGGGAGG - Intergenic
1017952309 6:159146226-159146248 AAGGTGCAGAAAGTAGTGGGAGG - Intergenic
1018759077 6:166874426-166874448 CAGGTGCAAGGAACAGCAGGGGG + Intronic
1018810498 6:167294905-167294927 GAGGAGACAGAAGCAGTGGGGGG - Intronic
1018854695 6:167667074-167667096 CAGGTGCCAGGGGCTGTGGGAGG + Intergenic
1019587273 7:1812481-1812503 CCGGTGCCAGGTGCAGTGGGAGG + Intergenic
1020675218 7:11175481-11175503 CATGTGAAAGAAGCAGTTGTAGG - Intergenic
1021312986 7:19116266-19116288 CAAGGGCAAGAGGAAGTGGGTGG + Intronic
1022060434 7:26787687-26787709 CAGGAGCAAGAGGGAGGGGGAGG + Intronic
1022857745 7:34332218-34332240 CAGGTGCAGGAAGGTGGGGGAGG - Intergenic
1024342655 7:48283025-48283047 CAGCAGCGAGAAGTAGTGGGTGG + Intronic
1024344522 7:48299598-48299620 TAGGGGAAAGAAGCAGTGGAAGG + Intronic
1025283656 7:57646385-57646407 CAGGAGGAAGAAGCTGCGGGCGG - Intergenic
1025799844 7:64775463-64775485 CAGGAGCAAGAAATAGTGAGGGG - Intergenic
1028563851 7:92205946-92205968 CAGGTGACAGCAGCAGTAGGTGG - Intronic
1028727214 7:94101168-94101190 CAGGTGCATGGAGCAGGGGGCGG - Intergenic
1029414362 7:100433714-100433736 CAGGTGCCAGAGGCATAGGGAGG - Exonic
1029417700 7:100453770-100453792 CATGTGCAGGAAGTAGTAGGAGG - Intergenic
1030179721 7:106693348-106693370 CAGGTGCAAGAAACAGCAAGTGG + Intergenic
1032846219 7:135754137-135754159 TAGGAGCAGGAAGCAGTGGGAGG + Intergenic
1033590260 7:142802847-142802869 CAGGAGAAAGCAGCATTGGGTGG - Intergenic
1033672988 7:143511164-143511186 CAGGTGCAAGGCGCAGGTGGAGG + Intergenic
1033814868 7:145059439-145059461 CAGGTGTTAAAACCAGTGGGTGG + Intergenic
1034854437 7:154528858-154528880 CAGGTGCAGGGAGCAGTGTGAGG + Intronic
1035074541 7:156169224-156169246 CAGGTGGGGGAGGCAGTGGGTGG + Intergenic
1039521257 8:38174319-38174341 AAGGTTCCAGAAGCAGTGAGAGG + Intronic
1039713827 8:40087528-40087550 CAAATGCAAGAAGAAGAGGGCGG - Intergenic
1042834898 8:73070567-73070589 CAGGTGAAAGCAGAAGTGGGAGG + Intronic
1043056125 8:75441818-75441840 CAGGTGCAAAAATCAATGTGTGG - Intronic
1043565170 8:81539829-81539851 CAGCTGTAAGAAGCAAAGGGTGG - Intergenic
1045012058 8:97967042-97967064 CAGGAGCAAGAGGTAGGGGGAGG + Intronic
1045070512 8:98499465-98499487 CAGAGGCTAGAAGGAGTGGGAGG + Intronic
1046943346 8:119952577-119952599 CTGGGGCCAGTAGCAGTGGGAGG - Intronic
1047450381 8:124960311-124960333 CATGTGCAAGAAACAATGGTAGG + Intergenic
1047468130 8:125139678-125139700 CATGTGAAAGACCCAGTGGGAGG - Intronic
1047792710 8:128220872-128220894 GAGATGGAAGAAGCAGAGGGAGG - Intergenic
1048318241 8:133377603-133377625 CAGGTGGAAGATGCAGGTGGAGG - Intergenic
1049175467 8:141189828-141189850 CAGGTGCAGGCGGCTGTGGGCGG - Intronic
1049194492 8:141308039-141308061 CAGGTGCGAGGTGCAGGGGGCGG + Intronic
1049203299 8:141352053-141352075 CAGGTGCAGGAGGGAGTGGAGGG - Intergenic
1049463576 8:142741047-142741069 CAGCAGCAGGAAGCAGGGGGAGG + Exonic
1049767435 8:144361443-144361465 CAGTTCCAAGAAGCAATGTGGGG - Intergenic
1052227775 9:26109820-26109842 CAGGTCCAAGAATCAAGGGGTGG + Intronic
1052358509 9:27529428-27529450 CGGGTGCAAGAAGGTGCGGGAGG - Intronic
1053526148 9:38832852-38832874 CAGGTGCGCCAAGCATTGGGGGG - Intergenic
1054198375 9:62057277-62057299 CAGGTGCGCCAAGCATTGGGGGG - Intergenic
1054639979 9:67531086-67531108 CAGGTGCGCCAAGCATTGGGGGG + Intergenic
1054827528 9:69588079-69588101 TAGGTGAAAGAAGCAGTGTCAGG + Intronic
1058050654 9:100402933-100402955 CAGGAGGAAGAAGAAGAGGGTGG - Intergenic
1059308912 9:113375218-113375240 AATGTGCAAGAAGCAGAGGTAGG + Intronic
1060927187 9:127463253-127463275 CAGGTGCAGGAGGCAGGTGGTGG + Intronic
1061445807 9:130636537-130636559 CAGCAGCAGGAAGCAGTGAGAGG + Intronic
1061678122 9:132229667-132229689 GAGGTGGAGGAAGGAGTGGGTGG + Intronic
1062145763 9:134988844-134988866 CAGGAGCAAGAGGCAGAGGCAGG + Intergenic
1062200711 9:135301328-135301350 CAGGTGCAGGAGGCGGTGGAGGG - Intergenic
1062235484 9:135505876-135505898 CAGGTGCAGGGGCCAGTGGGAGG - Intergenic
1203779838 EBV:95249-95271 CAGGTCCAAGCAGCACTGCGGGG + Intergenic
1203563540 Un_KI270744v1:75977-75999 AAGGTGCCAGCAGCCGTGGGTGG + Intergenic
1203630881 Un_KI270750v1:71266-71288 CAGAAGGAAGAAGCAGAGGGAGG - Intergenic
1185603636 X:1355089-1355111 CAGGAGGAAGAAGGAGCGGGAGG + Intronic
1185610140 X:1389440-1389462 CGGGTACACGAAGCAGAGGGAGG + Exonic
1185862522 X:3592437-3592459 CAAGGGCAAGAAGAAGAGGGAGG + Intergenic
1187333626 X:18363021-18363043 CAGGAGCAAGAAAGAGAGGGAGG - Intergenic
1187782174 X:22839234-22839256 CAGGAGCAAGAAAGAGTGTGGGG + Intergenic
1188327210 X:28820482-28820504 CAGGTAGATGAAGCAGTGAGTGG - Intronic
1190172477 X:48122439-48122461 CAGGTGCAAGAAAGGGTGGCTGG + Intergenic
1190178122 X:48168090-48168112 CAGGTGCAAGAAAGGGTGGCTGG + Intergenic
1191084189 X:56546852-56546874 CAGGGGCATGATGCAGTGGGAGG - Intergenic
1194844854 X:98792591-98792613 CAGCTGCAAGAAGTAGTTGCAGG - Intergenic
1195884918 X:109627577-109627599 CAGTTACAGGAAGGAGTGGGTGG - Intronic
1197179617 X:123520322-123520344 GAGGTGCAAAAGGCAGAGGGTGG - Intergenic
1197520492 X:127490947-127490969 CAGGAGCAGGAGGAAGTGGGGGG + Intergenic
1197761465 X:130031067-130031089 GAGGAGCAAGAACAAGTGGGGGG - Intronic
1197872525 X:131073211-131073233 GAGGAGCAGGAAGCAGTGAGTGG + Intronic
1198142315 X:133816802-133816824 CATGTGCAATAAGCTGAGGGTGG - Intronic
1199490764 X:148398027-148398049 AAGGTGCAAACAGCAGTGTGTGG + Intergenic
1199577233 X:149324085-149324107 CAGGTGGAAGGAGCAATGGTGGG + Intergenic
1201550343 Y:15211625-15211647 AAGGTGCAAGAGGGAGAGGGAGG + Intergenic
1201639033 Y:16159107-16159129 CAGGTGTAAGCAGCAGTGCCTGG - Intergenic
1201947735 Y:19530181-19530203 CAGGAGCAAGACAGAGTGGGAGG - Intergenic