ID: 992908560

View in Genome Browser
Species Human (GRCh38)
Location 5:81372561-81372583
Sequence CTGATGAGGCAGAGCCAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992908560 Original CRISPR CTGATGAGGCAGAGCCAACA AGG (reversed) Intronic
900593179 1:3468780-3468802 CTGATGGACCAGGGCCAACATGG - Intronic
900620891 1:3587296-3587318 CTGATGTGGCAGAGCCTTCGGGG - Intronic
901527836 1:9835405-9835427 CTGATGAGGGAGACCCAGCTAGG + Intergenic
902224546 1:14988384-14988406 CTGCTCAGGCTGAGCCAGCAGGG - Intronic
902409780 1:16206084-16206106 CTGAGGAGTCAGAGCCAGGATGG + Intronic
903223415 1:21881354-21881376 CTGTTCAGGCAGAGCCCAGAAGG + Exonic
904108662 1:28107510-28107532 TTGAGGAGGCAGAGCCAAATAGG + Intergenic
904212748 1:28896842-28896864 TTTAGGAGGCAGAGCCAGCAGGG + Intronic
904303180 1:29569296-29569318 CTGATGAAGCTGAGAAAACAGGG - Intergenic
904959027 1:34316427-34316449 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
905723603 1:40228910-40228932 CTGAGGAGGCAGAGGCAGCGGGG - Intronic
906835691 1:49081646-49081668 ATGATGGGGCAGAGCCCATAGGG - Intronic
907048162 1:51312650-51312672 CTCCTGAGGCAGGGCCAACAGGG + Intronic
908251996 1:62273130-62273152 ATGATAAGGCAGAGGGAACAAGG - Intronic
910616596 1:89205289-89205311 CTGAAGGGGCAGAGCCCTCATGG + Intergenic
911065178 1:93781691-93781713 CCTATGATGCAGAGCCAGCATGG - Intronic
911949392 1:104153613-104153635 CTGAAAATGCAAAGCCAACACGG - Intergenic
913187931 1:116387100-116387122 CTGATGAGCCAGTCCCCACAGGG - Intronic
914334671 1:146703575-146703597 CTGGTGAGGCAGAGGAAAAAAGG - Intergenic
915805226 1:158841593-158841615 CTGATTAGGGAGAGCCAAGAAGG + Intronic
915826712 1:159085739-159085761 CTAAAGAGGAAGAGTCAACAAGG + Intronic
916185935 1:162132915-162132937 CAGAAGAGCCAGAGCAAACAAGG - Intronic
916296749 1:163228219-163228241 CTGCAGGGGCAGAGCCATCATGG - Intronic
916910557 1:169341419-169341441 CTGCTGGGGCAGAGCCCTCATGG + Intronic
918113785 1:181480705-181480727 CTGCTGAGGCAGAACCACAAAGG + Intronic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
919524954 1:198635463-198635485 CTGTTGAGGAAAAGCCAATAAGG + Intergenic
921570177 1:216768595-216768617 CTGAGGAGGCTGAGGCAAGAGGG - Intronic
921797272 1:219360887-219360909 TTGATGAGGCAGAAAGAACATGG - Intergenic
921831638 1:219733736-219733758 TTGATGAGGCTGGGCCAACTGGG - Intronic
922578408 1:226678954-226678976 CTGATGAGGAAGAGACCACATGG + Intronic
924639843 1:245823627-245823649 CAGATGAGAGAGAGTCAACAAGG - Intronic
924792958 1:247269913-247269935 CTGCAGAGGCAGATCCCACATGG - Intergenic
1063880017 10:10521635-10521657 CTGAAGTGGTAGAGCCAAAATGG + Intergenic
1064988272 10:21232664-21232686 CTGATGAGGCGGAGCTCACGTGG + Intergenic
1065450853 10:25855465-25855487 CTGATGAGCCAGAGACAGCAGGG + Intergenic
1067085209 10:43234563-43234585 CTGATGAGGCTCAGCCCACAAGG + Intronic
1067146526 10:43698213-43698235 CAGGCGAGGCAGAGCCCACATGG - Intergenic
1068134607 10:52939733-52939755 ATGATAAGGAAGAGGCAACAGGG + Intergenic
1068160612 10:53258332-53258354 GTGGTGAGGTAGAGTCAACATGG + Intergenic
1069040823 10:63693957-63693979 CTGAAGAGGCAGGGCCCTCATGG + Intergenic
1069861692 10:71475658-71475680 CTGCTCAGGCAAAGCCAGCAGGG - Intronic
1069921578 10:71818899-71818921 CTGCTGCGGGAGAGCCAAGAAGG - Intronic
1070754410 10:78982695-78982717 CTCAGAAGGCAAAGCCAACAGGG - Intergenic
1071808053 10:89145866-89145888 CTGAACAGGCAGTGCCATCAGGG - Intergenic
1072769371 10:98124810-98124832 CTGCAGAGGCAGAGCCTTCATGG - Intergenic
1075055624 10:119216381-119216403 CTGAAGTGGCAGAGGCCACAGGG + Intronic
1075155798 10:119974930-119974952 CTGATGAGGTAGAAGCAAGATGG + Intergenic
1076200688 10:128555390-128555412 CTGAGAAGGCTGAGCCAGCATGG + Intergenic
1076219871 10:128724589-128724611 CTGGTGAGGCTCAGCAAACATGG - Intergenic
1077493268 11:2871852-2871874 CTGAGGTGGCAGAGTGAACAGGG - Intergenic
1078467606 11:11561779-11561801 CCCATTGGGCAGAGCCAACAAGG + Intronic
1079414170 11:20217491-20217513 CTGCTGAGGTAGAGGCAAGATGG - Intergenic
1079522763 11:21347992-21348014 CTGAAAAGGCTGAGCTAACAAGG + Intronic
1080715687 11:34797725-34797747 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
1081016715 11:37891360-37891382 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1081160601 11:39743633-39743655 CTGCAGAGGCAGAGCCTTCATGG + Intergenic
1081270509 11:41077325-41077347 CTGCTGGGGCAGAGCCTTCATGG - Intronic
1081482541 11:43503144-43503166 CTGATGGTGCACAGCCCACAGGG - Intergenic
1081734001 11:45391047-45391069 CCGAGGAGACAGAGCCTACAGGG + Intergenic
1083610748 11:64003046-64003068 CTGGGGAGGCAGAGCCCACTTGG + Intronic
1084090352 11:66875547-66875569 CCGAGGAGGAAGAGCCAAGAAGG + Intronic
1084981308 11:72830162-72830184 CTTACAAGGCAGAGCCCACAGGG + Intronic
1085640934 11:78192272-78192294 CTCTTGAGTCAGAGCCAGCATGG + Intronic
1086124843 11:83339962-83339984 CAGATGAGGCAGCCCCAAGATGG - Intergenic
1088928015 11:114321753-114321775 CTGATAAAGCAGAGAGAACATGG - Intergenic
1089345756 11:117790404-117790426 CTGATGAGGCACAGCCAGGCTGG - Intronic
1091487386 12:902790-902812 CTGATGAGTCAGTGCCTACCTGG + Intronic
1094681953 12:32674944-32674966 CAGATGAGGCAGAGAGAACTGGG - Intergenic
1096532702 12:52251903-52251925 CAGTTGAGGCAGAGACTACATGG + Intronic
1100354325 12:93814777-93814799 GAAATGAGACAGAGCCAACAAGG + Intronic
1104554538 12:129787809-129787831 CTAATGAGGCAGGGGCAACTGGG + Intronic
1104991226 12:132624886-132624908 CAGATGAGGGAGAGCCCACCTGG + Exonic
1105417283 13:20224478-20224500 CTGGGGAGGCAAAGCCAACGTGG - Intronic
1105974204 13:25458946-25458968 CAGGTGAGGCAGAGCCATCTAGG + Intronic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1108630363 13:52275642-52275664 ATGATGAGGAGGAGCCAAGATGG - Intergenic
1109616221 13:64837251-64837273 CTGCAGGGGCAGAGCCATCATGG + Intergenic
1112126291 13:96471967-96471989 CTGAAGAGGCAGAGGCTACCTGG + Intronic
1112723806 13:102278467-102278489 CTGATGAGGTAGATGAAACAGGG + Intronic
1112881328 13:104109588-104109610 CTGTAGTGGCAGAGCCATCATGG + Intergenic
1115007137 14:28499178-28499200 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1115608421 14:35029084-35029106 ATGATGAGGCAGTTTCAACAGGG + Exonic
1116440995 14:44952639-44952661 CTGATGAGGCTGAGGCAAGTAGG - Intronic
1118285599 14:64468600-64468622 CTGATCAGCCAGAGCCCACACGG + Exonic
1120091118 14:80334238-80334260 CTGCAGAGGCAGAGCCCTCACGG - Intronic
1120132532 14:80823940-80823962 CTGCAGAGGCAGGGCCATCATGG - Intronic
1120166661 14:81208437-81208459 CTGCAGAGGCAGAGCCCTCATGG + Intronic
1120570968 14:86116331-86116353 CTGTAGAGGCAGAGCCTTCATGG + Intergenic
1121026633 14:90621079-90621101 ATGATGGGGCAGAGGCCACATGG + Intronic
1121668715 14:95691932-95691954 CAGAAGAGGCAGGGCCAGCAGGG - Exonic
1125098585 15:35883372-35883394 TTGAGGAGGTAGATCCAACATGG + Intergenic
1125769918 15:42158291-42158313 CAGATGGGACAGAGACAACAAGG + Intergenic
1126453985 15:48841497-48841519 CAGCTGAGGCAGAGCCAGAAGGG - Intronic
1126533240 15:49733181-49733203 CTGCAGGGGCAGAGCCATCATGG - Intergenic
1126815277 15:52447945-52447967 CTGCAGAGGCAGAGCCTTCATGG + Intronic
1128243990 15:66120440-66120462 CTGCTGAGGAAGAGTCCACAGGG - Intronic
1129182449 15:73885715-73885737 GTGTTGGGGCAGAGCCAACTGGG - Intronic
1129710206 15:77817018-77817040 ATGATCAGCCAGAGCCAACAAGG + Intronic
1129715394 15:77845521-77845543 CTGCAGGGGCAGAGCCCACATGG + Intergenic
1130048129 15:80461707-80461729 ATGATGATGCAGAGCCTAGAAGG + Intronic
1130173757 15:81546340-81546362 CTCAGGAAGCAAAGCCAACAGGG - Intergenic
1131470981 15:92696861-92696883 TAGATGAGGCAGAGCCAAGGTGG + Intronic
1132036218 15:98487048-98487070 CTTCTGAGGCAGAGTCAGCAGGG - Intronic
1132347607 15:101117948-101117970 ATCATGAGGCAGAGCCCTCACGG + Intergenic
1132347686 15:101118390-101118412 GTCATGAGGCAGAGCCCTCACGG - Intergenic
1133889176 16:9862479-9862501 CTCTTGAGGCTCAGCCAACAGGG + Intronic
1134002567 16:10794146-10794168 CTCATGAGGCACAGCCCTCACGG + Intronic
1134805378 16:17119756-17119778 CAGAGGGGGCAGAGCCAGCATGG + Intronic
1136029401 16:27491842-27491864 AGGATGAGGCAGAGCCAGCCAGG - Intronic
1137556418 16:49473196-49473218 CTGCAGAGGCCGAGCCACCAGGG - Intergenic
1137842968 16:51657023-51657045 CTGATGAAGCAGAGCTCAGAAGG + Intergenic
1138507320 16:57484906-57484928 CAGACGAGGCCGAGCCACCAGGG - Intronic
1138631772 16:58301161-58301183 ATGATGGGGAAGGGCCAACAAGG - Intronic
1138646460 16:58429013-58429035 GTGATGAGGCAGAGCCCTCATGG - Intergenic
1139332954 16:66208010-66208032 CTCATGAGTCAGAGCCCCCAGGG + Intergenic
1139998950 16:71007657-71007679 CTGGTGAGGCAGAGGAAAAAAGG + Intronic
1141273066 16:82558383-82558405 CTGCAGAGGCAGAGCCGTCATGG + Intergenic
1141689340 16:85587608-85587630 GTGATGGGGCAAAACCAACAGGG - Intergenic
1142514124 17:415928-415950 CGGAGGTGGCAGAGCCAAGATGG + Intronic
1142539362 17:646214-646236 CTTATCAGGCAGAGGCCACACGG - Intronic
1142540551 17:655401-655423 CTGCTGAGGCAGAAGCAGCAGGG + Intronic
1143372053 17:6446577-6446599 CTGATGAAGAAGAGCCTTCACGG + Intronic
1143720048 17:8803090-8803112 GTGATGAGGAAGGGCCCACATGG - Exonic
1143755867 17:9067064-9067086 CACATGAGGCTGGGCCAACATGG + Intronic
1144557382 17:16294284-16294306 GTGATGTGGCAGAGAGAACATGG - Intronic
1146616624 17:34362027-34362049 CTGATGAGGCAGAGCTATGCCGG - Intronic
1147245346 17:39116639-39116661 CTGAGGAAGTAAAGCCAACAAGG + Intronic
1148758170 17:49985505-49985527 CTGTGGAGGCAGAGCCTGCATGG - Intergenic
1148913422 17:50955371-50955393 CACATGAGCCAGAGCCAGCATGG - Intergenic
1150221988 17:63500949-63500971 AGGATGAGGGAGAGGCAACATGG - Intronic
1150255587 17:63741770-63741792 CTGAGGAGGCGGAGCCAAGACGG - Exonic
1150575622 17:66428187-66428209 CTGCTGTGCCAGAGTCAACAGGG + Intronic
1151163771 17:72187238-72187260 TAGATGTGGCAGATCCAACAGGG - Intergenic
1152099749 17:78294161-78294183 CTGATGAGGCAGTGCCTCCGAGG + Intergenic
1152627000 17:81392463-81392485 CTGGTGAGGCTGAGCCAGAAGGG + Intergenic
1153340095 18:3964614-3964636 CTGATGAGGAAGAGCCTTGAAGG + Intronic
1155528187 18:26738822-26738844 CTGATGATGCAGAGACTTCATGG + Intergenic
1156972659 18:43175506-43175528 CTGTTGAGACACAGCGAACAAGG + Intergenic
1161243520 19:3236066-3236088 CTGAGGAGCCACAGCCAGCAGGG + Intronic
1163250070 19:16121536-16121558 TTGATGTGGCAGAGCCATGATGG - Intronic
1164529330 19:29036268-29036290 CTGATGAGCAAGAGCCCACTTGG - Intergenic
1165100711 19:33436944-33436966 CCGATGAGGCAGAAGCCACAGGG + Intronic
1165716942 19:38052512-38052534 CTGGTGAGGCTCAGCCAACAGGG - Intronic
1165898215 19:39155966-39155988 CTGGTGAGGCGGCGCCAGCATGG + Intronic
1166894511 19:46015486-46015508 CTGATGAGGCGGAGCCTAAGGGG + Intronic
1168431894 19:56288074-56288096 CTGGTGTGGCAGAGCCAAGAAGG + Intronic
926807924 2:16728919-16728941 CTGATGAGACATAGTCAAGAAGG - Intergenic
931285511 2:60828621-60828643 CTGCGGAGGCCGAGCCAGCAGGG - Intergenic
931940261 2:67244340-67244362 CTTTAGAGGCAGAGTCAACAGGG - Intergenic
932413222 2:71559358-71559380 TGGGTGAGGCAGAGCCACCAGGG - Intronic
932915710 2:75855936-75855958 CTGTAGGGGCAGAGCCCACATGG + Intergenic
933274235 2:80266685-80266707 CTGATGAAGTACAGCCAAGAAGG - Intronic
934036195 2:88090599-88090621 CTGAGTAGGCAGAGGAAACAGGG + Intronic
935947618 2:108300548-108300570 CTGCTGAGGCAGAGTCAGCCAGG - Intronic
937165687 2:119813804-119813826 GTGATGAGGAAGAGGCAAAATGG - Intronic
939415970 2:141897614-141897636 CTGATGTGGCATAGACAAAATGG - Intronic
939733610 2:145816025-145816047 GTGATGAGACAGATGCAACAGGG + Intergenic
940195565 2:151090843-151090865 CTGAAGAGGTAGAGACAGCAAGG + Intergenic
941873785 2:170412849-170412871 CTGATGAGCCAGCCCCATCAGGG + Intronic
942672229 2:178388434-178388456 GTGATGAGGCAGAGCCGGGAAGG - Intronic
943470168 2:188285285-188285307 CTGTTGATGCAGAACCAGCATGG + Intergenic
948008173 2:234628114-234628136 GTGATAAGGCAAAGCCAACATGG - Intergenic
948451990 2:238081423-238081445 CGGAAGAGGAAGAGGCAACAGGG - Intronic
949030468 2:241794514-241794536 CTGATCAGGCAGGGCCATCAGGG - Intronic
949080377 2:242093156-242093178 CTGAAAAGGAAGAGCCAAAAAGG - Intergenic
1168978970 20:1988883-1988905 CCAGGGAGGCAGAGCCAACAAGG - Intronic
1169236425 20:3933571-3933593 TTGGTGAGGCAGTGCCCACAAGG - Exonic
1169922801 20:10753562-10753584 CTAATGAAGCAGAGATAACACGG - Intergenic
1170255672 20:14340291-14340313 GTCATGTGGCAAAGCCAACATGG - Intronic
1170836309 20:19887677-19887699 CTGATGAGCCAGGGCAGACAGGG - Intronic
1171485937 20:25486081-25486103 ATGCTAAGGCAGAGGCAACAGGG + Intronic
1173284755 20:41660189-41660211 GAGATAAGGAAGAGCCAACAAGG - Intergenic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1177765244 21:25450140-25450162 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1178078026 21:29030995-29031017 ATGAAGAGGCAGTGGCAACAGGG + Intronic
1179727460 21:43348409-43348431 CTGATGTGGCAGAGGCAGGAAGG - Intergenic
1179800935 21:43811235-43811257 CTGAGGAGGCTGAGCCTCCAAGG - Intergenic
1180048226 21:45319516-45319538 CTGGTCAGGCAGTGCCCACACGG - Intergenic
1180060283 21:45381516-45381538 CTGCTGAGGCAAAGCCCACCCGG + Intergenic
1180080891 21:45487099-45487121 AGGATGAGGCAGTGCCAGCAAGG - Intronic
1181084503 22:20433236-20433258 CTGAGAAGGAAGAGCCACCAAGG + Intronic
1181436579 22:22914660-22914682 CTCATGAGGGAGAGGGAACAAGG + Intergenic
1183751138 22:39721268-39721290 CTGTTGGTGCAGAGCCAAGAGGG + Intergenic
1183810760 22:40255217-40255239 ATGGTGAGTCAAAGCCAACAGGG + Intronic
1184184474 22:42855913-42855935 CTGATGAGGCTGACACCACAGGG - Intronic
1184283950 22:43455976-43455998 CTGGTGAGGGAGAGGAAACAGGG + Intronic
1184445436 22:44544408-44544430 CTGATGATGCAGAGGTAAGAGGG - Intergenic
1184915079 22:47563627-47563649 CTGATGAGGAGCAGTCAACAAGG + Intergenic
950485885 3:13273814-13273836 GGGGTGAGGCAGAGCCAGCAGGG - Intergenic
950815182 3:15693680-15693702 CTGAAAAGGCAAAGCCAGCATGG - Intronic
953702632 3:45208520-45208542 CAGATGAGGCTGAGGCAGCAAGG + Intergenic
956743246 3:72291387-72291409 CGGCTGAGTCAGAGCCAACACGG + Intergenic
958255649 3:91321753-91321775 TGGCTGAGGCAGAGCCAGCAGGG - Intergenic
958469817 3:94502990-94503012 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
958776176 3:98485581-98485603 TTGGTTAGGCAGAGCCAACATGG - Intergenic
958893429 3:99805072-99805094 CTGAAGGGGCAGAGCCCTCATGG - Intergenic
960057339 3:113284800-113284822 CTGCTGAGGCAGACCCATCTTGG + Exonic
960541977 3:118871491-118871513 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
961064381 3:123862094-123862116 CTGGTGACGCTGAGCCAGCATGG - Intronic
961125583 3:124414777-124414799 CTGAGGAACCTGAGCCAACAAGG - Intronic
962020581 3:131496974-131496996 CTGCAGAAGCAGAGACAACATGG - Intronic
962398476 3:135037841-135037863 CTGAGGAGGCAGAGAAAACCTGG - Intronic
964355871 3:155851459-155851481 CTGAGGAGGTAGAGCCAGCTTGG - Intronic
964974877 3:162606313-162606335 CTGCAGGGGCAGAGCCATCATGG + Intergenic
965627743 3:170698543-170698565 CCGATGAGGCAGAAACAAAAGGG + Intronic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
966843322 3:184106506-184106528 CTGCGGAGGCAGAGCTGACAGGG + Exonic
966917252 3:184591961-184591983 ATGCTGAAGCAGTGCCAACAGGG + Intronic
967782627 3:193456723-193456745 CTGATGAGACAGAGGCACTAAGG + Intronic
968275415 3:197437218-197437240 CGGATTATGAAGAGCCAACAGGG - Intergenic
968530519 4:1088962-1088984 CTGCAGAGGCAGAGCCCTCATGG + Intronic
969085748 4:4655195-4655217 CTGATGAGGAGGAGGCAAGAAGG + Intergenic
969198440 4:5582049-5582071 CTGCTGGGGCAGAGCCCTCATGG + Intronic
969685512 4:8671940-8671962 GAGAAGAGGCAGAGCCAGCAAGG + Intergenic
970561783 4:17288645-17288667 GTGATGAGGGAGAGCCATCAGGG + Intergenic
970750428 4:19353047-19353069 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
972102989 4:35445786-35445808 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
975106770 4:70576465-70576487 GTGATAAGGCAGAGCATACATGG + Intergenic
976264316 4:83175704-83175726 CTGATCAGGCAAAGCAAAGAGGG + Intergenic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
980101311 4:128543897-128543919 GTGCTGAAGCAGAACCAACATGG - Intergenic
980458611 4:133076297-133076319 CTGTAGAGGCAGAGCCTTCATGG - Intergenic
980631861 4:135447533-135447555 CTCACGAGGGAGAGCCAAGATGG + Intergenic
981011847 4:139933278-139933300 CTGAGTAGGAAGAGCCAACCAGG - Intronic
981407202 4:144385458-144385480 CTGATGGGGCAGAGCCCTCATGG - Intergenic
981695253 4:147553050-147553072 CTGCTGGGGCAGAGCCCTCATGG + Intergenic
982676934 4:158386993-158387015 CTGAGGAAGCACAGCCCACAGGG + Intronic
984065598 4:175043961-175043983 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
984163520 4:176282352-176282374 CTGAGGAGGCGGGGCCAAGATGG + Intergenic
985282367 4:188300119-188300141 CTGAGGAAGCAGAGGGAACAGGG - Intergenic
987908125 5:24105495-24105517 ATGAAGAGGCAGAGCCCTCATGG - Intronic
988010078 5:25470611-25470633 CTGATGAGGCAGAGCTCAGATGG - Intergenic
990710157 5:58571851-58571873 CTGAAGTGGCAGAGCCTCCATGG + Intergenic
992591559 5:78301087-78301109 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
992893773 5:81229483-81229505 AAGATGAGGCAGAGCCAAAATGG + Exonic
992908560 5:81372561-81372583 CTGATGAGGCAGAGCCAACAAGG - Intronic
994285171 5:97955965-97955987 CTGAAGGGGCAGAGCCCTCATGG + Intergenic
995055419 5:107753882-107753904 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
995559441 5:113364652-113364674 CTGCTGAGGCAGAGCCCTCATGG - Intronic
997159632 5:131594442-131594464 CTGTAGAGGCAGAGCCCTCATGG + Intronic
997627209 5:135339252-135339274 CTGAGGAGGCTGACCCAAGAGGG - Intronic
997713496 5:136025771-136025793 CAGATGACCCAGAGCCAACCAGG - Intergenic
1000402581 5:160846804-160846826 AGGAAGAGACAGAGCCAACATGG - Intronic
1001673364 5:173492486-173492508 ATGATGAGACAGAGCCACCTGGG + Intergenic
1003236010 6:4295623-4295645 CTGATGAATCAGATCCTACAGGG + Intergenic
1007823393 6:44578949-44578971 CAGCTTAGGAAGAGCCAACAGGG - Intergenic
1010819432 6:80396045-80396067 CTGTAGAGGCAGAGCCCTCATGG + Intergenic
1011347710 6:86389926-86389948 CTGCAGAGGCAGAGCCCCCATGG + Intergenic
1014247715 6:119084716-119084738 CTGCAGAGGCAGAGCCCTCATGG - Intronic
1015534023 6:134248755-134248777 TTGATGAGGGAGAGCCTACCTGG - Intronic
1015678758 6:135781027-135781049 CAGCTGATGCAGAGCCTACAGGG + Intergenic
1015852975 6:137593552-137593574 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1016118070 6:140313047-140313069 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1016139043 6:140585723-140585745 ATGAGAAGGCAGAGCCAAGATGG + Intergenic
1017159400 6:151350874-151350896 TTGAAGACGCAGGGCCAACAGGG + Exonic
1019609414 7:1929417-1929439 GTGAGGAGTCAGAGCCAGCACGG + Intronic
1020381895 7:7556709-7556731 CAGCTGAGGCAGAGCCTAGACGG + Intergenic
1020908725 7:14101056-14101078 GTGTTTAGGCAGAGACAACAGGG - Intergenic
1021336430 7:19408324-19408346 CTGCTGAGGCAGAACAAGCAAGG - Intergenic
1022705988 7:32802413-32802435 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1023056922 7:36298253-36298275 CTGGGGAAGCTGAGCCAACAGGG + Intronic
1023999475 7:45181234-45181256 CTCAGGTTGCAGAGCCAACATGG - Intronic
1024273548 7:47659863-47659885 CTGGGGAGCCAGAGCCACCAAGG + Exonic
1024275585 7:47674284-47674306 CTCATGAGGCAGAGCCTAGTGGG - Intergenic
1026482069 7:70787859-70787881 ATGATGAGGCAATGCAAACATGG - Intronic
1026839923 7:73664651-73664673 CTGAGGAGGCAGAGCAAACTGGG + Intergenic
1027345340 7:77253965-77253987 CTGATGAGGCAGGGCCATGTAGG + Intronic
1029425356 7:100490880-100490902 CTGATGAGGCAGGGGCAGCCTGG + Intronic
1030158689 7:106484642-106484664 CTGATGAGGCAAAGCCAGGGTGG + Intergenic
1031074356 7:117198715-117198737 CTGAGGAGGCAGGTGCAACAGGG - Intronic
1032286123 7:130539688-130539710 ACGATGAGGCAGCGCCAACAGGG + Intronic
1032410819 7:131692390-131692412 CTGATGCGGCAGGGCCACCGTGG + Intergenic
1033230552 7:139594079-139594101 TTGATGGGGCAGAGCCTCCAAGG - Intronic
1033419919 7:141196562-141196584 CTGATGAGTCCAAGCCAAGATGG - Intronic
1034234839 7:149558510-149558532 CTCATGAGGCTGTGCTAACAAGG + Intergenic
1035538422 8:411348-411370 CTGAAAAGGAAGAGCCAAAAAGG - Intronic
1037662503 8:20939814-20939836 CCGCTGAGGCAGAGGCAGCATGG + Intergenic
1038327370 8:26581773-26581795 CTGATGAGTCAGAACACACAGGG - Intronic
1039191830 8:34984995-34985017 CTGATGATTCAGAGACAGCATGG + Intergenic
1041340959 8:56844962-56844984 CTGCTGAGGAAGAGCCAGGAGGG + Intergenic
1043033555 8:75169016-75169038 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1043085560 8:75827328-75827350 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
1043282635 8:78487425-78487447 CCCATGAGGCAGCGTCAACATGG + Intergenic
1045422141 8:102026787-102026809 CTGCTGGGGCAGAGCCCTCATGG - Intronic
1047101072 8:121676397-121676419 CTGCAGAGGCAGTGCCACCATGG + Intergenic
1047473919 8:125206898-125206920 AAGAAGAGGCAGAGCCAGCAAGG + Intronic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1048184825 8:132230087-132230109 CTGTTGAGGTAGATCCAACATGG - Intronic
1048264806 8:132976381-132976403 TTTATGAGGCAGAGCCCTCATGG - Intronic
1049363364 8:142224861-142224883 CTGATGAGGCTGAGCCCGCGGGG + Intronic
1049780515 8:144426595-144426617 CTCATGATGCAGTGCCAACAAGG + Intronic
1050604579 9:7287659-7287681 TTGGTGAGGCAGAGCCAAGCCGG - Intergenic
1056767681 9:89454924-89454946 GTGAAGAGGCAGAGCCACCCGGG - Intronic
1056964169 9:91152238-91152260 CTCCAGAGACAGAGCCAACAGGG + Intergenic
1058193059 9:101941537-101941559 CTGAGGGGGTGGAGCCAACATGG - Intergenic
1058387085 9:104449422-104449444 GTGAAGAGACAGAGCTAACAAGG - Intergenic
1060148742 9:121272996-121273018 CCCATGAGGCAGAGCAAGCAAGG - Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061638082 9:131928145-131928167 CTGATGTTGCAGTGCCCACATGG - Intronic
1185512517 X:674068-674090 CAGATGAGGCAGAGACCCCAAGG + Intergenic
1187180515 X:16939363-16939385 CTGCAGAGGCAGAGCCCTCATGG - Intergenic
1188527636 X:31103572-31103594 TTGATGTGGCAGGACCAACAGGG + Intronic
1189992472 X:46608056-46608078 CTTATGAGACAGAGCCTCCAGGG + Intronic
1192979973 X:76328801-76328823 ATGATGAGGAGGAGCCAAGATGG - Intergenic
1194150808 X:90323393-90323415 CTGCAGAGGCAGAGCCTACATGG - Intergenic
1194360323 X:92941989-92942011 CTGAAGGGGCAGAGCCCTCATGG - Intergenic
1194450724 X:94041835-94041857 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
1196715086 X:118803099-118803121 CTTATGAGGCAGAGGCCACAAGG - Intergenic
1196984842 X:121257064-121257086 CTGATGAAGCAGAACCAATAGGG + Intergenic
1197984851 X:132256531-132256553 CTGATGGGGCAGACCCTGCATGG - Intergenic
1199063621 X:143388812-143388834 CTGCAGAGGCAGAGCCCTCATGG + Intergenic
1199349838 X:146787756-146787778 CTGAAGGGGCAGAGCCCTCATGG + Intergenic
1200497176 Y:3900154-3900176 CTGCAGAGGCAGAGCCTACATGG - Intergenic
1201505405 Y:14693947-14693969 CAGATGAAACATAGCCAACAAGG - Intronic