ID: 992909675

View in Genome Browser
Species Human (GRCh38)
Location 5:81383453-81383475
Sequence CACATTAATCAAGGCTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992909675 Original CRISPR CACATTAATCAAGGCTACAG TGG Intronic
903335556 1:22622019-22622041 CACAGTAACCGAGGCTGCAGGGG - Intergenic
904601687 1:31676289-31676311 CACTTTAGTCTAGGCAACAGAGG + Intronic
906160270 1:43643329-43643351 AACATCAATCAACACTACAGTGG + Intergenic
910999618 1:93148996-93149018 AACATTCATCAAAGCTGCAGTGG + Intergenic
911732509 1:101305698-101305720 CACAGTGACCAAAGCTACAGGGG - Intergenic
915504032 1:156340911-156340933 CACTTGAATCAAGGAGACAGAGG - Intronic
916950933 1:169779596-169779618 AACATAAATCAAGGATACACAGG + Intronic
917538148 1:175889281-175889303 CACTTTAATGGAGGCTCCAGTGG + Intergenic
918249978 1:182694386-182694408 CACAGAAAGCAAGGCCACAGTGG - Intergenic
922814726 1:228440340-228440362 CAAATTAATCAAGCTTAAAGAGG + Intergenic
924749326 1:246871009-246871031 CAACTTAAGCAAGGCTACAGTGG - Intronic
924749667 1:246874391-246874413 CAAGTTAAGCAAGGCTACAGTGG - Intronic
1064789350 10:18938377-18938399 CACAATAATAAAGACAACAGAGG - Intergenic
1065859042 10:29855555-29855577 CACTTGAATCCAGGCGACAGAGG - Intergenic
1066577289 10:36839940-36839962 CACATTAAACAATCCTATAGAGG - Intergenic
1067077234 10:43195046-43195068 CCCATTGATCAAGGCTCCTGCGG + Exonic
1068418188 10:56753159-56753181 CACATTAGTCTAGGCTACATAGG - Intergenic
1069326586 10:67238183-67238205 CACATGAATCTAGACTTCAGAGG + Intronic
1073566869 10:104542643-104542665 CACATTAATGAAGTCTGCAACGG + Intergenic
1074092378 10:110273649-110273671 CACATTCTTCAAAGCTGCAGTGG - Intronic
1075219611 10:120573309-120573331 CAAATTAAACAAAGTTACAGTGG - Intronic
1075867315 10:125736083-125736105 CACATTATGCAAGCCTATAGTGG + Intronic
1077083867 11:737806-737828 CAAATTAATCAAGCCCAAAGAGG - Intergenic
1078813781 11:14798780-14798802 CACATTAAAAAATGATACAGGGG - Intronic
1082131781 11:48498872-48498894 CTCATGAATCCAGACTACAGAGG - Intergenic
1084001546 11:66297841-66297863 AACATTCAACAAGGCTGCAGGGG + Intergenic
1086895587 11:92308771-92308793 GACATTAAGAAAGGATACAGAGG - Intergenic
1088246192 11:107820396-107820418 CACTTTAATCAAGGAGACTGGGG + Intronic
1088331463 11:108657258-108657280 CACACTAAACAAGACAACAGTGG + Intergenic
1089198512 11:116709539-116709561 CACAATAATAAATGCTACAGTGG - Intergenic
1089214078 11:116825152-116825174 CACAGAAACCAAGGATACAGAGG + Intergenic
1093149136 12:15601341-15601363 CACATTAAGCAATACTAAAGAGG + Intergenic
1095427961 12:42098572-42098594 GACAAAAATCAAGGCTGCAGAGG + Intronic
1096822468 12:54247705-54247727 CACTTTAACCTAGGCAACAGAGG - Intronic
1097455541 12:59795004-59795026 AACACTAATCAAGGGAACAGAGG - Intergenic
1103046879 12:117743349-117743371 CACATTAAGCAAGGCTGCAGTGG - Intronic
1104161735 12:126187637-126187659 CACATGACTCAAGGCCAGAGTGG - Intergenic
1109724440 13:66320912-66320934 CCCTTTAAGCAAGGCTACTGGGG + Intronic
1110304746 13:73972622-73972644 CACAGTAATCACAGCTACAGTGG + Intronic
1113331311 13:109330638-109330660 CAAAGTAATCGAGGCTACAGAGG + Intergenic
1116800671 14:49440172-49440194 CACATTCAACAAGGCCACTGGGG + Intergenic
1119836651 14:77756202-77756224 CACACGAATCCAGGCGACAGAGG - Intronic
1124431290 15:29610964-29610986 CACATGAATCATGGCTTCAAAGG - Intergenic
1126190819 15:45876651-45876673 AAGATTATTCAAGGCTACTGTGG + Intergenic
1130319993 15:82833561-82833583 CACTTTATTCAAGCCTACTGTGG - Exonic
1130536976 15:84792966-84792988 CACTTAAATCAAGGCTAGAAAGG - Intronic
1131343923 15:91628554-91628576 CACATCATTCTAGGCAACAGGGG + Intergenic
1134795623 16:17033671-17033693 CATATTAAAGAAGACTACAGAGG - Intergenic
1138038486 16:53633475-53633497 CAGATTAATGCAGGCTAAAGAGG + Intronic
1140786665 16:78348880-78348902 TACATTAATGGAGGCAACAGAGG + Intronic
1143495417 17:7309382-7309404 CCCATAAATCAAAGCTAAAGTGG - Intronic
1143843215 17:9751386-9751408 AACATTAATCCAGCCTAAAGAGG - Intergenic
1145118880 17:20237690-20237712 CACATTACTCAAGGCAAAATAGG + Intronic
1150102575 17:62437209-62437231 CCCAAAATTCAAGGCTACAGTGG - Intronic
1155460346 18:26072941-26072963 AACAATCATTAAGGCTACAGAGG + Intronic
1158666777 18:59439684-59439706 CACATTAAGCAAGGCCGGAGGGG - Exonic
1161032125 19:2062349-2062371 TTCATTGATCAGGGCTACAGTGG - Intergenic
925213791 2:2074640-2074662 CACACTGAACAAGGCTAGAGAGG + Intronic
929951843 2:46417229-46417251 CAAATTAATCAAGCCCAAAGTGG + Intergenic
930541566 2:52713109-52713131 CAGATTAGTCTAGGCTGCAGTGG + Intergenic
931283246 2:60811786-60811808 CAAATGAATCATGCCTACAGAGG - Intergenic
931745141 2:65285323-65285345 CATATTAATGGAGGCTACAGAGG + Intergenic
933216017 2:79630789-79630811 CACATTAAACAATGCTATATGGG + Intronic
937253457 2:120538876-120538898 CACATTTTACAAGGCTCCAGTGG - Intergenic
939764441 2:146228722-146228744 GTCATTAATCAAGGCAACAAAGG - Intergenic
939878420 2:147603359-147603381 GCCATTAATCAAGGGTAAAGAGG - Intergenic
942243153 2:173982729-173982751 CACCTTAATCAAGGCCATATGGG - Intergenic
942731345 2:179064025-179064047 CACAATAAAAAAGGATACAGGGG - Intergenic
947508236 2:230726554-230726576 CACATTAGTCACAGGTACAGTGG + Intronic
1170155803 20:13268435-13268457 GACATTACTCAATGCAACAGAGG - Intronic
1170495605 20:16921600-16921622 AACATCAAGGAAGGCTACAGGGG - Intergenic
1170715729 20:18829243-18829265 CACATCAATCAAGACTACAAAGG - Intronic
949373473 3:3361263-3361285 CACACTAATCAAGGTAACAAAGG + Intergenic
950766533 3:15277361-15277383 CACACAAATCAAGGACACAGTGG + Intronic
951517391 3:23576307-23576329 AACATTAATCAAAGATACAGTGG + Intronic
951912727 3:27768480-27768502 CCCATAAATCATGGCTCCAGAGG - Intergenic
952054975 3:29433346-29433368 CACATTCATCAAGATTCCAGTGG - Intronic
953617281 3:44502717-44502739 CAGAGTCATCAAGGGTACAGAGG + Intronic
953773100 3:45793775-45793797 CACATTATGAAAGGCTGCAGAGG - Intronic
953953718 3:47213833-47213855 CACATTAATAAAGGGTAAAATGG + Intergenic
958917203 3:100062816-100062838 CACAGTAATCCAGGCTGGAGGGG - Intronic
959800039 3:110482540-110482562 CACATTTAATAAGGCTATAGCGG + Intergenic
967778717 3:193412671-193412693 CACATTCATTAAGGCTATATGGG + Intronic
971406782 4:26328949-26328971 AATATTAATCAGGGATACAGAGG + Intronic
976741019 4:88357732-88357754 CCCATTAATCAAGATTTCAGAGG + Intergenic
980440119 4:132831710-132831732 CACATTAAAGAAGACTACAGAGG - Intergenic
980511294 4:133791660-133791682 CATTTTAATCTAGGCTACATTGG + Intergenic
980588760 4:134855481-134855503 CAAATTAATCAATTCTGCAGAGG + Intergenic
980802025 4:137764107-137764129 AACATTTATAAAGTCTACAGTGG + Intergenic
981541426 4:145850364-145850386 TACATTAATCAAGGATAAATAGG + Intronic
982819338 4:159926901-159926923 CACCTTAGTCAAGGCTCAAGTGG - Intergenic
983079965 4:163372815-163372837 CAAATTAATCAAACCTAAAGAGG - Intergenic
984773532 4:183459707-183459729 GACAAAAATCAAGGCTACAGAGG + Intergenic
986049791 5:4078161-4078183 AACATAAATCAAAACTACAGGGG - Intergenic
988890363 5:35609932-35609954 CAAATTAATCAAGCCCAAAGAGG + Intergenic
992106663 5:73453600-73453622 CACCTTAATCAAGGTTCCAGTGG + Intergenic
992909675 5:81383453-81383475 CACATTAATCAAGGCTACAGTGG + Intronic
994180455 5:96758088-96758110 CACATTTTTAATGGCTACAGTGG - Intronic
1000010740 5:157229611-157229633 CACATTAAAAAAGACTAAAGAGG + Intronic
1000392542 5:160740096-160740118 CCCATTAATAAATGCTAAAGTGG + Intronic
1001879284 5:175229265-175229287 CACATTAAGCAATTCTCCAGTGG - Intergenic
1005011619 6:21341272-21341294 CACATTAAGCAAGGTTAAGGAGG - Intergenic
1010567474 6:77433490-77433512 TACATTAATCAAGCCAACATGGG - Intergenic
1011391135 6:86854843-86854865 CAAATTAATCAAGCCTGAAGAGG - Intergenic
1011817306 6:91207785-91207807 AACATAATTCAAGGCTACTGTGG - Intergenic
1012213771 6:96557032-96557054 CACTCTAATCATGGCTTCAGAGG - Intergenic
1013243499 6:108267350-108267372 CACATTAATCAAGTTCACAAGGG - Intergenic
1013337881 6:109183612-109183634 AACATTTATCAAGACTGCAGAGG + Intergenic
1016285504 6:142468355-142468377 TGCATTACTCAAGGCTAAAGAGG - Intergenic
1017555800 6:155566349-155566371 CACAATAAAAAAGGCAACAGAGG - Intergenic
1018774737 6:167002605-167002627 CACATTAATTGCTGCTACAGTGG - Intronic
1019001049 6:168752433-168752455 CACATTAATCAAAAGTAAAGGGG - Intergenic
1022237011 7:28471874-28471896 CAGATTAATAGTGGCTACAGTGG - Intronic
1025936180 7:66039510-66039532 CAAATTAATGAAGCCTAAAGAGG - Intergenic
1025947988 7:66119408-66119430 CAAATTAATGAAGCCTAAAGAGG + Intronic
1027355167 7:77347245-77347267 CAAATTAATCAAACCTAAAGAGG + Intronic
1032031781 7:128490398-128490420 CCCAAAATTCAAGGCTACAGTGG - Intronic
1032913672 7:136462718-136462740 CAAATTAATTAAGCCTAAAGAGG + Intergenic
1035797374 8:2370753-2370775 CACATTAATGAAAGTTCCAGGGG + Intergenic
1037354623 8:18004477-18004499 CACTTAAATCAGGGCTACACAGG - Intronic
1037858105 8:22386021-22386043 CACATTAATCCAGGAGGCAGAGG - Intronic
1039333478 8:36564353-36564375 CAGACTAATCAAACCTACAGTGG + Intergenic
1047982482 8:130197488-130197510 CACTTTATTCCAGGCCACAGAGG + Intronic
1049156142 8:141067859-141067881 CCCCTTAATCCAGGCCACAGTGG - Intergenic
1050291356 9:4158678-4158700 CATATTAACCAAGGATACAATGG + Intronic
1051352005 9:16205787-16205809 CCTATTGATCAAGGGTACAGAGG + Intronic
1052721993 9:32183088-32183110 GACAATAATCAAGGCAAAAGAGG + Intergenic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1056211918 9:84372793-84372815 AACATTTATCAGGCCTACAGGGG - Intergenic
1056326112 9:85480295-85480317 CACAATAATCCAGGCAAGAGAGG - Intergenic
1056479219 9:86984098-86984120 CACATCCATCACGCCTACAGAGG - Intergenic
1057884638 9:98821046-98821068 CAGATGAATCAAGAGTACAGTGG + Intronic
1059699671 9:116763106-116763128 CCCAATAATCATGGCTTCAGTGG + Intronic
1185526107 X:781541-781563 TACATTAATCAAAAATACAGTGG - Intergenic
1186791952 X:13008264-13008286 CATATTAATCTTGGCCACAGGGG + Intergenic
1186979777 X:14946329-14946351 CAAATTAATCAAACCTCCAGAGG + Intergenic
1193293666 X:79808619-79808641 CACATTAAATAAGGCACCAGTGG - Intergenic
1195859016 X:109360733-109360755 CAAATTGCTCAAGGCCACAGAGG - Intergenic
1196062967 X:111431092-111431114 GCCATTAAGCAAGCCTACAGAGG + Intergenic
1198321058 X:135519704-135519726 AAGATTAAACAAGGCTACCGTGG + Intergenic