ID: 992913737

View in Genome Browser
Species Human (GRCh38)
Location 5:81425917-81425939
Sequence CACAGAAGGAGGCCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 522}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992913737_992913743 16 Left 992913737 5:81425917-81425939 CCCTTCCCAGGCCTCCTTCTGTG 0: 1
1: 0
2: 4
3: 48
4: 522
Right 992913743 5:81425956-81425978 AAACCTGACAGATCCTTAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992913737 Original CRISPR CACAGAAGGAGGCCTGGGAA GGG (reversed) Intronic
900095511 1:938510-938532 CCAAGTAGGAGGCCTGGGAGTGG + Intronic
900407472 1:2498910-2498932 CACTGAGGGAGGCCTGGGCAGGG - Intronic
900410304 1:2509677-2509699 CCCCGAAGGTGGCCTGGGGAGGG - Intronic
900605714 1:3522724-3522746 CACAGTAGGAGGCCAGGAGAAGG + Intronic
900688415 1:3964443-3964465 CACCGAATGAGGGCTGAGAAGGG + Intergenic
900983704 1:6060954-6060976 CACAGAACGAGGCCTGTGGAGGG - Intronic
901537363 1:9891261-9891283 CTCAGAGGCAGGCCTGGGCATGG + Intronic
901845878 1:11981701-11981723 CCCTGCAGGAGCCCTGGGAAAGG - Intronic
901909596 1:12445518-12445540 CACAAAGGGTGACCTGGGAAAGG - Intronic
902005131 1:13225907-13225929 CCCAGAGGGAGGCAGGGGAAGGG + Intergenic
902024356 1:13371701-13371723 CCCAGAGGGAGGCAGGGGAAGGG + Intergenic
902238485 1:15073259-15073281 TACAGGATGGGGCCTGGGAATGG - Intronic
902645227 1:17793124-17793146 AACAGATGCCGGCCTGGGAATGG + Intronic
903006012 1:20299348-20299370 CACACAAAGAGGCCTCAGAATGG - Intronic
903145384 1:21368708-21368730 CAAGGTGGGAGGCCTGGGAATGG + Intergenic
903180880 1:21604266-21604288 CAGAGAAGGAAGCCAGGGGAAGG + Intronic
903501704 1:23803942-23803964 CATGGAAGGGGCCCTGGGAAGGG - Intronic
904081961 1:27877840-27877862 CTTAGAAGGGGGCCTGGGACAGG + Intronic
904500790 1:30911707-30911729 TGCACAAGGAGGCCTGGGCAAGG - Intergenic
904732805 1:32607336-32607358 AGCAGAAAGAGGCCAGGGAATGG + Intronic
904942133 1:34171258-34171280 CACAGAAGGATCCAGGGGAAAGG - Intronic
905445761 1:38027639-38027661 CTCAGCAGTAGGCTTGGGAAGGG - Intergenic
905478563 1:38245839-38245861 CACAGAAGGAGCCATGCCAAAGG + Intergenic
905916525 1:41688451-41688473 CCCAGAAAGAGGGCTGGGGAGGG - Intronic
906279419 1:44543161-44543183 CAAAGAGGAAGGCCTGGGGATGG - Intronic
906524036 1:46484148-46484170 TGTACAAGGAGGCCTGGGAAAGG - Intergenic
906789485 1:48646120-48646142 CACAGCATGATGCCTTGGAAGGG + Intronic
906866828 1:49430275-49430297 CAGAGAAGGGAGCCTGGGACAGG - Intronic
907254988 1:53172370-53172392 CACAGGTGGAAGCCTCGGAAGGG + Intergenic
907450421 1:54542476-54542498 CACAGGAGGAGCCCAGGAAACGG - Intronic
907525125 1:55049587-55049609 GATAGAGGGAGGCCTAGGAAGGG + Intronic
907609087 1:55849805-55849827 GGCAGAAGGCAGCCTGGGAAAGG + Intergenic
908178281 1:61578357-61578379 GACAGAAGTAGGCTTTGGAAGGG - Intergenic
909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG + Intergenic
911165458 1:94720635-94720657 AAGTGAAGGAGGCCTGGCAAAGG - Intergenic
911650251 1:100380249-100380271 CAGAAAGGGAAGCCTGGGAAAGG + Intronic
911986187 1:104626751-104626773 CACAGAAAGTGGACTGGCAATGG - Intergenic
912411740 1:109484641-109484663 CAGGGCAAGAGGCCTGGGAAAGG - Intronic
912812352 1:112803825-112803847 CAGAGGAGGTGTCCTGGGAAGGG - Intergenic
912822456 1:112878914-112878936 CAAAGAAGGTGCCCAGGGAAGGG - Intergenic
912963664 1:114218081-114218103 CTCTGAAGGAGGGGTGGGAATGG + Intergenic
913530341 1:119729499-119729521 CGGAGAAGGAAGCCTGGGGAAGG - Intronic
914424964 1:147567158-147567180 AGCAGAAGGAGGGTTGGGAAGGG - Intronic
914456408 1:147841139-147841161 CCCAGAGGGAGGCGGGGGAAGGG - Intergenic
915044488 1:153000515-153000537 CACACCAGGAGGCCTGGCACAGG + Intergenic
915252122 1:154598034-154598056 CACAGAAGAAGGGATGGGGATGG + Intronic
915835514 1:159172402-159172424 CAGAGAAGGGGGCCTGGGTGAGG + Intronic
915837892 1:159192496-159192518 CAAAGAAGCTGGCCTGGGATTGG + Intronic
915895303 1:159807339-159807361 CTCAGAAGGCTGTCTGGGAATGG + Intronic
915918448 1:159956174-159956196 CAAAGAAGGAGGCTGGGCAAGGG + Intergenic
915954909 1:160213470-160213492 CACCGAAGAAGGCCTGAGCAAGG + Exonic
916242970 1:162658144-162658166 CACAGCAAGTGGCCTAGGAATGG + Intronic
917621843 1:176804251-176804273 CACAGGATGAGTCCCGGGAATGG - Intronic
918113093 1:181475468-181475490 CATAGAAGGATGCCTAGGAGTGG + Intronic
918315109 1:183316705-183316727 TATAGAAGGAGCCCTGGTAAGGG - Intronic
919353652 1:196493696-196493718 CACACAATGGGGCCTGGGGAAGG - Intronic
919355158 1:196512949-196512971 CACAGAAGGAAGTATTGGAAAGG + Intronic
919910776 1:202109341-202109363 TCCAGAGGGAGACCTGGGAAAGG + Intergenic
920204114 1:204279107-204279129 CACAGAAGGAGGAGGGGGTAGGG + Intronic
920215994 1:204361865-204361887 CCCAGAGGGAGGCCGGGGAGGGG + Intronic
920309518 1:205040604-205040626 GACAGAGTGAGGCCTGGGATCGG - Intergenic
921184612 1:212658673-212658695 CACAGCTGGAGGTCTGAGAACGG + Intergenic
921924790 1:220702712-220702734 CACAGAAGGAAGAATGTGAAGGG + Intergenic
921981581 1:221264351-221264373 CACAGAATGAGGTCTGGGGTAGG - Intergenic
922182235 1:223244381-223244403 CACAAGAGGAGGCCAGGAAAAGG + Intronic
922419660 1:225451037-225451059 CAGAGGAGGAGGCCAGTGAAGGG - Intergenic
922867655 1:228873865-228873887 CACTGAAGGAGGGCTGGGATGGG + Intergenic
923164190 1:231343685-231343707 CACAGCATGAGACCTGGGACAGG - Intronic
923766850 1:236900459-236900481 CACAGAAGGAGGAAGTGGAAGGG + Exonic
924612931 1:245588810-245588832 AACAGATGCAGTCCTGGGAAAGG + Intronic
1063362176 10:5467838-5467860 CAGGGAAGGCTGCCTGGGAAAGG - Intergenic
1063373013 10:5533842-5533864 CTCATTAGGAAGCCTGGGAATGG + Intergenic
1063390214 10:5645461-5645483 CAAAGGAGGAGGGCTGGGGAGGG - Intronic
1063464621 10:6234751-6234773 CAAAGAATGAGGCCTGCGAGGGG - Exonic
1063626935 10:7699003-7699025 CAAAGAGGCAGGCCAGGGAAGGG + Intergenic
1063631004 10:7733750-7733772 GACAGAATGAGGCTTGGGAATGG - Intronic
1063692121 10:8296851-8296873 CAGAGAAGGAGGGGAGGGAAGGG - Intergenic
1065348124 10:24768756-24768778 CACAGAAGGAGGCCTAATCAAGG + Intergenic
1065903906 10:30231432-30231454 TACACAAGGAAGTCTGGGAAAGG + Intergenic
1067211920 10:44266534-44266556 CACTTAACGTGGCCTGGGAAGGG + Intergenic
1067516474 10:46950492-46950514 CAAGGAATGAGGTCTGGGAAGGG + Intronic
1067645778 10:48101301-48101323 CAAGGAATGAGGTCTGGGAAGGG - Intergenic
1068855642 10:61794913-61794935 CAGAGAAAGAGGCCAGGGTAAGG + Intergenic
1069074168 10:64020866-64020888 CACAGATGGAGATCTGAGAACGG - Intergenic
1070728041 10:78805300-78805322 CAGAGAAGCAGGCTTGGGGAAGG - Intergenic
1070806007 10:79271082-79271104 CTCAGAAGGAGGCAGGGGGAAGG + Intronic
1072407490 10:95168661-95168683 AAAAGAAGGAACCCTGGGAAAGG + Intergenic
1072542302 10:96407247-96407269 CACTTGAGCAGGCCTGGGAAGGG - Intronic
1072581083 10:96740714-96740736 TACAGAAGAAGGGGTGGGAAAGG - Intergenic
1072739811 10:97902570-97902592 AATAGAAGGAGAGCTGGGAAGGG + Intronic
1072798901 10:98378236-98378258 CCTAGAAGGAAGCCTGAGAAGGG - Intergenic
1074143670 10:110698323-110698345 CACAGGAGGTGGGCTGGGAAGGG + Intronic
1074470487 10:113722164-113722186 CTCAGAAGGATGCCTGTGCAGGG + Intronic
1076338393 10:129725997-129726019 CACAGAACGAGCCTTGGGAGAGG + Intronic
1076688636 10:132209480-132209502 CCCAGAAGCAGGCCTGGGACAGG - Intronic
1076945210 10:133642655-133642677 AACAGGAGAAGGCCTGGGGAAGG + Intergenic
1077212965 11:1382038-1382060 CAAGGAGGGAAGCCTGGGAAGGG - Intergenic
1078114041 11:8426938-8426960 CACATGAGGAGCACTGGGAAGGG - Intronic
1078250542 11:9613472-9613494 CATAGAAGGAGGCCTGTCAAAGG - Intergenic
1078581861 11:12545027-12545049 CACTAAAGGAGGACTGGGGAAGG + Intergenic
1078638992 11:13077942-13077964 CATATAAGGAGGCCTGGCACTGG + Intergenic
1079444566 11:20547068-20547090 CAGAAAGGGAGGCCTGGAAAAGG - Intergenic
1079478160 11:20853234-20853256 CAGAGAAGGAAGTGTGGGAAAGG + Intronic
1081700780 11:45151262-45151284 CTCAGAGTGAGGCCTGGGAGGGG + Intronic
1081729218 11:45357165-45357187 GACATAAGGAGCCCTGGGAGAGG - Intergenic
1081741680 11:45445304-45445326 CACAAAAGGCTGCCTGGCAATGG - Intergenic
1081771279 11:45651806-45651828 CACAGAAGGGGGACTGGGGAGGG + Intronic
1083208824 11:61169964-61169986 CAGGGAAGCAGGACTGGGAAGGG + Intergenic
1083353454 11:62047608-62047630 CAGGGAAGGAGGACAGGGAAGGG - Intergenic
1083616299 11:64028289-64028311 CACAGGACAAGGCCTGGGAGGGG - Intronic
1083812214 11:65112325-65112347 CTAAGATGGACGCCTGGGAAGGG + Intronic
1084220608 11:67675303-67675325 CACAGAGGGAGACGTGAGAATGG + Intronic
1084440452 11:69169846-69169868 CTCAGAAGGATTCCAGGGAAGGG - Intergenic
1084574310 11:69978644-69978666 TCAAGAAGGAGGCCTGGGCAGGG - Intergenic
1085196253 11:74673628-74673650 CAGAGAAGGTTTCCTGGGAAAGG - Intergenic
1085385781 11:76157385-76157407 CAATGTGGGAGGCCTGGGAAGGG + Intergenic
1085901341 11:80703385-80703407 TAGAGATGGAGTCCTGGGAAAGG + Intergenic
1085922365 11:80972617-80972639 CAAAGATGGAGGCTTGAGAAGGG + Intergenic
1086405460 11:86495540-86495562 CACAGCAGGAGGTGTTGGAAAGG + Intronic
1087220956 11:95545820-95545842 CACAGAAGGAATCGTGGAAATGG - Intergenic
1089014658 11:115156289-115156311 CCCAGAAGGAGCCCAGGGACAGG - Intergenic
1089386980 11:118074887-118074909 CACATAAGCAGGACTGGGCAGGG - Intergenic
1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG + Intergenic
1090284155 11:125484765-125484787 TACAGAAGGAGGAATGGCAAAGG + Intronic
1090541456 11:127710986-127711008 GACAGAAGGAGGGGTGGGGAGGG + Intergenic
1090809118 11:130221285-130221307 CCCTGGAGAAGGCCTGGGAAGGG - Intergenic
1091000165 11:131904355-131904377 AACAGAAAGAGCCCTAGGAATGG - Intronic
1091668927 12:2438618-2438640 CACAGAATGTGGCTGGGGAACGG + Intronic
1092329598 12:7571528-7571550 CAGGGAAGGAGGGCTGGGGAAGG - Intergenic
1094138707 12:27157842-27157864 AACAGAAAGAGGCCTTGTAAGGG - Intergenic
1095960328 12:47830426-47830448 CAGAGAAGGAGCACTGGGAAGGG - Intronic
1096465863 12:51847645-51847667 CAGAGGAGGAGGCCTGGGAAGGG - Intergenic
1096512008 12:52135788-52135810 TACAGAAGGAGGGTTGGGCATGG - Intergenic
1097173244 12:57128851-57128873 CAGAGAAGGAGGAGGGGGAAAGG + Exonic
1097338516 12:58411725-58411747 CACAGAAGGTGGCATTTGAAAGG + Intergenic
1100065693 12:90641426-90641448 AGCAGATGGAGGCATGGGAAGGG + Intergenic
1101053505 12:100888452-100888474 AAGAGCAGGAGCCCTGGGAAAGG + Intronic
1101963238 12:109265379-109265401 CCCACAAGTAGGCCTGGGGAGGG - Exonic
1101991284 12:109487445-109487467 CAAAGAGGGATGGCTGGGAATGG - Intronic
1102031429 12:109742055-109742077 CACAGAAAGAGGCTGGGGCAGGG + Intronic
1103271508 12:119677472-119677494 CACAGGAGGTGACCTGAGAAAGG - Intronic
1103319798 12:120085524-120085546 AGCAGAAGGAGGCCAGGCAAGGG + Intronic
1103495322 12:121357611-121357633 AAAAGAAAGAGGCCTGGGCACGG + Intronic
1103917630 12:124384207-124384229 CGCAGAAGGGGGCCTGGGCCGGG - Intronic
1104049346 12:125185777-125185799 CAGCGAAGGCGGCCTGGGGATGG - Intergenic
1104316355 12:127706136-127706158 CACAGAAGGAACCCGGGGAGGGG - Intergenic
1104773247 12:131377930-131377952 CACAGCAGGAGAGATGGGAACGG + Intergenic
1104949002 12:132430380-132430402 CAGAGAGGCAGGTCTGGGAAGGG + Intergenic
1105291553 13:19056689-19056711 CACAGGAGGAGGCCTGGCTGCGG + Intergenic
1105429938 13:20327116-20327138 CATACAACGGGGCCTGGGAAAGG - Intergenic
1107656713 13:42598957-42598979 AAGAAAACGAGGCCTGGGAAGGG + Intronic
1107975428 13:45683847-45683869 GACAGAAGGCAGCCTGGGAGAGG - Intergenic
1108289029 13:48939384-48939406 CACAAAAGCAGGGCTGGGGAAGG + Intergenic
1108523855 13:51268612-51268634 CTCAGGAGGAGGCCTGTGCATGG + Intronic
1108676493 13:52741370-52741392 CACAGAGAAAGGCCTTGGAAGGG + Intergenic
1110337827 13:74352537-74352559 CACACACGGAGGCCTGTCAAGGG + Intergenic
1111075999 13:83236346-83236368 CACAGGAGGAGGCAAGGTAAAGG + Intergenic
1112246222 13:97736510-97736532 GAGATAAGGAGGCCAGGGAAAGG + Intergenic
1112558077 13:100487670-100487692 CACAAAATGAGCTCTGGGAAAGG - Intronic
1113513178 13:110871967-110871989 CACAGAAAGACGGCAGGGAAGGG + Intergenic
1113616572 13:111684804-111684826 CTCAGAATGAGGCCACGGAAGGG + Intergenic
1113622102 13:111770075-111770097 CTCAGAATGAGGCCACGGAAGGG + Intergenic
1113937940 13:114005104-114005126 CACAGACTGAGGCCTCGGAAGGG + Intronic
1114263329 14:21055557-21055579 CACTCAGGGAGGCCTGGGAATGG - Intronic
1114499787 14:23160155-23160177 CACAGATGGAAGCCTGGGAAAGG + Intronic
1114671231 14:24412149-24412171 CACCCAACCAGGCCTGGGAAGGG + Intronic
1115200136 14:30844152-30844174 AACAAAAGGAGGGCTGGGCATGG - Intergenic
1115387373 14:32813405-32813427 CACCGAAGGACCTCTGGGAAAGG - Intronic
1115671462 14:35617189-35617211 GACAGGAGGGGGACTGGGAATGG + Intronic
1117472789 14:56063242-56063264 CACAGGAGGAGGCCTGGAGCAGG - Intergenic
1118103996 14:62637201-62637223 CACAGATGGAGATCTGAGAATGG + Intergenic
1118470139 14:66067760-66067782 ATCAGAAGCAGGCCTGGGAATGG + Intergenic
1119185063 14:72634830-72634852 CACCCAGGGGGGCCTGGGAAGGG - Intronic
1119787560 14:77324753-77324775 CACAGATGCAGGCCTGAGAGAGG + Intronic
1119787985 14:77327074-77327096 AGTAGCAGGAGGCCTGGGAAGGG + Intronic
1120574104 14:86159316-86159338 AAAAGAAGGAGATCTGGGAAGGG - Intergenic
1120791616 14:88589347-88589369 CAGAGAAGAAGGCTTGTGAATGG - Intronic
1120856170 14:89214387-89214409 CAAACAAGAAGGCCTGGCAAGGG - Intronic
1121798505 14:96754856-96754878 GCCAGATGGAGGCCTGGGCAGGG + Intergenic
1121897705 14:97663976-97663998 CAGAGAAGGCTGCCTGGAAAAGG + Intergenic
1122228282 14:100292245-100292267 CTGAGAAGGAGCCCTGGGGAAGG + Exonic
1122454286 14:101837859-101837881 CACAGATGGGGGAATGGGAAGGG + Intronic
1122496715 14:102161892-102161914 CAAAGAAGGAGGTTTGGTAAAGG - Intronic
1123038672 14:105481605-105481627 CACACAAGGAAGCCTGGGCCTGG - Intergenic
1202918544 14_KI270723v1_random:7979-8001 AACAGGAGAAGGCCTGGGGAGGG + Intergenic
1202926078 14_KI270724v1_random:26592-26614 AACAGGAGAAGGCCTGGGGAGGG - Intergenic
1123444110 15:20311677-20311699 CACAGCTGGAGGTCTGAGAACGG + Intergenic
1123965558 15:25453414-25453436 CACAGCAGGAGGCGAGGGCAGGG + Intergenic
1124512416 15:30338526-30338548 AACAGCAGGAGAGCTGGGAAGGG + Intergenic
1124730498 15:32192225-32192247 AACAGCAGGAGAGCTGGGAAGGG - Intergenic
1125749291 15:42017994-42018016 CACAGAATTGGGACTGGGAAGGG + Intronic
1125793798 15:42389600-42389622 CCCTGAAGGAGGCCTGGCCATGG - Intronic
1126335014 15:47577584-47577606 GACTGAAGGTGCCCTGGGAAAGG + Intronic
1127045215 15:55018076-55018098 CACAGCAGGAGGCCAGTGAAGGG + Intergenic
1127428430 15:58878566-58878588 CACAGCTGTAGGACTGGGAATGG + Intronic
1128764627 15:70243606-70243628 CTGGGAGGGAGGCCTGGGAAGGG + Intergenic
1129167124 15:73784992-73785014 CACAGAAGGAAGCCAGTGGAAGG + Intergenic
1129229491 15:74188882-74188904 CACAGAAGCAGGCAAGGGACAGG + Intronic
1129253852 15:74322967-74322989 CAGAGAAGGAGGCCTGAGACAGG - Intronic
1129465453 15:75722077-75722099 CACATGAGGAGGTCTGGGAACGG + Intergenic
1129649606 15:77474125-77474147 CGCAGAAGGAGCCCATGGAAAGG + Intronic
1129842605 15:78753018-78753040 CACAGCAGGTGGCCTGGGGCAGG - Intergenic
1130050562 15:80480394-80480416 CACAGGAGGGAACCTGGGAAAGG - Intronic
1130274340 15:82468735-82468757 CACAGAAGCAGTGCTGGGATGGG - Intergenic
1130404619 15:83587177-83587199 AACAGAATGAGGCAGGGGAAGGG - Intronic
1130466686 15:84196109-84196131 CACAGAAGCAGTGCTGGGATGGG - Intergenic
1130497578 15:84477427-84477449 CACAGAAGCAGTGCTGGGATGGG + Intergenic
1130530911 15:84747821-84747843 CAGAGATGGAGGACTGGCAACGG - Intergenic
1130588982 15:85200702-85200724 CACAGAAGCAGTGCTGGGATGGG - Intergenic
1130645952 15:85727270-85727292 GACATCAGGAGGGCTGGGAAGGG - Intronic
1131029252 15:89172858-89172880 AATAGGATGAGGCCTGGGAATGG - Intronic
1131036098 15:89222929-89222951 CAGAGTAGGAGCCCAGGGAAAGG - Intergenic
1131355733 15:91744419-91744441 AACAGAAAGAGGACTGGGTATGG - Intergenic
1131457862 15:92597319-92597341 GAGAGAAGGAGGCCTGGGAAAGG + Intergenic
1131804106 15:96103952-96103974 CACAGAAGAAGGGGTGGGATGGG + Intergenic
1132233370 15:100200944-100200966 CATGGAAGGAGCCCTTGGAAAGG - Intronic
1132660056 16:1057344-1057366 AACAGATTCAGGCCTGGGAACGG + Intergenic
1132867999 16:2103338-2103360 CACCGACGGAGGCCTGGGGCTGG + Exonic
1134031209 16:10993893-10993915 CAGAGAAGGTGACCTGGGATGGG + Intronic
1134523772 16:14929776-14929798 CACCGACGGAGGCCTGGGGCTGG - Intronic
1134549130 16:15131159-15131181 CACCGACGGAGGCCTGGGGCTGG + Intronic
1134711363 16:16328261-16328283 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134719213 16:16371564-16371586 CACCGACGGAGGCCTGGGGCTGG - Intergenic
1134948213 16:18340321-18340343 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1134955466 16:18380432-18380454 CACCGACGGAGGCCTGGGGCTGG + Intergenic
1134998366 16:18756779-18756801 CAGAAAGGGTGGCCTGGGAAGGG - Intergenic
1135969400 16:27061351-27061373 CACTGAGGGAGCCCTGGGGAGGG - Intergenic
1136082990 16:27865089-27865111 CACAGAAGAATGCGTGGGACTGG - Intronic
1136399342 16:30009384-30009406 CGAAGGAGCAGGCCTGGGAAGGG + Intronic
1137371499 16:47910521-47910543 CACAGTTGGAGACCTGAGAACGG + Intergenic
1137469719 16:48743454-48743476 CAGGGAAGGAAGCCAGGGAAAGG + Intergenic
1137961716 16:52887842-52887864 CACAGTAGGAAGCCATGGAAGGG + Intergenic
1137983806 16:53091175-53091197 CTTGGAAGGAAGCCTGGGAAGGG + Intronic
1138473372 16:57256261-57256283 TACAGAGAGAGGCTTGGGAAAGG + Exonic
1139259201 16:65575988-65576010 CAGAGAAGGAGAGCAGGGAATGG - Intergenic
1139305891 16:65986152-65986174 CACAGAACCAGGGCTGGGAATGG - Intergenic
1139810988 16:69616825-69616847 AATAGGGGGAGGCCTGGGAAGGG - Intronic
1140113991 16:72026074-72026096 CACTGAAGGAGAAATGGGAATGG + Intronic
1141616829 16:85214657-85214679 CAGAGAGGGAGGCCTCAGAAGGG - Intergenic
1141887288 16:86901305-86901327 CAGAGAGAGTGGCCTGGGAAAGG + Intergenic
1141896739 16:86963227-86963249 CAGAGAGGCAGGCGTGGGAAAGG - Intergenic
1141969902 16:87474166-87474188 CAGAGAAGCAGGCCTGGGCTAGG - Intronic
1142362882 16:89635635-89635657 CACAGAAAAAGGCCCTGGAAGGG + Intronic
1142541584 17:663998-664020 CACAGAAGGTCTCCTGAGAAAGG + Intronic
1142690960 17:1605879-1605901 CACAGGAGGTGGCCGGGGGAGGG - Intronic
1143121925 17:4613502-4613524 AACAGATGGAGGAATGGGAATGG - Intergenic
1143248460 17:5504781-5504803 CCCAGAATGCGGCCTGGGAAAGG - Intronic
1144065299 17:11619245-11619267 CACAAAAGAATACCTGGGAAAGG + Intronic
1145002053 17:19312506-19312528 CACAGCAGGAAGCCTGGCACAGG - Intronic
1145268660 17:21392669-21392691 CAGAGAATGAGGCCTGAGACTGG + Intronic
1146628450 17:34452848-34452870 AAAAAAAGGAGGCCTGGGGATGG - Intergenic
1146688120 17:34855449-34855471 CAGAGAGGGAGGGCAGGGAAGGG - Intergenic
1146788200 17:35735963-35735985 AACAGACGGGGCCCTGGGAAAGG + Intronic
1147038111 17:37696909-37696931 AAGAGAAGGAGGAATGGGAAAGG - Intronic
1147506833 17:41026693-41026715 GGCAGCAGGAGGCCTGGGCATGG + Exonic
1147725182 17:42562508-42562530 CAGAGAAGGAGGCCTGGAGCAGG - Intronic
1148155639 17:45424070-45424092 CAGACATGGAGGCCTGGGCAGGG + Intronic
1148581461 17:48747024-48747046 CCCAGAAGGAGCCCCGGGAAGGG - Intergenic
1148889636 17:50798604-50798626 CACAGAAGGCGTCTAGGGAAGGG + Intergenic
1149485508 17:57039710-57039732 CAAGGAAGGAGCCCAGGGAAGGG - Intergenic
1149867132 17:60157233-60157255 CCAAGGAGGAGGCCAGGGAAAGG + Intronic
1151318116 17:73336435-73336457 CCAATAAGGAGGCCTGGGAAGGG - Exonic
1151742840 17:75995650-75995672 CTCTGGAGTAGGCCTGGGAAAGG - Intronic
1152285721 17:79411556-79411578 CACAGAGGGAGGGCATGGAAGGG - Intronic
1152481899 17:80559798-80559820 CACAGAAGGGAGCCTCGGAATGG + Intronic
1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG + Exonic
1156013894 18:32526453-32526475 CAAAAATGGAGGACTGGGAAGGG + Intergenic
1156311297 18:35924579-35924601 CAAAGAATTAGGGCTGGGAAGGG - Intergenic
1157421732 18:47553657-47553679 CCCAGAGGGAGGCCCAGGAAAGG - Intergenic
1157593719 18:48851233-48851255 CAGGGAAGAAGGCATGGGAAGGG + Intronic
1158152997 18:54393461-54393483 CAGATAAGGAGGCCTGTGGAAGG - Intergenic
1159105722 18:64000619-64000641 CCCATAAGGAGGCCTCTGAATGG - Intronic
1160538004 18:79605597-79605619 CAGAGAAGGAGCCCTGGGGGAGG - Intergenic
1160844353 19:1159917-1159939 CAGAGGAGGGGGCCAGGGAAGGG + Intronic
1161256290 19:3311627-3311649 TAAAGATGGAGGCCTGGCAAAGG - Intergenic
1161747233 19:6068498-6068520 GACAGAAGGAGTGCTGGGATAGG + Intronic
1162945364 19:14039982-14040004 CACAGAATGAGTCCTGGGCTGGG - Intronic
1164531912 19:29055303-29055325 CACAGAGGGTGCTCTGGGAAGGG + Intergenic
1164615690 19:29665660-29665682 CCCAAGAAGAGGCCTGGGAAGGG + Intronic
1164828059 19:31298760-31298782 CACAGAACGAGGACTGGAATTGG + Intronic
1164888027 19:31799827-31799849 CACAGACACAGGACTGGGAAAGG + Intergenic
1164927847 19:32144173-32144195 CCCTGATGAAGGCCTGGGAAAGG - Intergenic
1164999528 19:32749508-32749530 CTCAGATGAAGGCCTGGGACTGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165490608 19:36120963-36120985 GACAGACGGAGGCCTGGGGTGGG + Intronic
1165724110 19:38100723-38100745 CACAGTAGGTGGACTGGGATGGG - Intronic
1165833055 19:38738606-38738628 CACAGAAGAGGGCCTGGTAAAGG - Exonic
1166533019 19:43553671-43553693 CAAAGGGGGAGTCCTGGGAAAGG + Exonic
1166881118 19:45930703-45930725 CCTAGAAAGAGGGCTGGGAAGGG - Intergenic
1167000860 19:46745474-46745496 CACGGAAGGAGGGCTGTGTAAGG - Intronic
1167211534 19:48136821-48136843 GACAGAAGCTGGCCTGTGAAAGG + Intronic
1167735749 19:51293700-51293722 CCCAGAAGGAGCCCTGGGCTGGG - Intergenic
925063589 2:912144-912166 CTCAGACAGAGGACTGGGAAGGG + Intergenic
925466425 2:4110728-4110750 CACGGAAGGAGGGCAGGGAATGG - Intergenic
925730774 2:6918084-6918106 CCCAAGAGGAGGTCTGGGAAAGG + Intronic
925917680 2:8618484-8618506 CACTCAAGGAGGCCTGAGCAGGG + Intergenic
926171650 2:10556477-10556499 CACCCATGGAGGCCTGGGATGGG - Intergenic
926220614 2:10933371-10933393 TACAGAAGAAGGCGTGGGTATGG - Intergenic
926584316 2:14669417-14669439 GAGAGAAGGAGCCCTGGGGATGG + Intergenic
927096499 2:19751285-19751307 CACAGAAGGAAGCGGGGAAAAGG + Intergenic
927511507 2:23647002-23647024 CAGAGAAGGAGGCTAGGGAAGGG + Intronic
929774625 2:44921264-44921286 AACAGAAGGGAGCCTGGGAGGGG + Intergenic
930143793 2:47980668-47980690 CACAGAAGGATGGCAGGAAATGG + Intergenic
930421407 2:51157683-51157705 CCCAGAAGGAGGTAGGGGAAGGG - Intergenic
930900850 2:56506311-56506333 CCCTGAAGTAGGCCTGGGACTGG + Intergenic
931088851 2:58864384-58864406 CACAGATGGCTGCCTAGGAAAGG + Intergenic
931862615 2:66372127-66372149 CACAGATAGTGGCCTAGGAATGG - Intergenic
932004070 2:67910756-67910778 CACAGAAGCAGCCCTGTGAAGGG + Intergenic
932353119 2:71047728-71047750 CTCCGAAGGAGGCAAGGGAAGGG + Intergenic
932786027 2:74604588-74604610 CACAGCAGGAGGGGAGGGAAGGG - Intronic
932977781 2:76625105-76625127 CCCAGCAGGAGCCCTGGGAGGGG + Intergenic
933212553 2:79587501-79587523 AACAGAAAGAGGCCAGGAAAGGG - Intronic
933758860 2:85661165-85661187 CTGAGAGGGAGGCCTGGGACAGG + Intronic
934652127 2:96098760-96098782 CCCAGAAAGAGGCCTGGCAATGG - Intergenic
934896806 2:98126765-98126787 GAGAGAAAGAGGCCTGGGAGGGG + Intronic
934946908 2:98549035-98549057 CACAGGAGGAGGTGTGGGGATGG - Intronic
936246888 2:110836252-110836274 GCTAGAAGGAGACCTGGGAAGGG + Intronic
937314605 2:120922983-120923005 TCCAGAAAGAGGCCTGGGGAGGG - Intronic
937738914 2:125325383-125325405 CACATAAGGAGGTCAGGCAAAGG - Intergenic
937907662 2:127060285-127060307 CTGGGAAGGAGGCCTGGGGAGGG - Intronic
938107401 2:128542732-128542754 CCCAGAAGGAGTCCAGGGATGGG - Intergenic
938157796 2:128956381-128956403 CGCAGCAGCAGGCCTGGGGATGG - Intergenic
940284566 2:152020755-152020777 CAGAGGAGGAAGCCGGGGAAAGG + Intronic
940526723 2:154825178-154825200 CACAGAAGGATGACAGGAAAAGG - Intronic
940639698 2:156333295-156333317 AAGAGGAGGAGGCCTGGGACAGG - Intronic
940984197 2:160036593-160036615 CATAGAAAGAGACCTAGGAATGG - Intronic
941013989 2:160333583-160333605 CTCAGAAGGAAGGCAGGGAATGG + Intronic
942458791 2:176155598-176155620 CACAGGAGTGGGCCAGGGAAGGG + Intronic
942481330 2:176391667-176391689 CACAGACTGAGGGCTGGGAGGGG + Intergenic
942824852 2:180163314-180163336 AACAGAAGGCGGCCCAGGAATGG - Intergenic
943518470 2:188916821-188916843 TAAATAAGGAGTCCTGGGAAAGG - Intergenic
943899917 2:193420516-193420538 TACAGAAGGAAACCTTGGAAAGG - Intergenic
944892537 2:204132530-204132552 GACAGAAGGAGGCATGGAGAGGG + Intergenic
945957447 2:216099485-216099507 CACAGAACTAGGCATGAGAAGGG + Intronic
946371833 2:219285821-219285843 CCCAGAGGGAGGCCTAGGAGGGG + Exonic
946483145 2:220075695-220075717 CACAGAAGTTGGCCTGGGACAGG - Intergenic
946624308 2:221594374-221594396 AGCATCAGGAGGCCTGGGAAAGG + Intergenic
946739801 2:222790255-222790277 CACAGACGGTGGCAGGGGAATGG + Intergenic
947942070 2:234065985-234066007 CACAGTAGTTGGACTGGGAAGGG - Intronic
948051706 2:234983717-234983739 CACAGCAGGAGGCCCTGGAATGG + Intronic
948391506 2:237614704-237614726 CAGAGGAGGAGGCCTGGGTGAGG - Intergenic
948533066 2:238625710-238625732 CACAGAAATAGGACTGGTAAAGG - Intergenic
948569306 2:238907349-238907371 CACAGAGGGAGGCGCGGGATTGG + Intronic
948742201 2:240055411-240055433 CAGGGCAGGAGGCGTGGGAAGGG + Intergenic
1168799752 20:636728-636750 CACATATTGAGGGCTGGGAATGG + Intergenic
1169227335 20:3864866-3864888 CACAGAATGCAGACTGGGAAGGG - Intronic
1169912931 20:10661978-10662000 CCCAGAAGGGGCCCTGGGAAGGG + Intronic
1170046276 20:12088694-12088716 CACAGAATGAGAAGTGGGAATGG - Intergenic
1170836414 20:19888584-19888606 CACAGAGGAAGGCCAGTGAAGGG - Intronic
1171089059 20:22267123-22267145 AACACAAGGAAGCCTTGGAAGGG + Intergenic
1171195938 20:23199428-23199450 CACAGAAGGATGCTGGTGAATGG + Intergenic
1171272373 20:23826898-23826920 TAGAGGAGGAGGCCTGGGAGGGG - Intergenic
1171782534 20:29432655-29432677 AACAGGAGAAGGCCTGGGGAAGG + Intergenic
1172621282 20:36320027-36320049 CACAGAGGGAGGCCTGGGAGAGG - Intronic
1172621298 20:36320081-36320103 CACAGAGGGAGGCCTGGAGGAGG - Intronic
1172621314 20:36320135-36320157 CACAGAGGGGGGCCTGGGAGAGG - Intronic
1173221125 20:41134068-41134090 CACAGAAATAGGCCTGAGCAGGG + Intergenic
1173283155 20:41647483-41647505 AGCAGAAGGAGGACAGGGAACGG - Intergenic
1174094041 20:48073833-48073855 GACAGAAGGAGGATGGGGAAGGG - Intergenic
1174114613 20:48218356-48218378 GACAGCAGGATGCCTGGGGAAGG - Intergenic
1175133875 20:56808689-56808711 CATAGAGGGAGCTCTGGGAAGGG - Intergenic
1175307047 20:57983192-57983214 CTCAGCAGGAGCCCTGGGCAGGG - Intergenic
1175525304 20:59629537-59629559 CACAGAGAGAGTCCTGGGACGGG - Intronic
1175846492 20:62062005-62062027 CACGGAGGGAAGGCTGGGAAGGG + Intronic
1175928053 20:62480519-62480541 CCCAGAAGCAGTCCTGGGCAGGG + Intergenic
1176217406 20:63954820-63954842 CACAGACGGTGGGCTGGGCACGG - Intronic
1177666155 21:24162325-24162347 CACAGAATGAGACTTTGGAAAGG - Intergenic
1179380498 21:40894786-40894808 CACAGAAGGTGGCCAGGCCAGGG - Intergenic
1179815714 21:43904727-43904749 CACAGCAGCGGGCCTGGGAACGG - Intronic
1179973432 21:44849145-44849167 CACAGAAGGGGGCCGGGGTGGGG + Intergenic
1180967875 22:19799959-19799981 GCCAGGAGGAGGCCTGGGAGGGG - Intronic
1181098716 22:20524396-20524418 CACTGATGGAGGACAGGGAAGGG + Intronic
1181720778 22:24772941-24772963 CACCCAGGGAGGCCTGGGGAGGG - Intronic
1182396632 22:30040912-30040934 AACAGAAGCAGCCCTGGGCATGG - Intergenic
1182489924 22:30664766-30664788 CTCTGAAGAAGGCCTGGGAAAGG + Intronic
1182876247 22:33693666-33693688 TACAGAAGGTTGCCTGGGCATGG + Intronic
1183121203 22:35731530-35731552 AACAGAGGGAGGCGGGGGAATGG + Intergenic
1183301183 22:37059955-37059977 CCAAGGAGGGGGCCTGGGAAAGG - Intronic
1183344104 22:37297505-37297527 CATGGAAGCAGGCCTGGGAGGGG - Intronic
1183658801 22:39206592-39206614 CACAGACGGAAGCCTGGAAGGGG + Intergenic
1184935483 22:47717366-47717388 CACAGAAGTAGGCAAGGGCATGG - Intergenic
1185288281 22:50011938-50011960 CACAGAAGGTGTCCCGGAAAGGG - Intronic
949098174 3:111572-111594 CATAGAAGGAGGGCAGGGGAAGG + Intergenic
950473885 3:13203884-13203906 AACAGACGGAGGCTTGGGCAGGG + Intergenic
950660024 3:14461477-14461499 CACAGAGTGGGGTCTGGGAAGGG + Intronic
950670233 3:14521589-14521611 GGCAGGAGGAGGCCTGGGATGGG - Intronic
951647727 3:24912094-24912116 CACAGCAGGAGACATGGAAAAGG - Intergenic
952488353 3:33839203-33839225 AAAAGAAGAAGGACTGGGAAAGG - Intronic
953067863 3:39491107-39491129 CAAAGAAAGAGGCTTGGGATAGG + Intronic
953186866 3:40646134-40646156 CCCAGGAGGAGGCCAGAGAAGGG + Intergenic
953391381 3:42535892-42535914 TTCAGAAGGAGGCCTTGGAATGG - Intronic
953680509 3:45035210-45035232 CTGAGGTGGAGGCCTGGGAAGGG + Intronic
953950881 3:47189205-47189227 CAGATAAGGAGGGCTGGGCATGG + Intergenic
954857970 3:53663159-53663181 CACAGGAGGAGGCAGGGGAGAGG - Intronic
954872334 3:53777251-53777273 CTCAGAAGGAGGCAGGAGAATGG + Intronic
954894748 3:53965875-53965897 CTCTGAAGGACCCCTGGGAAGGG - Intergenic
955639865 3:61070671-61070693 CTCAAAAGGTGTCCTGGGAAGGG - Intronic
956324171 3:68032647-68032669 GAGAGAAGGAGGAGTGGGAAGGG - Intronic
958584517 3:96069239-96069261 CACAGAAGGAAGGCTGAGGATGG - Intergenic
959732424 3:109619157-109619179 CACAAAAGGAGGGAAGGGAAGGG - Intergenic
961427410 3:126858863-126858885 CACAGAATGAGGGCTGGGTGTGG + Intronic
961522044 3:127472635-127472657 CACAGGAGGAGGGCAGGGCAGGG - Intergenic
961552592 3:127677666-127677688 CACAGAAAAAGGCCTGGGGGAGG - Exonic
961645953 3:128392896-128392918 CACTGAAGGAGGTCTGGGGAGGG - Intronic
961772186 3:129258121-129258143 CACAGGAGGAGGCCTGGTGGAGG + Intronic
962172832 3:133120503-133120525 CATAGGAGGATGGCTGGGAAAGG - Intronic
962445052 3:135456447-135456469 CTCAGGAGGATCCCTGGGAAGGG + Intergenic
962928594 3:140017402-140017424 CAGAGAGGGAAGCCTGGAAAAGG + Intronic
963166099 3:142205398-142205420 CACAGGAGGAGGCCTGGAGTTGG - Intronic
963206244 3:142638508-142638530 CTAAAAAGGATGCCTGGGAATGG + Intronic
963536616 3:146537432-146537454 CACTGGAGTGGGCCTGGGAAGGG - Intronic
963540195 3:146577051-146577073 TACAGAATGAGGTCTGGGTATGG + Intronic
963619206 3:147583804-147583826 GACAGTAGAAGCCCTGGGAAGGG + Intergenic
964381638 3:156103620-156103642 CACTGGAGGAGGCTGGGGAAGGG - Intronic
964530649 3:157664154-157664176 CACAGGAGTAGGCCTGGAGATGG - Intronic
964804149 3:160588106-160588128 AGCAGAGGGAGGACTGGGAAGGG + Intergenic
965606008 3:170498110-170498132 CAATAAAGGAGGCCAGGGAAAGG - Intronic
968899379 4:3423793-3423815 CACAGAACGAGAACTGGGGATGG - Intronic
969373385 4:6747974-6747996 CAGAGAAAAAGGCCTAGGAAGGG + Intergenic
969377306 4:6771459-6771481 CAGAGCAGGAGTCATGGGAAAGG - Intergenic
969538517 4:7771227-7771249 CACAGAATGTGGGCTGGGCATGG + Intronic
969670644 4:8588231-8588253 CAGAGAGGGTGGCCTGGGATGGG + Intronic
970502243 4:16689982-16690004 CTCAGAAGGAGGCTTCAGAAAGG + Intronic
970518715 4:16861597-16861619 ATTAGAAGGAGGCCTGGGACTGG - Intronic
970737688 4:19193882-19193904 CAGAGAAGGAGGCATCTGAATGG - Intergenic
971197971 4:24487310-24487332 CACAGAACGAGGACAGGGATAGG + Intergenic
973786237 4:54335290-54335312 CAAAGAAGCAGGCCGAGGAATGG - Intergenic
974064947 4:57069097-57069119 CCTAGAAGGAGGCCTGGGAGGGG - Intronic
975163689 4:71152761-71152783 CAAAGAAAGTGGGCTGGGAAAGG - Intergenic
975464501 4:74694150-74694172 CACAGGAATAGTCCTGGGAAGGG - Intergenic
975712313 4:77173108-77173130 CACAGAAGGCTGCCTGCCAAGGG - Intronic
977536508 4:98261194-98261216 CACAGAGGGAGGGGTGGAAAAGG + Intergenic
977649832 4:99456667-99456689 GAAAGAAGGAGGCATGTGAATGG - Intergenic
981726674 4:147855004-147855026 CACAGAAAGGGGCCGAGGAAGGG - Intronic
982763728 4:159319220-159319242 CACAGCAGGAGGCGAGTGAAAGG + Intronic
984705560 4:182844927-182844949 CACATAAGGTGGCCTCTGAATGG - Intergenic
985448591 4:190043168-190043190 AACAGGAGAAGGCCTGGGGAAGG + Intergenic
985854704 5:2415904-2415926 GACAGCAGGATGCCCGGGAAAGG - Intergenic
986103427 5:4635599-4635621 AACAGAAGGTGGTCTGGAAATGG + Intergenic
986625872 5:9723534-9723556 AATGGAAGGAGCCCTGGGAAGGG - Intergenic
986992260 5:13568193-13568215 CACAGAAGGGAGCTTGGAAATGG + Intergenic
987072596 5:14352100-14352122 CACAGAAGGATGACTAGGAAGGG - Intronic
988623466 5:32847001-32847023 CAGAGGAAGAGGCCTGGGCATGG + Intergenic
988993201 5:36690870-36690892 CTCAGAAGGTGGCATGGTAACGG + Intergenic
989465380 5:41748597-41748619 CACATAAGTAGTCCTGGGGAAGG + Intronic
990378287 5:55195350-55195372 TACAGAAATAGGCCAGGGAATGG + Intergenic
990507159 5:56456102-56456124 CACAGATGGTGCCCTGGGCAGGG - Intergenic
991578494 5:68129749-68129771 CACAGAAGTAGGGGTGTGAACGG - Intergenic
992458281 5:76936847-76936869 GAAAGAAGGAGCACTGGGAAAGG + Intergenic
992913737 5:81425917-81425939 CACAGAAGGAGGCCTGGGAAGGG - Intronic
993367482 5:87051045-87051067 CACCGATGGAGGCCTGCCAAAGG + Intergenic
993661404 5:90640806-90640828 CACAGAAAGAAGTGTGGGAAGGG - Intronic
994388613 5:99162855-99162877 CACAGAAGGAAGCTTGGCACTGG - Intergenic
995197663 5:109391320-109391342 GACAGATGGAGGCATGGAAATGG - Intronic
995728129 5:115203673-115203695 GATAGAAAGAGGCCTGGGACCGG + Intergenic
997818243 5:137038363-137038385 CCCAGAACCAGGCCTGGGAAGGG + Intronic
998395122 5:141813273-141813295 AAAAGAAGGAGGGCTGGGCATGG - Intergenic
999086212 5:148892600-148892622 CACTCAAGGAGGCCAGAGAAAGG + Intergenic
999254822 5:150204482-150204504 CAGAGAACGAGGCCCAGGAAGGG + Intronic
999255172 5:150205995-150206017 CACAGCAGGACTCCTGGGCACGG - Intronic
999466944 5:151816289-151816311 CTCAGCAGAAGGCCTGGGATGGG + Intergenic
999470447 5:151850208-151850230 CATACAAGCAGGCCTGGTAATGG - Intronic
999947977 5:156618089-156618111 CGCAGAAGGAAGCATGAGAATGG + Intronic
1000163785 5:158627236-158627258 GACAGAAGGAGACCAGTGAATGG - Intergenic
1000334546 5:160232299-160232321 GTCAGATGGAGGCCTGGGGAAGG - Intronic
1000987193 5:167874085-167874107 CAAATAAGGATTCCTGGGAAAGG - Intronic
1001164315 5:169349666-169349688 CACAGATGGAGGCGAGGGTAGGG - Intergenic
1003850560 6:10218155-10218177 CACAGAGGGTGGGCTGGGGAGGG + Intergenic
1006945701 6:37783322-37783344 CCCGGGAGGAGGCCTGGGGATGG + Intergenic
1007176703 6:39902228-39902250 CACAGAAGGAATCATGTGAAGGG - Exonic
1008020529 6:46572759-46572781 CTCAGAAGGAGGATTGAGAAAGG - Intronic
1009303328 6:62055291-62055313 CATTGAAGGAGGAATGGGAATGG + Intronic
1009532149 6:64831074-64831096 AAGAGAAGTAGGACTGGGAAAGG - Intronic
1009994545 6:70883959-70883981 CACAGGGGGTGGCCTGGGAAAGG + Intronic
1011771483 6:90678277-90678299 CAGAGAGGAAGGCCTGGCAAGGG + Intergenic
1012846412 6:104395163-104395185 CAGAGAAGGTAGCCTGGAAAAGG + Intergenic
1014096397 6:117466855-117466877 CACAGTGGGAGGCCAGGGGATGG + Intronic
1014931706 6:127343670-127343692 CACAAAGGTAGGGCTGGGAAAGG + Intergenic
1016886532 6:148964641-148964663 CCAAGGAGAAGGCCTGGGAAGGG - Intronic
1017500249 6:155017341-155017363 CTCAGAAGGACCCCTGTGAAAGG + Intronic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1018712438 6:166506509-166506531 CACAGCAGGAGGCAAAGGAAGGG + Intronic
1018726719 6:166618406-166618428 CAAAGCAGGAGGCCTGGGTGTGG + Intronic
1018765877 6:166932378-166932400 CAGAGCAGGAGGGTTGGGAAGGG - Intronic
1018791744 6:167154070-167154092 CACAGAACCTGGCATGGGAAGGG - Intronic
1019178781 6:170174851-170174873 CCCAGGAGGAGGCCTGGGACAGG - Intergenic
1019621472 7:1994502-1994524 CCCAGTAGGAGGACTGGGCAGGG + Intronic
1019713527 7:2528221-2528243 CACAGGAGGAGGGCAGGGATGGG - Exonic
1019895330 7:3977905-3977927 AACAGAAGGAGGCCCGCCAATGG - Intronic
1020692540 7:11373990-11374012 TACAGATGTAGCCCTGGGAATGG - Exonic
1020846718 7:13294403-13294425 CAGAACAGGAGGCCTGGGGAAGG + Intergenic
1021157596 7:17230885-17230907 CATAGAAGTTGGCCTGGAAATGG + Intergenic
1022017857 7:26367582-26367604 CACAGAAGGGAGGCTGGGGAGGG - Intronic
1022175351 7:27867179-27867201 CTCAAAAGGAGGGCTGGGAAAGG + Intronic
1023254797 7:38302295-38302317 CACAGGATGTGTCCTGGGAATGG + Intergenic
1026436774 7:70406168-70406190 GGCAGAGGGAGGCCTGGCAAGGG - Intronic
1028103382 7:86848612-86848634 CACAGAAAGAGGCTTGGGGTAGG - Intronic
1029253545 7:99253541-99253563 CACGGGGGGAGTCCTGGGAACGG - Intergenic
1029657568 7:101937056-101937078 CACAGAGGGAGGCCATGGGAGGG - Intronic
1029662873 7:101974879-101974901 GGCAGAGGGAGGTCTGGGAATGG + Intronic
1030158747 7:106485407-106485429 CACAGCTGGAGGCCTGGCAGTGG - Intergenic
1030279051 7:107751318-107751340 CACAGCAGGAGGTGAGGGAAGGG - Intronic
1030345945 7:108433120-108433142 CACAGAAGCAGGACTGGGATGGG - Intronic
1032707303 7:134432579-134432601 CACAGCAGGAGGCGTGCGATGGG - Intergenic
1032915396 7:136483720-136483742 CACAAAAGGAGGAGTGGGACAGG + Intergenic
1034192240 7:149221644-149221666 CAGTGCAGGATGCCTGGGAAGGG - Intronic
1034892677 7:154854847-154854869 GACAGAGGGAGGGCTGGAAAGGG - Intronic
1035021198 7:155801491-155801513 CAGAGGAGGTGGCCTGGGGATGG - Exonic
1035025275 7:155820848-155820870 CACAGTAGGAGGCCTGCACAGGG + Intergenic
1035240575 7:157526689-157526711 CTCTGAAGGAAGGCTGGGAATGG - Intergenic
1035287037 7:157813271-157813293 CACAGCAGGAGGACCGGGCAGGG - Intronic
1035650934 8:1264264-1264286 CCCAGAAAGGGGCCTGGGATGGG + Intergenic
1036117430 8:5973053-5973075 AAGAGAAGGAGGCCTTTGAATGG - Intergenic
1036548913 8:9799729-9799751 CCCACAAGGAGGCCAGGGCAGGG + Intergenic
1036587810 8:10141212-10141234 CACAGAACCAGGCCTGGCACAGG - Intronic
1037373708 8:18206277-18206299 CACAGAAGGTGGACTGAGAGGGG - Intronic
1037829357 8:22178817-22178839 CAAAGCACCAGGCCTGGGAATGG - Intronic
1038652999 8:29422474-29422496 CACAACAGGAGGCTTGGGAATGG + Intergenic
1039385837 8:37134750-37134772 CCCAGAAGGAGGCACAGGAATGG + Intergenic
1039399594 8:37258049-37258071 TACAGAAGGACGACAGGGAAGGG + Intergenic
1039469935 8:37807118-37807140 AATAGAAGGAGGCCTAGGGAGGG - Intronic
1039716458 8:40114688-40114710 CACTTTAGGAGGCCTGGGACGGG - Intergenic
1040081077 8:43286453-43286475 CACAAAAAGAGGCCAGAGAAAGG - Intergenic
1041726199 8:61019875-61019897 CACAGAAGCAAGGCTTGGAAAGG - Intergenic
1042448680 8:68919959-68919981 CACAGAAAGCGGCCTGGCATGGG + Intergenic
1042506104 8:69562643-69562665 CACAGAAGGAGGCTTTTGAAAGG - Intronic
1043503904 8:80884235-80884257 GAAAGAAGGAGGGCTGGGGAAGG + Intergenic
1044198934 8:89412378-89412400 CATAGATGGAGGCATGGGCAGGG + Intergenic
1044306821 8:90647838-90647860 TACAGAAAGTAGCCTGGGAAAGG - Intronic
1044838419 8:96317253-96317275 CCCAGACTGAGGCCTGGGCATGG - Intronic
1045986635 8:108256826-108256848 CACAGAGGGAAGCATGGCAAAGG - Intronic
1046243172 8:111526126-111526148 CACAGAAGATGGCCTGGCACTGG + Intergenic
1047338114 8:123955287-123955309 GAGAGAAGGAGGCTTGGAAATGG + Intronic
1047411565 8:124628529-124628551 CACAGCAGGTGCTCTGGGAAGGG + Intronic
1047459149 8:125045625-125045647 ACCAGAAGGAGGCGTGAGAAGGG + Intronic
1047521905 8:125601443-125601465 CACAGACACAGGCCTGGGGAGGG + Intergenic
1048381773 8:133871711-133871733 CTCTGAAGGAGGCCAGGGAGGGG + Intergenic
1048500251 8:134968852-134968874 CTGAGAGGAAGGCCTGGGAAAGG - Intergenic
1049253461 8:141601645-141601667 CTCAGAAGGAGGGTAGGGAAAGG - Intergenic
1049276254 8:141721500-141721522 CACAGTAGGGGCCCTGGGAATGG + Intergenic
1049283224 8:141761111-141761133 CACAGCAGGTGGCCTGGGCTGGG + Intergenic
1049358853 8:142202318-142202340 CAGAGCTGGAGGCCTGGGCATGG - Intergenic
1049454908 8:142681844-142681866 GACAGGAGGAGGCCTGGGGCAGG + Intronic
1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG + Intergenic
1049657872 8:143806714-143806736 GAGAGAAGGAGGGCTGTGAAGGG + Intronic
1049818919 8:144622367-144622389 CACAGAAGGAAGCCTGTGGCGGG - Intergenic
1050353325 9:4760890-4760912 CACAAAAGGGAGCCTGGGCACGG - Intergenic
1052049355 9:23827221-23827243 CACAGAAAGAGCCCTGATAAAGG - Intergenic
1052409274 9:28102150-28102172 CTTAGAAGCAGCCCTGGGAAAGG + Intronic
1052788806 9:32854977-32854999 CAGAAAAGGAGGCATGGGAGGGG + Intergenic
1052988843 9:34506811-34506833 TGCAGAAGGAGGGCTGGGAGTGG - Exonic
1053150337 9:35739122-35739144 CACAGAAGGGAGGCAGGGAATGG + Intronic
1054311341 9:63480557-63480579 CACAGCTGGAGACCTGAGAATGG - Intergenic
1054857535 9:69916733-69916755 CACTGAAGGAAAACTGGGAATGG + Intergenic
1056198250 9:84249577-84249599 CATACAAGGAGGCCTGGGGAAGG + Intergenic
1056493277 9:87129267-87129289 CAAAGCAGCAGGTCTGGGAAGGG - Intergenic
1057270041 9:93645485-93645507 CACAGGAGGAGGCCTGGCCGTGG - Intronic
1057492518 9:95532298-95532320 CACTGAAGGAGGCAAGGAAATGG + Intergenic
1058454882 9:105129737-105129759 AACAGAAGAACCCCTGGGAAGGG - Intergenic
1060416680 9:123435627-123435649 CAAAGAAGGGGGCCCTGGAAGGG + Intronic
1060726415 9:126008806-126008828 CATGGAAGGGGGCCTGGGCAGGG + Intergenic
1061584516 9:131557246-131557268 GACAGAAGCAGGGCTGGGCATGG + Intergenic
1061631872 9:131877185-131877207 CACAGATGAAGGCCTGGAAGAGG - Intronic
1061926050 9:133806546-133806568 GACAGAAAGAGGCCTGGGGCGGG - Intronic
1062337488 9:136078654-136078676 GACAGAAAGGGGCGTGGGAATGG + Intronic
1062350384 9:136135835-136135857 CACAGCAGGCGGGCTGGGCAGGG - Intergenic
1186862381 X:13685868-13685890 GACAGAAGGAAGCATGGCAATGG + Intergenic
1188053370 X:25513597-25513619 CTGAGAAGGAGACCTGGGTATGG + Intergenic
1190233211 X:48597978-48598000 CAGAGGAGGAGGCCGGGGAATGG + Exonic
1190287645 X:48971594-48971616 CCTGGAAGGAGGCCTGGGAAGGG + Intergenic
1195261074 X:103132047-103132069 CACAGATGGAGATCTGAGAATGG + Intergenic
1199081553 X:143582362-143582384 CACAGAATGAGGTCAGGGAAGGG + Intergenic
1200042417 X:153379758-153379780 CACAGTGGGAGGCCTGGGGGAGG + Intergenic
1200884311 Y:8253085-8253107 CTCAGAGGGAGAGCTGGGAAGGG + Intergenic
1201596984 Y:15681107-15681129 CAGTGGAGGAAGCCTGGGAAGGG + Intergenic