ID: 992913819

View in Genome Browser
Species Human (GRCh38)
Location 5:81426749-81426771
Sequence CTGTCTTAACAGTTGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992913819_992913825 13 Left 992913819 5:81426749-81426771 CCCTCTTCCAACTGTTAAGACAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 992913825 5:81426785-81426807 CAAATCTGGGAAGGAAGTAGAGG No data
992913819_992913824 4 Left 992913819 5:81426749-81426771 CCCTCTTCCAACTGTTAAGACAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 992913824 5:81426776-81426798 CACTAATGACAAATCTGGGAAGG No data
992913819_992913823 0 Left 992913819 5:81426749-81426771 CCCTCTTCCAACTGTTAAGACAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 992913823 5:81426772-81426794 CAGTCACTAATGACAAATCTGGG 0: 1
1: 0
2: 2
3: 14
4: 156
992913819_992913826 14 Left 992913819 5:81426749-81426771 CCCTCTTCCAACTGTTAAGACAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 992913826 5:81426786-81426808 AAATCTGGGAAGGAAGTAGAGGG 0: 1
1: 1
2: 5
3: 39
4: 564
992913819_992913822 -1 Left 992913819 5:81426749-81426771 CCCTCTTCCAACTGTTAAGACAG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 992913822 5:81426771-81426793 GCAGTCACTAATGACAAATCTGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992913819 Original CRISPR CTGTCTTAACAGTTGGAAGA GGG (reversed) Intronic
901028092 1:6289877-6289899 CTGTCTTAGCAGGTGGAAGGGGG - Intronic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
905303931 1:37004826-37004848 CGGTCTCAAGAGTGGGAAGAGGG - Intronic
905447912 1:38039248-38039270 CTGTCTTCCCACTTGGAAGGAGG - Intergenic
909907565 1:81217793-81217815 CTGTCTTCTCAGTTGTAAAATGG - Intergenic
912050414 1:105522679-105522701 GTGTGTTTCCAGTTGGAAGAAGG - Intergenic
916308248 1:163364116-163364138 TTTTATTAAAAGTTGGAAGAAGG - Intergenic
917961115 1:180145481-180145503 CTGTCTTAACAGTGCTAACATGG - Intergenic
919534508 1:198770210-198770232 CTGTCTTAAAACTTGGTAGGTGG - Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
922291313 1:224211064-224211086 CTTTCTTTCCAGTGGGAAGAGGG - Intergenic
923134488 1:231105984-231106006 TTCTCTTAACATTTGGAATAAGG + Intergenic
1064162333 10:12957252-12957274 GTGTCTTAAAAGGAGGAAGAGGG - Intronic
1067196698 10:44126020-44126042 CTTTCTTAATAGATGGAGGAGGG + Intergenic
1068050040 10:51938634-51938656 GTGTCTTCTCAGTGGGAAGAGGG - Intronic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068905274 10:62315264-62315286 CTTTCATAACAGTTGCAATATGG + Intergenic
1071180964 10:82983054-82983076 GGGTCTAAACAGTTGGAAAAAGG - Intronic
1072914088 10:99526614-99526636 AGGTCTTACCAGTTGGAACAGGG + Intergenic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1075898266 10:126017246-126017268 CTGTCTTCACTGTTGAAAAAAGG + Exonic
1077943612 11:6870888-6870910 CTGTCATACCAGTTGAAACAAGG - Intergenic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1082279950 11:50260951-50260973 CTGTGTTAAAAGTTAGAAGCGGG + Intergenic
1082771427 11:57210796-57210818 CTGTCTGCACCGTTGGAGGATGG - Intergenic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1087326571 11:96730405-96730427 CTGCAATAACATTTGGAAGAGGG + Intergenic
1093941424 12:25059245-25059267 CTGTCTTAACTGTATTAAGAAGG - Intronic
1095326265 12:40897007-40897029 CTGACTTAGAAGTTGGAAGATGG + Intronic
1095640046 12:44477076-44477098 CTGTCTTATCAGCAGGAAAATGG + Intergenic
1096008979 12:48197128-48197150 TACTGTTAACAGTTGGAAGAGGG + Intergenic
1099862944 12:88242493-88242515 CTCTCTTTACAGTGGAAAGATGG - Intergenic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1100137593 12:91572575-91572597 ATATCTCAACACTTGGAAGAAGG - Intergenic
1100167544 12:91934054-91934076 CTGTTGTAAGAGTTAGAAGAAGG - Intergenic
1106017388 13:25882685-25882707 CTCACTTAACCATTGGAAGATGG + Intronic
1110372418 13:74754824-74754846 CTGTCTTATCAGATAGGAGAGGG + Intergenic
1114399416 14:22395786-22395808 CTGTCTTCAGATTTGGAACAAGG + Intergenic
1114442426 14:22760547-22760569 CTTTCTTAACATTTGGAAGGTGG - Intergenic
1115323451 14:32110817-32110839 TTTGCTTAACAGTTGGAAGTAGG + Intronic
1116273315 14:42799931-42799953 CTGTCCCATCAGTTGGAACACGG - Intergenic
1117784501 14:59268514-59268536 TTGTCTTATCAGTTGGTAGGGGG - Intronic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1118193315 14:63600933-63600955 CTGTCTTCAAAAGTGGAAGAGGG + Intronic
1118581172 14:67299775-67299797 CTGACTTAAAAGTGGGAATAGGG + Intronic
1119989765 14:79182702-79182724 TTGTCTTAACACTTAGAAAAGGG - Intronic
1120528493 14:85605159-85605181 CTTTCTTGACAATAGGAAGAGGG - Intronic
1121478681 14:94239756-94239778 CTGTCTTAATAGCTGGTATAAGG - Intronic
1122070975 14:99205132-99205154 CTTTCACAACAGTAGGAAGAGGG + Intronic
1124111161 15:26789946-26789968 CCGTCTTAACAGCTGGAGGAAGG - Intronic
1125491243 15:40150141-40150163 CTATCTTCAAAGTAGGAAGAAGG + Intergenic
1126682403 15:51215229-51215251 GTTTCTGAACAATTGGAAGATGG + Exonic
1127540222 15:59930084-59930106 CTATCCTTACAGTGGGAAGAGGG + Intergenic
1127836721 15:62796454-62796476 CTGTGTTTACAGTTGGCAAAGGG - Intronic
1130071864 15:80654249-80654271 CTGTTTTAACATCTGTAAGATGG + Intergenic
1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG + Intergenic
1131245482 15:90788271-90788293 CTGTCTTCAGAATTGGAAGAAGG + Intronic
1133595888 16:7291451-7291473 CAGCCTTAATAGTTGGGAGATGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1135235710 16:20753826-20753848 CTTTCTTAAGAGTTGTAATAGGG - Intronic
1135283942 16:21177150-21177172 CTGCCTTAACAGTTGTCAGCCGG + Intronic
1135793545 16:25420731-25420753 TGGTCTTAAGACTTGGAAGATGG + Intergenic
1136057103 16:27698627-27698649 CTGTCTGAACAGTGGAAACACGG - Intronic
1137637134 16:49996345-49996367 CTGCCTGAGCAGGTGGAAGAGGG - Intergenic
1138813857 16:60181913-60181935 CTGTTGTTACAGTTAGAAGAAGG + Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141584240 16:85022516-85022538 CTGTCTTAATAATAAGAAGAAGG + Intergenic
1147695658 17:42350662-42350684 CCGTCTTCACAGTAGCAAGAGGG - Intronic
1148909772 17:50935198-50935220 CTGTTTTCACAGTGGGAAGCAGG - Intergenic
1150901652 17:69284688-69284710 CTGTCTTAACAGAAGACAGATGG + Intronic
1153014943 18:575129-575151 GAGACTTAACAGCTGGAAGAGGG - Intergenic
1155162682 18:23208450-23208472 CTTTATTAAAAGCTGGAAGAAGG - Intronic
1155344795 18:24847651-24847673 CTGGCTTTGGAGTTGGAAGAAGG + Intergenic
1155399376 18:25420982-25421004 CTGTCTTAATAGTGGGAATCTGG - Intergenic
1159669422 18:71204565-71204587 CTGCCTTAACAGTTTTAAAAAGG + Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1164019209 19:21282761-21282783 CTGGCTTAATAGTTGGAATTGGG - Intronic
1166171197 19:41028535-41028557 TTGTGTTATCAGTTGGCAGAGGG + Intergenic
927047823 2:19297761-19297783 CTGGCTTAACAGTGGGATGCTGG + Intergenic
927304958 2:21560293-21560315 CTTTGTAAACAGTTGGAAGTTGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
928962109 2:36937843-36937865 CTCTCTTAACAGTTAGCAGGAGG + Intronic
930935531 2:56946325-56946347 CTGTATTAACAGTTTAGAGAAGG + Intergenic
930945706 2:57072332-57072354 CTGTCTTAACATTGAGGAGAAGG - Intergenic
931116263 2:59170049-59170071 CTTTCTTACCAATTGGAGGAAGG + Intergenic
933229991 2:79796159-79796181 CTGTCCTAACAGTGTTAAGACGG - Intronic
935173196 2:100626673-100626695 CTCTCTTCTCAGTTGTAAGAGGG - Intergenic
936411672 2:112263795-112263817 CTGTCTTCACAGCTGCAACAAGG + Intergenic
940165309 2:150764307-150764329 CTGGCTTCCCAGTTGGAAGGTGG - Intergenic
941165101 2:162075455-162075477 CTTCCTCAGCAGTTGGAAGAGGG - Intergenic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
942299180 2:174545983-174546005 CTGGCTGAGCAGGTGGAAGAAGG + Intergenic
943804220 2:192102474-192102496 CTGTCTTAAGAATTGCAAGAAGG - Intronic
943922351 2:193725226-193725248 CTGGCTTTGAAGTTGGAAGAAGG - Intergenic
1169093324 20:2874228-2874250 CAGCCTCAACAGTTGGGAGAGGG - Intronic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1170998094 20:21384950-21384972 CTGTCATAAAAGTCAGAAGAAGG + Intronic
1175406889 20:58740795-58740817 CACTCTTAAAAGTTGGAGGAGGG + Intergenic
1177283165 21:19011641-19011663 CAGTGTTAACATTTGGAAGAGGG - Intergenic
1181550565 22:23636884-23636906 CTGGCTTTGAAGTTGGAAGAAGG + Intergenic
1182621772 22:31622373-31622395 CTGTCTTAACAGGAAGAAGGAGG + Intronic
1184075890 22:42177615-42177637 GTGTGTTAACTGTTGAAAGAAGG - Intronic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
949214635 3:1551303-1551325 GCCTCTTAAGAGTTGGAAGAAGG + Intergenic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
952094037 3:29926745-29926767 TTGCCTTATCATTTGGAAGAAGG + Intronic
952760460 3:36908997-36909019 CTCTCTTAGCAGATGGAACAGGG + Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
959473623 3:106783425-106783447 CTGTCTTAACAGATTGAATTTGG - Intergenic
959702898 3:109315050-109315072 CTGTCTCAACAAGTGAAAGAAGG + Intronic
960105104 3:113787138-113787160 CTGGGATAACATTTGGAAGAGGG + Intronic
960242824 3:115365749-115365771 CTGTTTCAACAGTAGGAAAAAGG + Intergenic
960790964 3:121430434-121430456 CTGGCTTTAAAGTTGGAAGAAGG - Intergenic
961438798 3:126938361-126938383 CTGTCTTCTCAGCTGTAAGATGG + Intronic
964668442 3:159199335-159199357 TTGTCTTTAAAGTTGGAGGAAGG + Intronic
964988963 3:162782391-162782413 CTTTGTTAACAATTGGAAGAAGG + Intergenic
965717081 3:171616642-171616664 CTGACTTTAAAGGTGGAAGAAGG + Intronic
966526460 3:180924568-180924590 ATGTCTGAATAGTTGGAAGTTGG + Intronic
967949049 3:194826168-194826190 CTGTCTTTGCACTTGCAAGAGGG + Intergenic
969948389 4:10807886-10807908 CTGTCTTGACAGTTGTAAGATGG + Intergenic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
972043237 4:34630682-34630704 CTGTATTTGAAGTTGGAAGAAGG - Intergenic
973121641 4:46527889-46527911 CTGTCTTTGAAGTTAGAAGAAGG + Intergenic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
975208525 4:71671937-71671959 TTGTCTTAACTGTGGGATGAGGG - Intergenic
975580428 4:75902308-75902330 CTGTCTTCAGAGTTGGCTGAGGG + Exonic
976442653 4:85093412-85093434 CTTTCTTGAGAGTTGGAGGAGGG - Intergenic
977121361 4:93105790-93105812 CAGTCTTTAAAATTGGAAGAGGG - Intronic
977664758 4:99633112-99633134 CTGATTTAACAGGTGTAAGATGG + Intergenic
980062534 4:128147315-128147337 CTGTCTTAGCAGTGAGAAAAAGG - Intronic
981408505 4:144399805-144399827 CTAGCTTAAGAGTTGGAACATGG - Intergenic
981928838 4:150168413-150168435 AAGTCTTTACACTTGGAAGAGGG - Intronic
982042109 4:151407485-151407507 CTGCTCTAACAGTTGGAAGGTGG - Intergenic
982987489 4:162229778-162229800 CAGTCTCAAGAATTGGAAGAAGG - Intergenic
985024153 4:185722907-185722929 ATGTCATCACAGTGGGAAGAAGG + Intronic
987155016 5:15080353-15080375 CAGTCTTAAAAGTTGAAAGCAGG - Intergenic
987414346 5:17647548-17647570 CTTTCTTAAGTCTTGGAAGATGG - Intergenic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
994949204 5:106435313-106435335 CTGTCTTTACAGAAAGAAGAAGG - Intergenic
995422593 5:111983761-111983783 CAGTCTTAACAGTTGGCATTAGG - Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
1001268220 5:170290615-170290637 CTGTCCTAACAGTTGTCAGTTGG - Intronic
1002682151 5:180974865-180974887 CTATCCTAACAGTTGTGAGATGG - Intergenic
1004537802 6:16519728-16519750 CTGTCTTAGCAATTGAAAGGAGG - Intronic
1004561174 6:16752480-16752502 CTGTCTTCACAGTTTCAAGCAGG + Intronic
1005741439 6:28794492-28794514 CTGTGTTAAAAGTTAGAAGCGGG + Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010680570 6:78794207-78794229 CAGTCTTAACTGGTGTAAGATGG + Intergenic
1010733903 6:79420387-79420409 CTCACTTAACAGTTGGAGGCAGG - Intergenic
1011091389 6:83605438-83605460 TTATTTTAACAGTTGGAACAAGG - Intronic
1012532676 6:100257019-100257041 ATGTCTGAACTATTGGAAGATGG + Intergenic
1013563869 6:111335600-111335622 CTTTTTTAACAGATGGAAAATGG - Exonic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1014252352 6:119127734-119127756 ATGTCATAACAGTTGGGAGTGGG + Intronic
1015196792 6:130532380-130532402 CTGTCCTATCACTAGGAAGAAGG + Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018381220 6:163259965-163259987 CTGGTTTCAGAGTTGGAAGAGGG + Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1021055952 7:16046436-16046458 CAGTTTTAAAAGTTTGAAGATGG + Intergenic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1021280400 7:18709860-18709882 CTGGCTTAAGTCTTGGAAGAGGG - Intronic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021416166 7:20387618-20387640 CTGTCATAACTGTGGAAAGAGGG + Intronic
1021612408 7:22471078-22471100 CTGACTTAGAAGTTTGAAGAAGG - Intronic
1021992269 7:26150826-26150848 CTGTGTTAAGCCTTGGAAGATGG - Intergenic
1022976543 7:35562939-35562961 TTTCCTTCACAGTTGGAAGATGG - Intergenic
1024457214 7:49622398-49622420 ATGACTTAAGAGCTGGAAGATGG - Intergenic
1024705373 7:51952976-51952998 CTGTCTAATGAGTTAGAAGATGG + Intergenic
1024852771 7:53740914-53740936 CTGTTTTAACAGGTGCAAGCTGG - Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1026394836 7:69940888-69940910 CTATGTTAACAGTCAGAAGAAGG + Intronic
1026827170 7:73591668-73591690 CTACCTTCAGAGTTGGAAGAAGG - Intergenic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1029194192 7:98793020-98793042 ATGTTGTATCAGTTGGAAGATGG + Intergenic
1029194198 7:98793102-98793124 ATGTTGTATCAGTTGGAAGATGG + Intergenic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032567799 7:132965874-132965896 TTGTCATAAAAGATGGAAGAAGG + Intronic
1034175078 7:149093360-149093382 CTGTCTTAACAAAAGGAAGCAGG + Intergenic
1034476109 7:151283277-151283299 CCATATTAACAGATGGAAGAAGG + Intergenic
1037067321 8:14598131-14598153 ATTTCTTTACACTTGGAAGAAGG + Intronic
1037725529 8:21479903-21479925 TTGTCTTAACAGCTGGAACCAGG + Intergenic
1038363889 8:26911144-26911166 CTCTCTTAATAGTTGAAAAATGG + Intergenic
1039612158 8:38928568-38928590 CTGTCACCAGAGTTGGAAGACGG + Intronic
1041065489 8:54078786-54078808 TTGTCTTAGCAGATGGTAGAAGG - Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1042063627 8:64848784-64848806 CCTTATTAACATTTGGAAGACGG - Intergenic
1043888894 8:85634251-85634273 CTGTCTTAACAGATAAAACAAGG + Intergenic
1045695708 8:104806648-104806670 CTGTATTATCAGTTACAAGAAGG + Intronic
1045974742 8:108119451-108119473 CAATCTTGAGAGTTGGAAGAAGG + Intergenic
1046160705 8:110360298-110360320 CTGTCATAACAATTGAAAAAGGG - Intergenic
1046842206 8:118872001-118872023 CTGTCTTTACATGTGGATGATGG + Intergenic
1047712938 8:127570011-127570033 CTGTCTCCACACTTGGAGGAGGG + Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1047979393 8:130164606-130164628 CTGTTTTTAGAGTTGGAAGTAGG - Intronic
1050108329 9:2188941-2188963 CTGGCTTTAAAGTTGGAACAAGG - Intronic
1053211391 9:36231599-36231621 CTGTTTTAGCCTTTGGAAGAAGG - Intronic
1055075288 9:72208426-72208448 CTGTCTGAGCACTTGGAAAAAGG - Intronic
1057690610 9:97280807-97280829 CTGGACTAAGAGTTGGAAGAGGG + Intergenic
1059130569 9:111744179-111744201 CTGTCATAACAGATGGATTAGGG + Intronic
1061254295 9:129445106-129445128 CTGTCTTAAAAGTTAAAAAAGGG - Intergenic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1197551851 X:127901363-127901385 CTGTCTTCACAGGTGGCAGATGG + Intergenic
1198863636 X:141096972-141096994 ATCTGTTAACAGTTAGAAGAGGG - Intergenic
1198899051 X:141490405-141490427 ATCTGTTAACAGTTAGAAGAGGG + Intergenic
1200947171 Y:8855179-8855201 CTGACTTAACAGCTGGCAGATGG + Intergenic
1200980127 Y:9256055-9256077 ATTTGTTAACAGTTAGAAGAGGG - Intergenic
1202020871 Y:20463392-20463414 CTGTTTTAGCAGTTCCAAGATGG - Intergenic
1202131198 Y:21612618-21612640 ATTTGTTAACAGTTAGAAGATGG + Intergenic