ID: 992918400

View in Genome Browser
Species Human (GRCh38)
Location 5:81483991-81484013
Sequence CACTGCCCAATAGAACTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 2, 2: 8, 3: 28, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992918400 Original CRISPR CACTGCCCAATAGAACTTTC TGG (reversed) Intronic
900736409 1:4302046-4302068 TGCTGCCCCATAGAACTTTCCGG - Intergenic
900907723 1:5572478-5572500 CACTGCCCAAGACAACTTCCTGG - Intergenic
901296661 1:8166110-8166132 CTCTGCCCATGAGAACCTTCTGG + Intergenic
904812048 1:33169831-33169853 TACTGTCCACTAGAACTCTCTGG - Intronic
905008666 1:34731666-34731688 CACTGTCCAAGGGAAGTTTCTGG - Intronic
906932685 1:50185085-50185107 CACTGTCCCACAGAATTTTCTGG - Intronic
907727979 1:57037881-57037903 CCCTGTCCAATAGAACTTCTTGG + Intronic
910001037 1:82342583-82342605 AACTGCCCAATAAATCTTTTTGG + Intergenic
910804360 1:91175687-91175709 CACTGAGCAATAGAACTAACTGG - Intergenic
912966062 1:114238657-114238679 CTTTGTCCAATAGAACTTTCTGG + Intergenic
916619082 1:166476177-166476199 CACTGGCCAATGGAACATTGTGG + Intergenic
916915147 1:169398752-169398774 CACTGTCCAATAGAACTTTCTGG - Intronic
917018619 1:170562235-170562257 CACTGCCTGAAAGAACTTGCTGG - Intergenic
918409888 1:184247544-184247566 CACTGCCCAATCAAAATTACAGG - Intergenic
918419055 1:184343465-184343487 CACTGCCGCATAGTACTGTCTGG + Intergenic
918672209 1:187232601-187232623 CACTGGCCAGTAGAACTTTGAGG + Intergenic
919130305 1:193442355-193442377 CAATGCCCAGCAGAACTTTGGGG + Intergenic
919941851 1:202292707-202292729 CACTGCCCAGTAGAACTTTCTGG + Intronic
921620372 1:217319675-217319697 CACTGCAGACTAGATCTTTCTGG + Intergenic
922311778 1:224400474-224400496 CGCTGTCCAATAGAATTTTCTGG - Intronic
923349163 1:233086813-233086835 CACTGTCCAATAGGAAGTTCTGG - Intronic
1062941452 10:1424508-1424530 CACTCAGCAATAGAACTGTCCGG - Intronic
1063394776 10:5676795-5676817 CACTGCCCAATAAGCCTTTGGGG - Intergenic
1065593338 10:27287876-27287898 CACTGCCCAGTTGAACTTACTGG + Intergenic
1065657037 10:27962411-27962433 CACTGCCCAGTTGAACTTACTGG - Intronic
1069310849 10:67034366-67034388 CAATGCCCAATAAAATGTTCTGG + Intronic
1070442455 10:76460171-76460193 CGCTGCACAGTAGAACTGTCAGG + Intronic
1072564368 10:96605258-96605280 CATCATCCAATAGAACTTTCAGG + Intronic
1075221420 10:120588289-120588311 CCCTGCCAAAGAGAACATTCAGG - Intronic
1075993207 10:126855611-126855633 CACTGTGCGACAGAACTTTCTGG + Intergenic
1076144501 10:128106560-128106582 CACAGCCCAAGAGAAGTCTCAGG - Exonic
1084769442 11:71333284-71333306 CACAGCCCCATGGAACATTCTGG - Intergenic
1086204641 11:84243141-84243163 CTCTGTCTGATAGAACTTTCTGG + Intronic
1086990660 11:93300257-93300279 CACTGCAGAACAGAATTTTCTGG + Intergenic
1089763440 11:120745726-120745748 CAATTCCCAAAAGATCTTTCAGG - Intronic
1092261805 12:6956847-6956869 CCCTGCCCCATAGATCTCTCTGG + Intronic
1098810872 12:75089920-75089942 GGCTGTCCAGTAGAACTTTCTGG - Intronic
1103334138 12:120176544-120176566 ACCTCCCCAAAAGAACTTTCTGG - Intronic
1104424743 12:128666798-128666820 CACTGACCAATATCAATTTCAGG - Intronic
1105773191 13:23632362-23632384 TACTGCCAAACAGAACTTTCAGG + Intronic
1106857981 13:33873459-33873481 CTTTGCCCAACAGAAATTTCTGG - Intronic
1109056662 13:57558644-57558666 CACAGTGCAATAGAACTTTCTGG - Intergenic
1109444146 13:62411256-62411278 CACAGCCAACTAGAATTTTCTGG + Intergenic
1111998416 13:95187934-95187956 CACTGCCCTCCAGAAGTTTCTGG - Intronic
1113834517 13:113319883-113319905 CACTGCCCAATAGGCCATGCTGG - Intronic
1115380392 14:32730883-32730905 CACTGTCCACTTGAATTTTCTGG - Intronic
1115404189 14:32996860-32996882 CACTGCCTAATGGAGCTTTGAGG + Intronic
1119910303 14:78343914-78343936 CACTGCCTAATAGAACTGCCAGG - Intronic
1121227044 14:92328714-92328736 CCCAGCCCAACAGAACTTCCTGG - Intronic
1121409890 14:93742580-93742602 CCCTGCCCAAGGGAATTTTCTGG - Intronic
1121814170 14:96916307-96916329 AACTGCCCAGCTGAACTTTCTGG + Intronic
1121821119 14:96967002-96967024 CACTGCCCAATTGGAGTCTCTGG - Intergenic
1123854857 15:24398392-24398414 CACTGCCCAAAAGAAATCTTTGG - Intergenic
1123870887 15:24571378-24571400 CACTGCCCAAAAGAAATCTTCGG - Intergenic
1126639922 15:50813757-50813779 CACTGCCTTATACAATTTTCTGG - Intergenic
1132219527 15:100094913-100094935 TGCTGTCCAATAGAACCTTCTGG + Intronic
1134813189 16:17184677-17184699 CACTGTCCAGTGGAACTTTCGGG - Intronic
1136358561 16:29762646-29762668 CAATGTCCAACAGAACTTTCTGG - Intergenic
1137757678 16:50915421-50915443 TGCTGTCCAAGAGAACTTTCTGG + Intergenic
1140724924 16:77803335-77803357 ACATGTCCAATAGAACTTTCTGG - Intronic
1140741712 16:77947505-77947527 CACTGGCCAATATTACTCTCAGG + Intronic
1140902498 16:79382363-79382385 ATCTGTCCAACAGAACTTTCTGG + Intergenic
1141888530 16:86910420-86910442 CACTGGCCAATTTAACTTTATGG - Intergenic
1142871144 17:2821831-2821853 CGCTGTACAGTAGAACTTTCTGG - Intronic
1142881284 17:2884124-2884146 CAATGCACACTAGAAGTTTCTGG - Intronic
1145919170 17:28597533-28597555 TACTGTCCAATAGAACTTTCTGG - Intronic
1147520095 17:41162799-41162821 AAATGCCCAATAGAACATTTAGG + Intergenic
1147648687 17:42049956-42049978 CTCTGTCCAATAGAACTTTCTGG - Intronic
1148095629 17:45051185-45051207 CACTGCCCTTTAGAACTTTGCGG - Intronic
1148537839 17:48455611-48455633 CACTTCTCTATAGAACATTCTGG - Intergenic
1148960265 17:51386534-51386556 CACAGCCCGGTAGAACTTTCTGG - Intergenic
1153719597 18:7888340-7888362 AACTGGCCATTAGTACTTTCTGG + Exonic
1155811964 18:30248410-30248432 TACTTCCCAATACAACTTTTAGG - Intergenic
1156498160 18:37539650-37539672 CACTGTTTGATAGAACTTTCTGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160418175 18:78726462-78726484 CACTGCCCGCCAGAACCTTCTGG + Intergenic
1162845669 19:13390432-13390454 CACTGTCTGACAGAACTTTCTGG + Intronic
925593261 2:5530846-5530868 TACTTCCCAAAAGAACTTTCTGG - Intergenic
926758900 2:16259995-16260017 AACTGCTCAATAGAACTAACTGG - Intergenic
927095513 2:19745150-19745172 CGCTGTTCAGTAGAACTTTCTGG - Intergenic
928933916 2:36654757-36654779 CATTACCCAATAGAGCTTTCTGG - Intergenic
931401017 2:61931492-61931514 CTCTGCCCATGAGAACTTTGAGG - Intronic
933111794 2:78410416-78410438 CTCTGCACAATACGACTTTCAGG + Intergenic
936376454 2:111945535-111945557 CAGTGCCCAAAAGAAGTCTCAGG - Intronic
939075203 2:137593010-137593032 CACAGCCCAAAAGAACTGTGTGG - Intronic
940091487 2:149924489-149924511 CACTGCAACCTAGAACTTTCAGG + Intergenic
941210709 2:162635119-162635141 CACTGTCCAATAGAAATTTCTGG - Intronic
945158284 2:206862072-206862094 AACTGCTTACTAGAACTTTCTGG - Intergenic
945194557 2:207226121-207226143 CACTGTCCCATAGAACTTTCTGG + Intergenic
945256658 2:207808900-207808922 CACTGTCCAGTAGAACATTCTGG - Intergenic
946436611 2:219660714-219660736 CACTGTGCAATGGAACTTTCTGG - Intergenic
947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG + Intronic
947853673 2:233308558-233308580 AATTGCCAAATAGAACTTTTGGG + Intronic
947989855 2:234478091-234478113 CACTGCCCACTGGCACTTCCAGG - Intergenic
948702490 2:239768963-239768985 CACTGCACCAGAGCACTTTCGGG + Intronic
1170691791 20:18622856-18622878 CACTGCCCAGAGGAACTTGCGGG - Intronic
1173580271 20:44142197-44142219 CACCACCCAATAGAACTTTCAGG + Intronic
1177721092 21:24907891-24907913 GACTTCCCAATATATCTTTCAGG - Intergenic
1178474105 21:32921280-32921302 CACTGTCCAGTAGAACTTGCTGG + Intergenic
1180939488 22:19648071-19648093 CACTGCCCTCTTGAACTCTCGGG - Intergenic
1182118066 22:27768937-27768959 TATTGTCCCATAGAACTTTCTGG - Intronic
1182852565 22:33488323-33488345 CTCTGTCCAACATAACTTTCTGG - Intronic
1183822752 22:40360009-40360031 CACAGCCCAATAGAAATGCCTGG - Intronic
1184682975 22:46081881-46081903 CAGTGCCGTTTAGAACTTTCCGG - Intronic
950155064 3:10715817-10715839 TGCTGTCCAAAAGAACTTTCTGG + Intergenic
950158022 3:10738627-10738649 AACTGCCCAAAAGCACCTTCGGG - Intergenic
951903134 3:27677209-27677231 CTCTGCCAAATAGATCTTTATGG - Intergenic
951979734 3:28552031-28552053 TACAGTCCAGTAGAACTTTCTGG - Intergenic
952749649 3:36814998-36815020 CACAGCCCCACAGAGCTTTCTGG + Intergenic
953125950 3:40092056-40092078 CACTGCACAAGAGACATTTCAGG - Intronic
955496820 3:59542222-59542244 CACTGTCTGATAGAACTTTCTGG - Intergenic
956191149 3:66609856-66609878 AACAGCCAAATAGAACTCTCTGG + Intergenic
959775725 3:110160458-110160480 CACTTCCCAATGAAACTCTCTGG + Intergenic
960089168 3:113621820-113621842 CATTGTCCATTAGAACTCTCTGG + Intronic
962302590 3:134255921-134255943 CACTGCCCAATAGAAATGTCAGG - Intergenic
962973645 3:140427488-140427510 CACTGCCCACTAGACATCTCTGG - Intronic
963951884 3:151211102-151211124 TACTACCTATTAGAACTTTCAGG - Intronic
965141849 3:164848021-164848043 CAGTACACAATACAACTTTCAGG - Intergenic
965597821 3:170425257-170425279 CAGAGCCCAAGAGAACCTTCCGG - Intronic
974317594 4:60302606-60302628 CATTGACCAATAGAAAGTTCTGG + Intergenic
979270560 4:118755766-118755788 CACAGCCCAAAATAAATTTCAGG + Intronic
979270676 4:118756991-118757013 CACAGCCCAAAACAAATTTCAGG - Intronic
979548172 4:121960778-121960800 CTCTGCCCAATGGACTTTTCTGG + Intergenic
980007920 4:127562141-127562163 CACTTCCCTATAGAGTTTTCTGG + Intergenic
984145842 4:176059573-176059595 CATTTACCAATAAAACTTTCTGG + Intergenic
985182815 4:187283242-187283264 CAATGCCCAGTGGAAATTTCAGG + Intergenic
988514098 5:31890188-31890210 CACTGTCCAATAAAACTTAATGG + Intronic
988639906 5:33030378-33030400 CACTGCCTGAAAGAACTTTCTGG + Intergenic
992918400 5:81483991-81484013 CACTGCCCAATAGAACTTTCTGG - Intronic
993265322 5:85719773-85719795 CACTTTCCAATAAAACTTTTTGG + Intergenic
994202529 5:96994379-96994401 CATTGCCCAGTATAACTTTGTGG + Intronic
996333534 5:122357885-122357907 CATTGTCCAGCAGAACTTTCTGG - Intronic
1000579506 5:163018033-163018055 CACTGCCCAGTAGAAGTCTCAGG - Intergenic
1000703926 5:164488206-164488228 CACTGTCCAAGAGATCATTCAGG + Intergenic
1000973279 5:167737912-167737934 CAGTGCCCTATAGAACTGTCTGG - Intronic
1001394594 5:171407524-171407546 TGCTGCCCAATAGGGCTTTCTGG + Intronic
1002701679 5:181129154-181129176 CACTGCCAGCTTGAACTTTCAGG - Intergenic
1005344338 6:24874530-24874552 CTCTGCCCAACAGAGCTTTCAGG - Intronic
1006169576 6:32085373-32085395 CCCTGCCCTATAAATCTTTCAGG - Intronic
1008399645 6:51049752-51049774 TACTACCCAATAGAGCTTACAGG - Intergenic
1009803616 6:68573677-68573699 TATTGCCCAGAAGAACTTTCTGG - Intergenic
1010767485 6:79792921-79792943 CACTGTCCACTGGAACTTCCTGG + Intergenic
1013986667 6:116201979-116202001 TGCTGACCAATAGAACTTCCTGG + Intronic
1015595611 6:134863653-134863675 TACTGTCCAATAGAACTTCCTGG - Intergenic
1016208081 6:141494589-141494611 GACTGCCCAAGAGAACTGTAGGG - Intergenic
1017552944 6:155529620-155529642 TGCTGTCCAATAGAGCTTTCTGG + Intergenic
1019143267 6:169961598-169961620 CCCTGTCCCATGGAACTTTCCGG + Intergenic
1027491974 7:78839469-78839491 CACTGCTATAAAGAACTTTCTGG + Intronic
1029525287 7:101090065-101090087 CACTGCCCATTCGAAATCTCAGG - Exonic
1030098978 7:105928032-105928054 AACTGCCAGAGAGAACTTTCTGG + Intronic
1031291116 7:119936533-119936555 CACTGACAAATAGAAATTTTGGG - Intergenic
1032316718 7:130844907-130844929 TATTGTCCAATAGAACCTTCCGG - Intergenic
1036945998 8:13095495-13095517 CACTGTCCAGGAGAACTGTCTGG - Intronic
1039980793 8:42408394-42408416 CACTGCCCAGCAGAGCTTTCTGG + Intergenic
1041865143 8:62564125-62564147 CACTGACCAAGAGAACTTGTTGG - Intronic
1044931650 8:97257773-97257795 CACTGCCCAAATGCCCTTTCTGG + Intergenic
1046551088 8:115718126-115718148 CACTGCCCAACAGAAATGTAAGG - Intronic
1053057414 9:35001937-35001959 ACCTGCCCAAGTGAACTTTCAGG + Intergenic
1055873132 9:80909168-80909190 CACTGTTCAATAGAACTTTCTGG - Intergenic
1056787217 9:89602042-89602064 CAATGCCCACTAGAAGTTTGAGG - Intergenic
1057043668 9:91866821-91866843 TTCTGCCCCATAGAACTTTTGGG - Intronic
1059501018 9:114754137-114754159 TCCTGCCCAATAGAAGTTACAGG - Intergenic
1060171237 9:121463058-121463080 CACTGCTTAAGAGAACTTTGAGG + Intergenic
1061149899 9:128822747-128822769 CTCGGCCCCTTAGAACTTTCAGG + Exonic
1061706725 9:132458600-132458622 CACTGTCCGGTGGAACTTTCTGG + Intronic
1061904078 9:133687717-133687739 TGCTGCCCCATGGAACTTTCTGG - Intronic
1187438230 X:19292236-19292258 AGCTGTCCAATAGAACTTTCTGG - Intergenic
1187654704 X:21458334-21458356 CACTGTCCAATAAAACTTTCTGG - Intronic
1187995937 X:24926731-24926753 GACTGCCCACTAGAACTACCTGG + Intronic
1188473460 X:30565513-30565535 CACTGTCCAACAGAGCTTCCTGG + Intronic
1189558040 X:42165665-42165687 CACTGCCCTATAAAACCTTTTGG - Intergenic
1196710155 X:118754056-118754078 CACCATCCAACAGAACTTTCTGG - Intronic
1197845096 X:130792949-130792971 CACTGTCCAGCAGAAGTTTCTGG - Intronic