ID: 992919804

View in Genome Browser
Species Human (GRCh38)
Location 5:81503157-81503179
Sequence AAAAAACAACAGATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1178
Summary {0: 1, 1: 0, 2: 14, 3: 130, 4: 1033}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992919802_992919804 6 Left 992919802 5:81503128-81503150 CCAGTCAGAATGGCTATTATAAA 0: 47
1: 1536
2: 4615
3: 6316
4: 21709
Right 992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG 0: 1
1: 0
2: 14
3: 130
4: 1033
992919799_992919804 29 Left 992919799 5:81503105-81503127 CCACAATGAGATACCATCTCACA 0: 13633
1: 10201
2: 9897
3: 7805
4: 7587
Right 992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG 0: 1
1: 0
2: 14
3: 130
4: 1033
992919800_992919804 16 Left 992919800 5:81503118-81503140 CCATCTCACACCAGTCAGAATGG 0: 1798
1: 16456
2: 8687
3: 5862
4: 3413
Right 992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG 0: 1
1: 0
2: 14
3: 130
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992919804 Original CRISPR AAAAAACAACAGATGCAGCT GGG Intronic
900262086 1:1736639-1736661 AAAATACAACAGAATTAGCTGGG + Intronic
900632146 1:3642744-3642766 AAAAAAAAAAAAATGCTGCTGGG + Intronic
901010908 1:6201563-6201585 AAACAAAAAAACATGCAGCTGGG - Intronic
901410829 1:9082883-9082905 AAAAAAAAAAAAATGCAGATTGG + Intronic
901434281 1:9236675-9236697 AAAAAAAAAAAAAAGCAGCTAGG + Intronic
901567720 1:10132465-10132487 AAGAAAGCACAGATGCAGGTAGG + Exonic
901705504 1:11070074-11070096 AAAAAGAAACAAATGTAGCTGGG + Intronic
902594121 1:17496355-17496377 AGAAAACAGCAGAAGCAGATGGG + Intergenic
902603457 1:17555768-17555790 AAGCAAGAACAGATGCAGGTGGG - Intronic
902638968 1:17754319-17754341 AAAAAAAAACAGGTGGAGATGGG - Intergenic
902908361 1:19576211-19576233 AAAAAACTACAGAGGCAGGCTGG - Intergenic
903179686 1:21598887-21598909 CAGATACAACAGATACAGCTGGG - Intronic
903504613 1:23824771-23824793 AAAAAATAAAAGCTGAAGCTAGG - Intronic
903729346 1:25479565-25479587 AAAATACAAAAAAAGCAGCTGGG - Intronic
904781640 1:32954067-32954089 AAAATACAAAAAATGTAGCTGGG - Intronic
905192672 1:36247859-36247881 AAAAAAAAAAAGATGAAGATGGG - Intronic
905247153 1:36623168-36623190 ATAAAACCACTGATGCCGCTGGG + Intergenic
905599539 1:39237707-39237729 AAAAAAAAAAAGAATCAGCTGGG - Intronic
905784903 1:40747251-40747273 AAAAAAAAACAGATATTGCTTGG + Intronic
905809726 1:40903117-40903139 AAAAATCAAGAGATGAAACTTGG - Intergenic
905822165 1:41001749-41001771 CAAAAACAACAAAACCAGCTGGG + Intronic
905848149 1:41251545-41251567 AAAATATAACAGATGCTGGTGGG - Intergenic
905892341 1:41525294-41525316 ATAAAACAGCAGCAGCAGCTCGG + Intronic
906387822 1:45386945-45386967 AAAAAACTACATATGGGGCTGGG - Intronic
906406861 1:45549173-45549195 AAAAAAAAAAAAATTCAGCTAGG - Intergenic
906972799 1:50534567-50534589 AAAAATCAACAGAAGAGGCTGGG - Intronic
906988319 1:50710900-50710922 AAAAAAAAACAAATGCCACTTGG - Intronic
907002433 1:50875138-50875160 ACAAAACAATAGATTCAGATTGG - Intronic
907028755 1:51149980-51150002 CAAGAACAACAGTTGAAGCTAGG - Intergenic
907313376 1:53552518-53552540 AAAAACCAACAGATGCATTTGGG + Intronic
908080385 1:60571259-60571281 GAAAAAAGACACATGCAGCTAGG + Intergenic
909630003 1:77761044-77761066 AAAAAAAAAAAGATGCCGTTAGG + Intergenic
909654066 1:78011012-78011034 AAAATCCAACAGATTAAGCTAGG - Intronic
909722553 1:78792981-78793003 AAAAAATAACAGATGTTGGTGGG + Intergenic
909909473 1:81244490-81244512 AGAAAACAACAGATGCTGGAAGG + Intergenic
910991574 1:93061899-93061921 AAAAAAAAATAGAAGAAGCTGGG - Intergenic
910993290 1:93078092-93078114 TAAAAAAAGCAGATGCAGCCGGG - Intergenic
911116228 1:94248861-94248883 AATAAACAACAGAGCTAGCTGGG - Intronic
911125079 1:94333859-94333881 AAAAAAAGTCAGATGCAGCTGGG + Intergenic
911183946 1:94885233-94885255 AAAAAAAAAAAGAGGCAGCAGGG + Intronic
911491912 1:98579734-98579756 AAAAAATAACAGATGCTGGCTGG - Intergenic
911553953 1:99319420-99319442 AAAAAACAAAAAATTCAGATAGG + Intergenic
911667800 1:100573797-100573819 AAAAAATAACAGATGCTGATGGG + Intergenic
912205502 1:107503949-107503971 AAGAAACAACAGATGCTGACAGG - Intergenic
912303251 1:108538185-108538207 AAAAAATAACAGATGTTGGTGGG - Intergenic
912338543 1:108887317-108887339 AAAAAACCACACAGGCAGGTGGG + Intronic
912610730 1:111040560-111040582 AAAAAAAAAAAGTTGCAGTTAGG + Intergenic
913270912 1:117092698-117092720 AAAAAAGGACAGGAGCAGCTGGG - Intronic
913664409 1:121034311-121034333 AAAAAACACCAGATACAGCCAGG + Intergenic
914015801 1:143817590-143817612 AAAAAACACCAGATACAGCCAGG + Intergenic
914161981 1:145143418-145143440 AAAAAACACCAGATACAGCCAGG - Intergenic
914377153 1:147081381-147081403 AGAAAACAACAGAAGCAGGAAGG + Intergenic
914654420 1:149726131-149726153 AAAAAACACCAGATACAGCCAGG + Intergenic
914889474 1:151610256-151610278 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
915695398 1:157736196-157736218 AAAAAATAACAGATGTGGCCAGG - Intergenic
915939224 1:160108148-160108170 AAAAAAATACCGATGCGGCTGGG + Intergenic
916089243 1:161294289-161294311 AAAAAAAAAATGCTGCAGCTGGG - Intergenic
916510863 1:165471296-165471318 AAAAAAAAAAAGAGGCATCTGGG + Intergenic
916560082 1:165927018-165927040 AAAAAAGAACAAAATCAGCTGGG - Intergenic
916596933 1:166252523-166252545 AAAAAAAAGCAAATGTAGCTGGG - Intergenic
916747048 1:167692654-167692676 AAAAAGCAGCATATGAAGCTGGG - Intronic
916842370 1:168613626-168613648 TAATAAAAACAGATGCAGATTGG - Intergenic
917054345 1:170963321-170963343 AAAAAACAACAGATGCTGGCAGG + Intronic
918062522 1:181074362-181074384 AAAAAACAACTGATATGGCTTGG + Intergenic
918261739 1:182802452-182802474 AAAAAAAATCTGATGCATCTAGG - Intronic
918289189 1:183090241-183090263 AAAAAAAAGCAGATGCATCTAGG + Intronic
918616652 1:186551558-186551580 AAAAAACAACAGAGGAAGAAAGG - Intergenic
918625898 1:186655681-186655703 AAAAAAGAACACATTCAGCCTGG + Intergenic
918872875 1:189998857-189998879 AAAAAACAAGTAATGCAGCTTGG - Intergenic
918950590 1:191131574-191131596 AAAAAACAACAAATGCTGGCAGG + Intergenic
918972535 1:191438183-191438205 AAAAAACAACAAATGGTGCTGGG + Intergenic
919342655 1:196333083-196333105 AAAAAAAAAAACTTGCAGCTGGG - Intronic
919457960 1:197842330-197842352 AAAAAAAAACAGAAGCAGGGAGG - Intergenic
919522994 1:198612286-198612308 AAAAAAGAACAGATTCACTTAGG - Intergenic
919798130 1:201333585-201333607 AATAAACATCAGCTCCAGCTGGG - Intergenic
919902365 1:202053650-202053672 AAAAAATAACAGATGCAGCCAGG + Intergenic
920108711 1:203572325-203572347 ACAAAACAGAAGATGCAGATAGG - Intergenic
920612821 1:207458268-207458290 AAAAAAAAAAAAATGAAGCTTGG - Intronic
920981340 1:210838901-210838923 AAACAACAACAGATGCTGGCAGG + Intronic
921621762 1:217333288-217333310 GAAAGAGAACAAATGCAGCTGGG + Intergenic
921651145 1:217679972-217679994 AAAACACAAAAGATGCATGTTGG - Intronic
921753724 1:218827680-218827702 AAAAAATAACAGATGCTGGCAGG - Intergenic
921772979 1:219065006-219065028 AAAAAACAAGAGGGGCTGCTAGG + Intergenic
921828999 1:219706218-219706240 AAGAAACAACAGATGCCGTGAGG + Intronic
921843527 1:219854555-219854577 AAGAAACAACAGATGCTGGAGGG - Intronic
922040802 1:221894593-221894615 CAAAAACAACAGATGCTGGCAGG + Intergenic
922159109 1:223065443-223065465 AAAAAAAAAAGGATGCGGCTGGG - Intergenic
922254106 1:223877222-223877244 AAAAAAGATCATATGAAGCTGGG + Intergenic
922402490 1:225274487-225274509 AAAAAATAACAGATGCGGCCGGG - Intronic
922549879 1:226486338-226486360 AAAAAACAACAGATGCTGGCAGG - Intergenic
923189593 1:231607742-231607764 AGAAAATAACAGATGCTGCTAGG - Intronic
923620877 1:235578030-235578052 AAAAAAGAAAAGGTGCATCTTGG - Intronic
923653616 1:235896810-235896832 AAAAAAAAAAGGAGGCAGCTGGG + Intergenic
923720703 1:236464412-236464434 AAAAAAAAAAAGTTGCAGCAAGG - Intronic
924048626 1:240058267-240058289 AAAAAACAAGGGATGGAGTTTGG - Intronic
924189484 1:241535239-241535261 AAAAAAAAACAGAAGAAGATGGG - Intronic
924228303 1:241941522-241941544 AAAAAAACACAGATGTGGCTGGG - Intergenic
924236024 1:242000227-242000249 AAAAAACAACAAACACAACTTGG - Intergenic
1063208172 10:3854636-3854658 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1063240566 10:4165392-4165414 AAAAAAAAAAAAATTCAGCTTGG - Intergenic
1063427683 10:5962599-5962621 AAAAAAAAAAAGATCCACCTGGG + Intronic
1063797559 10:9530006-9530028 AAAAGACAACAGATGTTGGTGGG + Intergenic
1064407792 10:15079870-15079892 AAAAAAAAAGAAAAGCAGCTGGG - Intronic
1064577446 10:16760630-16760652 AAAATACAACAGATGGAGACAGG - Intronic
1064737218 10:18394421-18394443 CAAAAACATCAGATGCATGTAGG + Intronic
1064751163 10:18530517-18530539 AAAAAAAAAAAAATGCAGTTGGG + Intronic
1064890246 10:20162918-20162940 AAAAAAAAAAAAATCCAGCTGGG + Intronic
1065025592 10:21536260-21536282 AAAAAGCAAGACATGCAACTTGG - Intronic
1065033674 10:21614637-21614659 AAAAAAGATCAGTTGCAGGTTGG + Intronic
1065280642 10:24134296-24134318 AAAACATAGCAGATGCAGGTAGG + Intronic
1065332290 10:24614786-24614808 AAAAAAAAAAAAATGCGGCTAGG + Intronic
1065441859 10:25761344-25761366 AAAAACCAACAGATGCCTCAAGG + Intergenic
1065868830 10:29938160-29938182 AAAATACAAAAGAAACAGCTGGG - Intergenic
1065880285 10:30031735-30031757 AAAAAAATACAGATGGGGCTGGG - Intronic
1065938533 10:30543327-30543349 AAAAAAAAAAAGAGGCAGTTAGG - Intergenic
1066003871 10:31129621-31129643 AAAAAAAAAAAAAGGCAGCTGGG + Intergenic
1066097389 10:32085183-32085205 AAAAGACGACAGTTGCAGTTGGG + Intergenic
1066113476 10:32218722-32218744 AAAAAATAACAGATGTTGGTGGG + Intergenic
1066384872 10:34933554-34933576 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1066715001 10:38277168-38277190 CAAAAACAATAGATGGGGCTGGG + Intergenic
1066783079 10:38973532-38973554 CAAAAACAATAGATGGGGCTGGG - Intergenic
1067115464 10:43432468-43432490 AAAGAACCACAGATGTAGCCAGG - Intergenic
1067269895 10:44782121-44782143 AAAAAATAACAAATGCTGATGGG + Intergenic
1067352345 10:45487906-45487928 AACACACCACAGATTCAGCTGGG - Intronic
1067385469 10:45814337-45814359 AAAAATCAACAGAGGCTTCTAGG + Intergenic
1067484391 10:46633934-46633956 AAAAAACGACAGATGTTGGTAGG - Intergenic
1067610369 10:47707712-47707734 AAAAAACGACAGATGTTGGTAGG + Intergenic
1067805463 10:49389375-49389397 AAAAAAGAACAGAAACAGCATGG + Intronic
1068073148 10:52221049-52221071 AAAAAATAACAGATGCGGGTGGG - Intronic
1068088490 10:52404000-52404022 AAAGAATAACAGATGCTGATGGG - Intergenic
1068555577 10:58455011-58455033 AGAAAACTTCAGATTCAGCTTGG + Intergenic
1068621953 10:59195642-59195664 AGAAAACAACAGAAGCAGGAAGG - Intronic
1068762323 10:60726214-60726236 AAAAAAAAACAGACACAGTTAGG + Intronic
1069122327 10:64582412-64582434 AAGAAACAGCAGATGCTGGTGGG - Intergenic
1070079807 10:73175073-73175095 AAAAAACAGAACATGGAGCTTGG + Intronic
1070448024 10:76527063-76527085 AAAAAAGAAGAGGTGGAGCTGGG + Intronic
1070973074 10:80583371-80583393 AAAAGACAACAGATGGAGCCGGG + Intronic
1071034992 10:81233953-81233975 AAGAAATAACAGATGCTGATGGG - Intergenic
1071345306 10:84686428-84686450 AAAAAAAAAAAGAAGAAGCTGGG + Intergenic
1071625781 10:87167970-87167992 AAAAAACGACAGATGTTGGTAGG + Intronic
1072635189 10:97173482-97173504 AAAAAAAAAAGGATGGAGCTGGG - Intronic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1072841256 10:98776284-98776306 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1072870542 10:99115142-99115164 AAAAAAAAACACATTTAGCTGGG - Intronic
1072960197 10:99922489-99922511 AAAAAAAAACAGCAGCAGCTAGG - Intronic
1074036970 10:109749207-109749229 AAAAAATAATAGATGCGGCATGG - Intergenic
1074057309 10:109934106-109934128 AATAAGCAGCAGATGCAGCAAGG + Intergenic
1074482904 10:113843077-113843099 CAAATACAACAGATCCAGTTGGG + Intronic
1074635058 10:115305313-115305335 TGAACACAACAGCTGCAGCTGGG - Intronic
1075702623 10:124479075-124479097 AAAAAAAAAAAGATCCAGTTTGG + Intronic
1075757417 10:124824546-124824568 AAAACAAAACAAAGGCAGCTAGG + Intronic
1075794775 10:125112092-125112114 AAAAAAAGTCAAATGCAGCTGGG - Intronic
1076642066 10:131924696-131924718 AAAAAAAAAAAAAGGCAGCTGGG + Intronic
1076925931 10:133487016-133487038 AAATAATAACAGATGAAGCAAGG - Intergenic
1077522531 11:3044883-3044905 ACAACACACCAGATGCAGATAGG + Intronic
1077563356 11:3280164-3280186 AAAAACCAACAGATGTGGCCAGG - Intergenic
1077569248 11:3325979-3326001 AAAAACCAACAGATGTGGCCAGG - Intergenic
1078135609 11:8649362-8649384 AAAATAAAACAGATGGTGCTGGG + Intronic
1078719256 11:13869457-13869479 AAAAAACAACAAATGCTGGGTGG - Intergenic
1079018051 11:16886375-16886397 AAAAAATAATTGATTCAGCTAGG + Intronic
1079072076 11:17356094-17356116 AAAAGACAAGACATGAAGCTGGG - Intronic
1079165689 11:18040526-18040548 AAAAAAAAACAAATTTAGCTGGG - Intronic
1079200971 11:18377199-18377221 AAAAAACAACAAAACTAGCTGGG - Intergenic
1079616481 11:22499962-22499984 AACAAACAACAGAAGAATCTAGG - Intergenic
1080344594 11:31310477-31310499 AAAATACAAAAAATTCAGCTGGG - Intronic
1080398683 11:31914028-31914050 AAAAAATAACAGATGCTGGTGGG - Intronic
1080947786 11:36994531-36994553 AAAAAAAAACACATTCAGCAGGG + Intergenic
1081480975 11:43488859-43488881 AAAAAATAAAAAATACAGCTGGG - Intronic
1081616145 11:44592488-44592510 AAAGAAGAACAGATGCCGCCTGG + Intronic
1081910796 11:46698613-46698635 AAAAAAAAAAAGGAGCAGCTGGG + Intronic
1081944770 11:46981262-46981284 AAAAAAAAAAAGATGCAGAAAGG + Intronic
1082056794 11:47824798-47824820 AAAAAACAAAAGAAAAAGCTGGG - Intronic
1082076188 11:47978101-47978123 AAAAAAAAAAAGATGCTACTGGG - Intergenic
1082083596 11:48031151-48031173 AAATAACAAAAGATGAGGCTAGG - Intronic
1082831052 11:57617608-57617630 AAAAAACAAAAAATGTAGCCAGG - Intergenic
1082843556 11:57709386-57709408 AAAAAAAAAAAGAGGCATCTTGG + Intronic
1082907492 11:58326058-58326080 AAAAAAAAAAAGATGCTGGTGGG - Intergenic
1083044761 11:59724318-59724340 AAAAAGCAATAGATGTAGGTGGG + Intronic
1083425522 11:62582831-62582853 AAAAATCAATTCATGCAGCTGGG + Intronic
1083665795 11:64273872-64273894 AAAAAAAAAGAGAGGCAGGTAGG + Intronic
1084002065 11:66301381-66301403 AAAAAAAAAAAGAGGCGGCTGGG - Intergenic
1084066355 11:66706624-66706646 AAAAAAAAAAAAAAGCAGCTAGG - Intronic
1084311429 11:68318497-68318519 AAAAAACAACAAAATCAGCTGGG - Intronic
1084865778 11:72055818-72055840 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1084981985 11:72834301-72834323 CAAAACCAAAAGCTGCAGCTGGG + Intronic
1085497115 11:76979842-76979864 AAAAAAAAACAGGTTTAGCTGGG + Intronic
1085721792 11:78918808-78918830 AAAAAACAAAGGAAGCAGCCAGG - Intronic
1086083024 11:82924838-82924860 AAAAAAAAACAAATGAAACTTGG + Intronic
1086430808 11:86734473-86734495 AAAAAAAAAAAAAAGCAGCTAGG - Intergenic
1086527922 11:87750751-87750773 AAAAAACAATAAAAGCAGCTAGG - Intergenic
1086548325 11:88025527-88025549 AAAAAACAACAGATTTGGCAAGG - Intergenic
1086809128 11:91283235-91283257 AAGAAACAACAGCTTCATCTAGG + Intergenic
1087403123 11:97693572-97693594 AGAAAACAACAGATGCTGGAGGG - Intergenic
1087781231 11:102303200-102303222 AAAAAAAAAAAGATGTAGCATGG - Intergenic
1088099268 11:106136729-106136751 AAAGAACCTCAGATGCAACTAGG - Intergenic
1088278702 11:108115864-108115886 AAAGAACAGCAGGTGCAGCCAGG + Intergenic
1088442373 11:109885710-109885732 AAAAAATAACAGATGCTGATGGG + Intergenic
1088560719 11:111113120-111113142 AAAAACCAACAAACTCAGCTGGG - Intergenic
1088654890 11:111989781-111989803 AAAAAAAAAAAGATGCCTCTAGG - Intronic
1089579323 11:119471512-119471534 AAAAAAGATCAGAGGCAGCAGGG + Intergenic
1089776266 11:120838722-120838744 AAAAAACACCAACTGCAACTGGG - Intronic
1089779609 11:120864158-120864180 TAAGAACAGCAGACGCAGCTGGG - Intronic
1090094720 11:123731121-123731143 ATAAATCAACAGATCCAGTTGGG + Intronic
1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG + Intergenic
1091084273 11:132705430-132705452 AAAAAATAACAAATTCAGCTGGG + Intronic
1092943876 12:13435581-13435603 ATACAACTTCAGATGCAGCTTGG - Intergenic
1093513895 12:19962322-19962344 AACAAACAACAGAAGCTGGTTGG + Intergenic
1094388629 12:29923280-29923302 AAAAAACAACAGATACACTTTGG + Intergenic
1094426547 12:30322358-30322380 AAAAATAAACATTTGCAGCTGGG - Intergenic
1095130105 12:38531027-38531049 AAAAAACAACAAATGTGGTTGGG - Intergenic
1095187419 12:39216898-39216920 AAAAAAAAAAAAATACAGCTGGG + Intergenic
1095427659 12:42094360-42094382 AAAAAAAAAAAGATGAGGCTGGG + Intronic
1095441663 12:42244116-42244138 AAAAAAAAACAGATGTCGGTAGG + Intronic
1095480035 12:42625299-42625321 AAAAAACAAAAAACACAGCTGGG + Intergenic
1095533711 12:43221509-43221531 AAAAATCACCATATGCAGGTTGG - Intergenic
1095602181 12:44026389-44026411 GAAAAGCAACAGAGGCATCTGGG - Intronic
1096128105 12:49134848-49134870 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
1097028962 12:56078389-56078411 AAAAAACAAAACATTCGGCTGGG - Intergenic
1097334419 12:58366209-58366231 AAAAAACAAAGAATCCAGCTGGG - Intergenic
1097653268 12:62330291-62330313 AAAAAAAAACAAATGGGGCTGGG + Intronic
1097759558 12:63446733-63446755 AAAAAACAACAGATGCTGGCGGG + Intergenic
1097773147 12:63613893-63613915 AAAAAATAAAAGAGACAGCTGGG + Intronic
1097916666 12:65027712-65027734 AAAAAATAACAGATGTCGGTGGG - Intergenic
1098278351 12:68836430-68836452 ATAAAACAAAACATTCAGCTAGG - Intronic
1098278984 12:68843976-68843998 AGAAAAAAACAGATTCTGCTTGG - Exonic
1098427110 12:70377124-70377146 AAAAAATAACTAATCCAGCTGGG - Intronic
1098444381 12:70551189-70551211 AAGAATCAAGAGATGCGGCTGGG - Intronic
1098937625 12:76498878-76498900 AAAAAACAATAAACGTAGCTGGG - Intronic
1099010833 12:77289306-77289328 AAAGAACTAGAGAAGCAGCTGGG + Intergenic
1099098867 12:78411527-78411549 AAAAAATAACAGATGCCGCAAGG - Intergenic
1099897523 12:88667545-88667567 AAAAAAAAACTCCTGCAGCTAGG - Intergenic
1099954244 12:89337350-89337372 AAAAAAAAAAAGCAGCAGCTGGG + Intergenic
1099982543 12:89623343-89623365 AAAAAAAAAAAGATGTAGCTTGG - Intronic
1100086737 12:90920002-90920024 AAAATAGAGCAAATGCAGCTAGG - Intronic
1101483619 12:105128936-105128958 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1101644897 12:106622613-106622635 AAAAAAAAAAAAATGCAGCTTGG - Intronic
1102143497 12:110636692-110636714 CCACAACAACAGAGGCAGCTGGG - Intronic
1102361097 12:112288325-112288347 AAAAAAAAAAAGATGCAGCAAGG + Intronic
1103584119 12:121938300-121938322 CAACAACAACAGATGAGGCTGGG - Intronic
1103616184 12:122154112-122154134 AAAAAAAAAAAGTTGCTGCTGGG - Intergenic
1103680825 12:122692284-122692306 AAAACAAAACAGATCCAGCTGGG - Intergenic
1103765127 12:123274281-123274303 AAAAAAAAAAAGTTTCAGCTGGG + Intergenic
1103771268 12:123327297-123327319 ATAAAACAACAGATGAAGCCAGG - Intronic
1103850852 12:123932259-123932281 GAAAAACAAAAGATACAGATAGG - Intronic
1104497218 12:129252202-129252224 TAAAACCAAAAGATGGAGCTGGG + Intronic
1105967067 13:25394687-25394709 AAGAAACATCAGATGCAGAAAGG + Intronic
1106191650 13:27458854-27458876 AAAAAAAAACAAATCCACCTAGG - Intergenic
1106416463 13:29549956-29549978 AAAAAACAATAGAAGTGGCTGGG - Intronic
1106641868 13:31593066-31593088 AAAAAGTAAAAAATGCAGCTGGG - Intergenic
1106791319 13:33157507-33157529 AAAATACAAAAAATGTAGCTGGG + Intronic
1106984009 13:35323008-35323030 AAAAAATACAAAATGCAGCTGGG - Intronic
1107866659 13:44709842-44709864 AAAATACAACAAATGAGGCTGGG + Intergenic
1108296610 13:49026662-49026684 AAAAAATAACAGAATTAGCTGGG - Intronic
1108390004 13:49937570-49937592 AAAAAAAAAAAGATACCGCTTGG + Intergenic
1108484090 13:50907260-50907282 AAGAAACAACAGATGAGGCCGGG - Intergenic
1108784159 13:53873841-53873863 AAAGAACAGCAGGTGCAGCCAGG - Intergenic
1109080253 13:57890552-57890574 AAAAAAAGAAAGATGGAGCTGGG - Intergenic
1109293705 13:60505030-60505052 AAAAAATAACTCCTGCAGCTAGG - Intronic
1109592158 13:64499648-64499670 GAGAAACACCAGATGCAGATAGG - Intergenic
1111492627 13:89002379-89002401 AAAAAATAATAGATGTTGCTGGG - Intergenic
1111588505 13:90312426-90312448 AACAAAAAACTGATGTAGCTTGG + Intergenic
1111899597 13:94184632-94184654 AAAAAACAACAGATGCCGATTGG + Intronic
1112119919 13:96398572-96398594 AAAATGCAACAGATGGGGCTGGG - Intronic
1112614935 13:100994594-100994616 AGAAAAGAACAGATGAGGCTGGG + Intergenic
1112659000 13:101485834-101485856 AAAAAACAATAGATGTTGGTAGG + Intronic
1112672249 13:101653847-101653869 AAAAAACAAAAAAAGTAGCTGGG - Intronic
1112742670 13:102492817-102492839 AAAAAAAAAAAGATGCACCTGGG + Intergenic
1112782740 13:102919078-102919100 AAAAGATAACAGATGCTGGTGGG - Intergenic
1113004343 13:105681593-105681615 AAAAAACAAAAGCTGCAGCGAGG - Intergenic
1113057397 13:106283959-106283981 AGAACACAGCTGATGCAGCTTGG - Intergenic
1114152833 14:20064143-20064165 AAAAAAAAAAAGGTGAAGCTGGG - Intergenic
1114639804 14:24212085-24212107 AAAAAAAAAGAAAGGCAGCTAGG - Intronic
1114698694 14:24653666-24653688 AAAAAATAACAAATGCTGCAAGG - Intergenic
1114896257 14:26994546-26994568 AGAAAACAACAGAGGTGGCTGGG + Intergenic
1115799236 14:36973446-36973468 AAAACAGAAAAGTTGCAGCTAGG + Intronic
1115951421 14:38726736-38726758 AAAAAAAAAAAAATGCAGATTGG - Intergenic
1116148623 14:41107917-41107939 AAAAAACAACAGATGGTGGTAGG + Intergenic
1116181046 14:41536113-41536135 AAAAAACAACAGATGCTGGTGGG - Intergenic
1116515652 14:45802003-45802025 AAGAAACACCAGATGCATCTAGG + Intergenic
1116797698 14:49409549-49409571 AGAAAACAATGCATGCAGCTGGG + Intergenic
1116943320 14:50811958-50811980 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1117699690 14:58400441-58400463 AAAAAAAAACAGTCTCAGCTTGG + Intronic
1117815051 14:59589153-59589175 TAAAAACAACAATGGCAGCTGGG + Intergenic
1117864956 14:60137401-60137423 AAGAAAAACCAGATGCAGTTAGG + Exonic
1118294566 14:64557357-64557379 AAAACACAACTGATGTAGGTTGG + Intronic
1118395291 14:65330988-65331010 AAAAAACAAAAAAATCAGCTGGG + Intergenic
1118598776 14:67456622-67456644 AAAAAATAACACATGCTGCAAGG + Intronic
1118705818 14:68479352-68479374 AAAAAACAGCAGAGGCAGGAAGG + Intronic
1119340142 14:73870034-73870056 AAAAAAAAAAAGAATCAGCTGGG + Intronic
1119488836 14:75012268-75012290 AAAAAACAACTGTTGTAGCTTGG + Exonic
1119572233 14:75685220-75685242 AAAAAACAAAAAATTTAGCTGGG + Intronic
1119633440 14:76254334-76254356 GAAAAACTGCAGCTGCAGCTGGG + Intronic
1120142078 14:80941008-80941030 AACCAATAAAAGATGCAGCTGGG + Intronic
1120277907 14:82400728-82400750 AAAAAATAACAGATGCGGTGAGG + Intergenic
1120698408 14:87670485-87670507 AAAAAATAACAGATGTTGGTAGG + Intergenic
1120907301 14:89631570-89631592 AAAAAAAAAAAGATTCATCTGGG + Intronic
1121031211 14:90660087-90660109 TAAAAAGAACAGAGGCGGCTGGG + Intronic
1121034252 14:90686982-90687004 AAAAAAAAAAATAGGCAGCTGGG - Intronic
1121196826 14:92080692-92080714 AAAATACAAAAGAATCAGCTGGG - Intronic
1123043796 14:105501573-105501595 AAAAAATAAAAAAAGCAGCTGGG + Intergenic
1123189407 14:106553988-106554010 AAAAAACAATGGATGCTGCTGGG + Intergenic
1123474750 15:20581876-20581898 ACAAAAAAGCAGCTGCAGCTTGG + Intergenic
1123643261 15:22418481-22418503 ACAAAAAAGCAGCTGCAGCTTGG - Intergenic
1123668628 15:22630273-22630295 AAAAAAAAAAAAATGGAGCTGGG - Intergenic
1123693062 15:22855254-22855276 AAAAAACAAAAGAATTAGCTGGG + Intronic
1124463283 15:29912713-29912735 AAAAAAAAAAAGAGGGAGCTTGG + Intronic
1124717655 15:32080635-32080657 AAGAAACAACAGATGCTGGCAGG + Intronic
1124799472 15:32816528-32816550 AAGAAACAACAGATGCTGTTTGG + Intronic
1124899196 15:33806911-33806933 AAAAAAAAAAAAATTCAGCTGGG - Intronic
1125088348 15:35759013-35759035 AGAAAACAACAGCTGGATCTTGG - Intergenic
1125129746 15:36269686-36269708 TAAAAACAAAAAATGTAGCTGGG - Intergenic
1125216080 15:37276919-37276941 AGAATACAACAGATGCTGCAAGG + Intergenic
1125398455 15:39274976-39274998 CAAAAACAAAAGGTGAAGCTTGG + Intergenic
1125881210 15:43197685-43197707 AAGGAACAACAGATGTAGCTTGG - Intronic
1126500235 15:49337340-49337362 AAAAAACAATAGATGCTGATGGG - Intronic
1126607378 15:50492152-50492174 AAAAAAATACAGTTCCAGCTGGG - Intronic
1126678523 15:51182606-51182628 AAGAAACAGCAGATTCATCTGGG - Intergenic
1126811449 15:52409831-52409853 AAAAAACAGTTGATGCATCTGGG - Intronic
1126924657 15:53570576-53570598 AAAAAATAACAGATGTTGCCAGG + Intronic
1127226027 15:56930221-56930243 AAACAACAACATATGCCTCTGGG - Intronic
1127240957 15:57113788-57113810 AAAAAAAAAAAAATTCAGCTAGG + Intronic
1128332935 15:66767948-66767970 AAAAAAAAAAAGATGCAGCTTGG - Intronic
1128338993 15:66806924-66806946 AAAAAAAAACAGAATTAGCTGGG + Intergenic
1128367860 15:67017396-67017418 AAAAAAGAAAAGATGCAGCTGGG + Intergenic
1128473366 15:67975364-67975386 AAAAAACAACAGGTTGGGCTGGG + Intergenic
1129147490 15:73662094-73662116 AAAATACAAAAAATGCAGCTGGG - Intergenic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1129852763 15:78803853-78803875 ACAAAACCACAGGTGCTGCTGGG + Intronic
1130453042 15:84076895-84076917 AGAAAAGAACAGAGCCAGCTGGG + Intergenic
1130750315 15:86704625-86704647 AGGAAACAACAGATGCTGGTAGG + Intronic
1131342497 15:91615699-91615721 AATATACAACATAGGCAGCTAGG + Intergenic
1131505128 15:93011057-93011079 AAAAAAGGCCAGATGCCGCTAGG - Intronic
1131522046 15:93123858-93123880 AAAAAAAAAAAGATCCAGCTAGG - Intergenic
1131562631 15:93457741-93457763 AAAAAAAAAAAGCAGCAGCTAGG - Intergenic
1131926671 15:97391935-97391957 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1132003926 15:98208820-98208842 AAGAAACTTCAGATCCAGCTGGG - Intergenic
1132029325 15:98427527-98427549 AAAAAACTACAGATGAAAATGGG + Intergenic
1132057732 15:98664908-98664930 AAAAAACGGCAAATGTAGCTAGG - Intronic
1132895264 16:2226099-2226121 AAAAAAAAAAAGATGCAGATTGG + Intronic
1132982722 16:2746940-2746962 AAAAAAAAAAAAATGCAGCCTGG - Intergenic
1133130596 16:3674070-3674092 AAAAAAGAACAGATGCCTCTGGG - Intronic
1133321683 16:4917995-4918017 AAAACACAAAAAAGGCAGCTGGG + Intronic
1133630012 16:7611416-7611438 AAAATACAAAAGATCTAGCTGGG + Intronic
1133653072 16:7831288-7831310 AGGAAACTACAGATGCATCTTGG - Intergenic
1134163475 16:11911845-11911867 AAAAAAAAAAAAATACAGCTGGG - Intronic
1134228153 16:12408180-12408202 AAAAAAAACTAGAAGCAGCTGGG + Intronic
1134259010 16:12635640-12635662 AAAAAAATACACATCCAGCTGGG + Intergenic
1134640158 16:15823591-15823613 AAAATAAAACATAGGCAGCTTGG - Intronic
1135085361 16:19470736-19470758 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1135288047 16:21210868-21210890 AAAAAAAAAAAAATGCAGCCAGG - Intronic
1135322070 16:21503600-21503622 AAAAAAAAAGAGAATCAGCTGGG + Intergenic
1135682946 16:24473978-24474000 AAAAAATAACATATGCAGAATGG - Intergenic
1135689748 16:24526695-24526717 AAAAAACAGCTAATGCTGCTGGG + Intergenic
1135838107 16:25846371-25846393 AAAAAATAAAAAATGTAGCTGGG + Intronic
1135907397 16:26525494-26525516 CCAAAATTACAGATGCAGCTGGG + Intergenic
1136018318 16:27421348-27421370 AAAAAAAAAAAGAGCCAGCTGGG + Intronic
1136177062 16:28524396-28524418 AAAAAATAAGAAATCCAGCTGGG + Intergenic
1136333546 16:29596741-29596763 AAAAAAAAAGAGAATCAGCTGGG + Intergenic
1136349154 16:29695784-29695806 AAAAAAAAAAAAAGGCAGCTGGG - Intronic
1136533360 16:30884479-30884501 AAAAAAAAACAAATGGAGATAGG - Intronic
1136592838 16:31227934-31227956 ATAAAATAAAAGATGAAGCTGGG - Intergenic
1137032647 16:35538318-35538340 AAAGAAAAACAGATGAGGCTGGG + Intergenic
1137294488 16:47077333-47077355 AAAAAAAAAAAAATTCAGCTGGG + Intergenic
1137736835 16:50731017-50731039 AAAAAATAAAAAATTCAGCTGGG + Intronic
1138225199 16:55288762-55288784 AAATAAAAACATATGCAGGTCGG + Intergenic
1138283665 16:55791783-55791805 CAATAACAACGGCTGCAGCTGGG - Intergenic
1138285337 16:55805204-55805226 CAATAACAACGGCTGCAGCTGGG + Intronic
1138306831 16:55984957-55984979 AAAAAATAACAGATGCGGCTGGG - Intergenic
1138330071 16:56206335-56206357 AAAAAAAAAAAGAGGCAGTTAGG + Intronic
1138359743 16:56418002-56418024 AAAACACAACAAATGTAGCCAGG + Intronic
1138523323 16:57585983-57586005 AAAAAATAAAAGATTTAGCTGGG - Intronic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1138953506 16:61942774-61942796 GAAAAACACCAGTTCCAGCTGGG + Intronic
1139376816 16:66504327-66504349 AAAAAACAAATGATGCTGCCAGG + Intronic
1139535160 16:67567749-67567771 AAAAAATAAAAGAATCAGCTGGG - Intronic
1139730131 16:68936711-68936733 TGAAAACAACAGATGCATTTTGG + Intronic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1139874291 16:70133103-70133125 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
1139910166 16:70392775-70392797 CAAAAACAACAGATGGCACTGGG - Intronic
1140019410 16:71223818-71223840 AAAAAACAATAGATGTTGGTTGG + Intronic
1140212381 16:72980608-72980630 AAAAAAAAACAAAAACAGCTGGG + Intronic
1140344376 16:74198370-74198392 AAAAAATATCACAGGCAGCTGGG + Intergenic
1140361487 16:74348039-74348061 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1140425690 16:74859432-74859454 AAAAAAAAAAAAATACAGCTGGG - Intergenic
1140769549 16:78190891-78190913 AAAAAACAACAAATGGGGATTGG - Intronic
1140852390 16:78947348-78947370 GAAAAATAACAAATGCAGCTAGG - Intronic
1141052941 16:80789115-80789137 AAAAAACAACAGAGTTGGCTTGG + Intronic
1141452159 16:84111903-84111925 AAAAAAAAAAAAATGCAGCTGGG + Intronic
1141522320 16:84589269-84589291 TAAAAACAATAGACTCAGCTGGG - Intronic
1141848044 16:86624364-86624386 ATAAAGAAAAAGATGCAGCTAGG - Intergenic
1142541264 17:661224-661246 GAAAAAAAAAAGTTGCAGCTGGG + Intronic
1142814631 17:2415464-2415486 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
1143078243 17:4363967-4363989 AAAAAAAAAAAGATGCAGACGGG + Intronic
1143311924 17:5999148-5999170 AAAAAAAAAAAAATTCAGCTGGG + Intronic
1143440263 17:6966327-6966349 AAAAAACAAGGGATGCAGGGAGG + Intronic
1143525991 17:7472942-7472964 AAAAAAAAAGAGAAGCAGTTGGG - Intronic
1143546827 17:7601928-7601950 AAAAAAAAAGAAATGAAGCTAGG + Intronic
1143741339 17:8956216-8956238 AAAAAAAAAAAGATGCAGGTTGG + Intronic
1143956017 17:10669748-10669770 AAAAAACAAAAAAATCAGCTGGG + Intergenic
1144410499 17:14995992-14996014 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
1145228516 17:21152136-21152158 AAAAAACAACACCCGAAGCTAGG - Intronic
1145278241 17:21449091-21449113 AAAAATCAACAGTATCAGCTAGG - Intergenic
1145316062 17:21734990-21735012 AAAAATCAACAGCATCAGCTAGG - Intergenic
1146334453 17:31957223-31957245 AAAAAACAAAAAATGTAGCCAGG - Intronic
1146363163 17:32196170-32196192 AAAAAAAAAAAGCAGCAGCTTGG - Intronic
1146527484 17:33579292-33579314 AAAAAAAAAAAAATGCAGGTGGG + Intronic
1146857587 17:36266536-36266558 AAAAAAGAACAGATATGGCTTGG - Intronic
1147076380 17:37991072-37991094 AAAAAAGAACAGATATGGCTTGG - Intronic
1147077423 17:38001987-38002009 AAAAAAGAACAGATATGGCTTGG + Intronic
1147087905 17:38070617-38070639 AAAAAAGAACAGATATGGCTTGG - Intergenic
1147109305 17:38249896-38249918 AAAAAAGAACAGATATGGCTTGG + Intergenic
1147257357 17:39189814-39189836 AAAAAATAAAAGGGGCAGCTGGG + Intronic
1147371517 17:39996125-39996147 AAAAAAAAAAAGAAGAAGCTGGG + Intronic
1147404129 17:40198825-40198847 AAAAAATAAAAAATGTAGCTGGG + Intergenic
1147748962 17:42715645-42715667 AAAAAACAACAGATGAATCCAGG + Intronic
1147851886 17:43450099-43450121 AAAAACCCACAGCTGCTGCTAGG - Intergenic
1147895960 17:43751547-43751569 AACAAACAACAGACCTAGCTGGG - Intergenic
1148061129 17:44837195-44837217 AAAAAAAAAAAGATGTAGCTGGG + Intergenic
1148100668 17:45088770-45088792 AAAAAAAAAAAGAGGCAGCTTGG + Intronic
1148420145 17:47538186-47538208 AAAAAAGAACAGATATGGCTAGG - Intronic
1148566579 17:48636518-48636540 AAAAAAAAAAAAATCCAGCTGGG - Intergenic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1148879465 17:50714625-50714647 AAAAAACAAAAAAAACAGCTGGG + Intergenic
1149097483 17:52861026-52861048 AAAAAAAAACACATGCAGAGTGG + Intergenic
1149144021 17:53468034-53468056 AAAAAAAAAAAAAGGCAGCTTGG + Intergenic
1149202788 17:54207420-54207442 AAAAAATAACAGATGCGGCTGGG + Intergenic
1149236491 17:54596415-54596437 AAAAAACAACAGATTTATATGGG + Intergenic
1149322309 17:55493827-55493849 AAAAAAAAGCAGCAGCAGCTTGG + Intergenic
1149579993 17:57743035-57743057 AAAGAACAAAAAAAGCAGCTGGG + Intergenic
1149694074 17:58602650-58602672 AAAAGAAATCAGATGAAGCTGGG + Intronic
1149904803 17:60515867-60515889 AAGGAACATCAGATGAAGCTGGG + Intronic
1150149389 17:62796830-62796852 AAAATACAAAAAATGTAGCTGGG + Intronic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1150342502 17:64379862-64379884 AAAATACAAAAGAATCAGCTGGG + Intronic
1150509920 17:65739817-65739839 AAGAAACAACAGATGAAGTAAGG - Intronic
1150582511 17:66487669-66487691 AAAAAAGAACAGATACTGGTGGG - Intronic
1150679921 17:67276462-67276484 AAAAAAAAAAAAGTGCAGCTGGG - Intergenic
1150931033 17:69585665-69585687 AAAAAACAACAGATGCTGGTAGG + Intergenic
1151098119 17:71522611-71522633 AAAGAACAATAGATGCTGATGGG + Intergenic
1151191108 17:72398799-72398821 AAAAAAAAAAAGATGCATCCTGG + Intergenic
1151454989 17:74220779-74220801 AAAAAAAAAAAGTGGCAGCTGGG - Intronic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1151647881 17:75446038-75446060 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1151717991 17:75841122-75841144 AAAAAAAAAGGGATGCGGCTGGG - Intronic
1151907578 17:77058837-77058859 TAAAAACAATAGAAACAGCTGGG + Intergenic
1152063205 17:78094733-78094755 AAAGAACCACAGAAGCAGCCAGG - Intronic
1152113303 17:78369376-78369398 AAAAAAAAAAAGATGCAGAGTGG + Intergenic
1152734039 17:81988163-81988185 AAGAAACAACAGAAGTGGCTGGG + Intronic
1153261864 18:3231835-3231857 AAAAAAAAAAGGATGCGGCTGGG - Intergenic
1153281238 18:3416222-3416244 AAAGAAAAACATTTGCAGCTGGG + Intronic
1155014823 18:21823238-21823260 AAAAAAAAAAAGAATCAGCTGGG + Intronic
1155423012 18:25675964-25675986 CAACAACAACAGATTCAACTAGG + Intergenic
1155816882 18:30323362-30323384 AAGTAGCTACAGATGCAGCTAGG - Intergenic
1155976526 18:32137823-32137845 AGGAAACAACAGATACAGATGGG - Intronic
1156290289 18:35743186-35743208 AAAAAACAATAGATGCTGGCAGG + Intergenic
1157055161 18:44219418-44219440 AAAAAATAACAGATGCTGCAAGG + Intergenic
1157231910 18:45925173-45925195 ACAAAACAACAGATACAGCCAGG + Intronic
1158356560 18:56626971-56626993 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1158494745 18:57944424-57944446 AAAAAATAACATTTGCAGCTGGG - Intergenic
1158529217 18:58243044-58243066 AATAATCGACACATGCAGCTGGG - Intronic
1159380160 18:67645986-67646008 AAAAAATAACAGATGCTGCAAGG + Intergenic
1159842158 18:73411889-73411911 AAAAAATAGCAGATGCCGGTAGG + Intergenic
1159905876 18:74091796-74091818 AAAAAACATTAAAGGCAGCTGGG - Intronic
1160221313 18:76979962-76979984 AAAAAAAAACAAAGGAAGCTTGG + Intronic
1160590134 18:79939717-79939739 AAAAAATAACAGATGCTGGTGGG + Intronic
1160931440 19:1571922-1571944 AAAAAACATCAGATGCAGAGTGG - Intergenic
1161533616 19:4805022-4805044 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
1161536054 19:4819111-4819133 AAAAAACAAAAAAAGTAGCTGGG + Intronic
1161704573 19:5813236-5813258 AAAAAAAAACAGATGGAGGCTGG + Intergenic
1161742197 19:6028709-6028731 AAAAAAAAAAAGATGAAACTTGG + Intronic
1161866842 19:6839194-6839216 ACAAAAAAACAGCTGCGGCTGGG - Intronic
1161951039 19:7468254-7468276 AAAAAAAAAAAAATGAAGCTGGG + Intronic
1161993698 19:7699464-7699486 AAAAAAAAACGGCTTCAGCTAGG - Intronic
1162213912 19:9116317-9116339 AAAAAAAAAAAGATGAGGCTGGG - Intergenic
1162669126 19:12239559-12239581 AAAAAAAAAAAAATGCAACTTGG - Intronic
1162882097 19:13667334-13667356 AAAAAAAAAAAAATGCTGCTGGG + Intergenic
1163108541 19:15142270-15142292 AAAATACAAAAAATGTAGCTGGG + Intergenic
1163578835 19:18126059-18126081 AAAAAAAAAAAGATGTAGCTGGG + Intronic
1163958792 19:20667763-20667785 TAAAAAAAACCGATGCAGCTGGG - Intronic
1164275483 19:23713773-23713795 AAAAAAAACCACAGGCAGCTTGG + Intergenic
1164990803 19:32681861-32681883 AAAAAAAAAAAAAAGCAGCTAGG - Intergenic
1165052295 19:33149646-33149668 AAAAAAAAAAAGATACAGGTAGG - Intronic
1165109811 19:33495687-33495709 AAAAAACAAAAGGCTCAGCTGGG + Intronic
1165214698 19:34262276-34262298 AAAAAAAAAAAGCAGCAGCTGGG - Intronic
1165323278 19:35099400-35099422 AAAAAAGAACAGTGGCAGTTTGG + Intergenic
1165807772 19:38591974-38591996 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1166066803 19:40364801-40364823 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1166181036 19:41109059-41109081 AAAAAACAAAAAAAGTAGCTGGG + Intergenic
1166382068 19:42360329-42360351 AAAAAACAGCAGAAGCAGAGAGG - Intronic
1166446151 19:42858488-42858510 ATAAAACAACAGCTCCAGCAGGG - Intronic
1166530261 19:43538386-43538408 AACATATAACAGATGCAGCTGGG - Intergenic
1166549225 19:43654127-43654149 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1166600228 19:44087578-44087600 AAAAAAAAGCAGAAGCAGCATGG - Exonic
1167010127 19:46801728-46801750 AAAAAAAAAAAGAAGAAGCTGGG - Intergenic
1167025771 19:46916714-46916736 AAAAAAAAATAGATGAATCTGGG - Intergenic
1167106170 19:47431017-47431039 AACAAACAAAAAATACAGCTAGG - Intronic
1167130834 19:47584568-47584590 AAAAAAAAAAAGATGTGGCTGGG + Intergenic
1167273513 19:48520532-48520554 AAAAAAAAAAAAAAGCAGCTTGG - Intergenic
1167451079 19:49569837-49569859 AAAAAAGAACACTTGCAGGTGGG + Intronic
1167824427 19:51959397-51959419 AACATAGAAAAGATGCAGCTGGG + Intergenic
1168298952 19:55392526-55392548 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1168542358 19:57223656-57223678 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
925320665 2:2964789-2964811 AAAAAGCAATAGATGCTGGTAGG + Intergenic
926072178 2:9906170-9906192 AAAATATAACTGATGCAGCCTGG + Intronic
926764877 2:16315406-16315428 AAGAATCAACAGCAGCAGCTTGG + Intergenic
926815957 2:16797768-16797790 AGAAAACAACTGATACAGTTTGG - Intergenic
926897132 2:17704959-17704981 AAAAAAAAAAAATTGCAGCTGGG + Intronic
927247253 2:20967350-20967372 AACAAACCACAGGTGGAGCTGGG - Intergenic
928112275 2:28520221-28520243 AAAAAAAAAAAGATTCGGCTGGG - Intronic
928553173 2:32394671-32394693 AAAAAATAACAGAATTAGCTGGG + Intronic
928577215 2:32667709-32667731 AAAAAACAACAAACACAGCCAGG - Intronic
928588340 2:32786280-32786302 AACAAACAAAAAAAGCAGCTGGG - Intronic
928620203 2:33081275-33081297 AAAAAACAGCAGAAGCAGGAAGG - Intronic
928774532 2:34744055-34744077 AAAAAAAAAAAGAGTCAGCTGGG + Intergenic
929021803 2:37560698-37560720 AAGAAACAGCACATTCAGCTGGG - Intergenic
929476984 2:42260459-42260481 AAAAAATCACAGAGGCGGCTGGG - Intronic
929639711 2:43565439-43565461 AAAAAAAAAAAGATGAATCTAGG + Intronic
929943015 2:46349165-46349187 AAAGGTCAACAGAAGCAGCTGGG + Intronic
930376327 2:50571828-50571850 AAAAACAAAAAGAGGCAGCTGGG + Intronic
930647739 2:53929584-53929606 AAAAAAAAAAATAAGCAGCTAGG - Intronic
930756661 2:54981173-54981195 TAAAAATAAGAGATGCGGCTGGG + Intronic
930935589 2:56947036-56947058 AAAAAATAACAGAACCATCTAGG - Intergenic
931143855 2:59494406-59494428 TAAAAACAACAGATGCTGGTGGG - Intergenic
931397035 2:61896716-61896738 AAAAAACAGCAGATGCATAAAGG + Intronic
931538532 2:63303978-63304000 AAAAAAAAACAGATGTAGGCAGG + Intronic
931561105 2:63561862-63561884 AAGAAACAACAGATGCTGGCGGG + Intronic
931787448 2:65632871-65632893 AAGAAATTACAAATGCAGCTAGG - Intergenic
932206730 2:69889966-69889988 AAAAAAAAAAAGATACAGATGGG - Intergenic
932527263 2:72484404-72484426 AAAAAAAAAAAAATTCAGCTGGG + Intronic
932547492 2:72729582-72729604 AAAAAACAAAAAAAGGAGCTGGG - Intronic
932766100 2:74471168-74471190 AAAAAAAAAAAGATGGAACTGGG + Intergenic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
933027770 2:77283317-77283339 AAAAAACAAGAGATTCTGGTGGG + Intronic
933168937 2:79103904-79103926 AACAAATAACAAATGCAGCAAGG + Intergenic
933227851 2:79771719-79771741 AAATAAATACAGATGAAGCTTGG + Intronic
933263609 2:80156905-80156927 ATAAAACATCAGATGTTGCTTGG - Intronic
933324205 2:80815192-80815214 AAAAAACACCACCTGCAACTCGG - Intergenic
933471673 2:82733750-82733772 AGAATAGAACAGATGAAGCTTGG - Intergenic
933660513 2:84923965-84923987 AAAAAAAAAAAAAAGCAGCTGGG + Intergenic
933757655 2:85652647-85652669 AAAAAAAAAAAGATACATCTGGG + Intergenic
934969449 2:98751074-98751096 AAAAAACAACAGATACCCATTGG - Intergenic
935007546 2:99094745-99094767 AAAAACCAACAGATGTTGGTGGG + Intronic
935166512 2:100573680-100573702 AAAAAAAAAGATATTCAGCTGGG + Intronic
935689227 2:105715387-105715409 AAAAAAAAAAAAATGCAGCATGG + Intergenic
935878722 2:107539557-107539579 AAAAAAAAAGAGGTGAAGCTAGG + Intergenic
936791284 2:116156313-116156335 AAAAAATTACAGATGCTGCAAGG - Intergenic
936818261 2:116486636-116486658 AAAAAATAACAGATACTGTTAGG + Intergenic
936822566 2:116541264-116541286 AAAAAACTACACATGAATCTGGG - Intergenic
937424553 2:121787966-121787988 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
937837961 2:126492999-126493021 AAAACACAAAAAATGTAGCTGGG + Intergenic
938476681 2:131621764-131621786 AAAAAACAACAGATGTTGGGTGG - Intergenic
938866654 2:135428876-135428898 AAAGAATAACAGATGCTGGTGGG + Intronic
939505725 2:143044481-143044503 AAGAAACAACAGATGCTGAGAGG - Exonic
939800241 2:146699097-146699119 AAAAAAGAACAGAACCAGCCTGG + Intergenic
939903925 2:147886760-147886782 AAAAAAAAAAAGATGCCACTAGG - Intronic
940004102 2:148995859-148995881 AAAAATGAATGGATGCAGCTGGG + Intronic
940184519 2:150968710-150968732 AGAAAACAACAGAGGCAGAAAGG + Intergenic
940235513 2:151507375-151507397 AAAAAACAGCAGAAGCAGGAGGG + Intronic
940366545 2:152854370-152854392 AAAAAATAACAGATGCTGGCAGG - Intergenic
940442258 2:153730882-153730904 AAAAGACAACAGATGTTGATGGG + Intergenic
940539778 2:154997611-154997633 AAACAAAAACATAAGCAGCTTGG - Intergenic
941124998 2:161574157-161574179 AAAAAACAACAGATGCTAGCAGG - Intronic
941163525 2:162061200-162061222 AAGAAACTGAAGATGCAGCTGGG - Intronic
941268941 2:163401077-163401099 ACAAAATAACAGATGAAGGTGGG + Intergenic
941351707 2:164445634-164445656 ATAAAGCAACAGGTGCAGCTTGG + Intergenic
941513779 2:166446362-166446384 AGGAAACAACAGATGCAGGCAGG + Intronic
941527492 2:166624199-166624221 AAAAAATAACAGATGCTGTGAGG - Intergenic
941607427 2:167617122-167617144 AAAAAACAACATATGGAGGGTGG - Intergenic
941724331 2:168844878-168844900 AAAAAAAAAAAGATTCAGCCTGG + Intronic
941984108 2:171492473-171492495 AAAAAAAAAAAGATGGAGCACGG + Intergenic
942478215 2:176352367-176352389 AAAAAACAATAGATGTTGGTGGG - Intergenic
942587294 2:177495610-177495632 AAAAAACCACAATAGCAGCTGGG + Intronic
942588174 2:177509671-177509693 AAAAAAAAAAAGAAGCAGTTTGG + Intronic
942594789 2:177582747-177582769 AAAAAAAAAAAAAAGCAGCTAGG + Intergenic
942746461 2:179239646-179239668 GGTAAACAACATATGCAGCTAGG + Intronic
942795340 2:179812132-179812154 AAAAACCAACAGGTGCAGGCGGG + Intronic
943165919 2:184325872-184325894 AAAAAACAAGAGATGCTAGTGGG + Intergenic
943185960 2:184607923-184607945 AAAAAAAAAGAGATGCATCAAGG - Intronic
943191840 2:184686693-184686715 CAAAAACAACAGATGCTGTCAGG - Intronic
943198481 2:184787505-184787527 AAAAAACAACCGATGTTGGTGGG - Intronic
943479703 2:188403291-188403313 AAAAAACAAGAGATTTACCTTGG - Intronic
943510746 2:188824006-188824028 AAAAAATAACAAATGAAGCCAGG - Intergenic
944099410 2:196006568-196006590 AAAAAAAAACATATCCAGATAGG + Intronic
944224387 2:197335436-197335458 AAAAAAAAAAAGATGCAGTAGGG - Intergenic
944579609 2:201120179-201120201 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944639351 2:201707424-201707446 AAAAAAAAAAAAATGTAGCTGGG - Intronic
944732540 2:202531921-202531943 AAAAAAAAAAAAATACAGCTGGG - Intronic
944889992 2:204107623-204107645 AAAAAAAAAAAGATGTACCTAGG - Intergenic
944890097 2:204108723-204108745 AAAAATCAGCAGTGGCAGCTGGG - Intergenic
944996983 2:205304638-205304660 AAAAAAAAAAAAATTCAGCTAGG + Intronic
945000566 2:205345873-205345895 TAAAAAAAGAAGATGCAGCTGGG + Intronic
945005388 2:205399648-205399670 TAAAAAAAGAAGATGCAGCTGGG - Intronic
945193194 2:207211769-207211791 AAACAAAAACAGATGCTGCGAGG + Intergenic
945216688 2:207441860-207441882 AGAAAACAACAGAAGCAGGAAGG + Intergenic
945228581 2:207559086-207559108 AGAAAACAACAGAGGCAGGTGGG - Intronic
945841165 2:214889750-214889772 AAAAAAAAAAAAATCCAGCTGGG + Intergenic
945991144 2:216396318-216396340 AAAAAAATAAAGATGTAGCTGGG + Intergenic
945991194 2:216396629-216396651 AAAAAAAAAAAAATGTAGCTGGG + Intergenic
946019137 2:216627970-216627992 AAAAAACAACAGATGTTGGCAGG - Intergenic
946315381 2:218907971-218907993 AAAATACAAAAAATGTAGCTGGG + Intergenic
946509334 2:220337331-220337353 AAAAAAAAACAAATCCTGCTGGG + Intergenic
946878366 2:224152862-224152884 AAAAAATAACAGATGCTGGTGGG - Intergenic
947399874 2:229720850-229720872 CAAAAACAATTGATGCAGCCAGG + Intergenic
948093946 2:235318669-235318691 AAAAAAAAAAAAATGTAGCTAGG + Intergenic
948222681 2:236285507-236285529 ACAAAACAACACCTGCAACTGGG - Intergenic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948327158 2:237133798-237133820 AAAAAAAAAAAGAGGAAGCTAGG - Intergenic
948410056 2:237752406-237752428 AAAAAAGAAAAAATGCTGCTGGG + Intronic
948937488 2:241176933-241176955 TAAAAATACCACATGCAGCTGGG + Intronic
1169089621 20:2850809-2850831 AAAAAACAAAAAAAACAGCTGGG + Intronic
1169286825 20:4315350-4315372 AAAAAAGAGCAAATGCAACTGGG + Intergenic
1169418449 20:5438713-5438735 GAAAAATAGCTGATGCAGCTGGG - Intergenic
1169567204 20:6868240-6868262 GAAAAACAACTCATGTAGCTTGG - Intergenic
1170157041 20:13278449-13278471 AAAAGACCACAGGTGCAGGTGGG - Intronic
1172170007 20:32924357-32924379 TAAAAACAACACATGTAGCTGGG - Intronic
1172343572 20:34178930-34178952 ATAAAATAACAGAAGCGGCTGGG + Intergenic
1172649846 20:36495150-36495172 TAAAAATAAAACATGCAGCTGGG - Intronic
1172721516 20:37002323-37002345 AAAAAAAAACAGATAAGGCTAGG - Intronic
1172907784 20:38381815-38381837 AAGAAAGAAGAAATGCAGCTGGG - Intergenic
1173319676 20:41976124-41976146 AAAAAAAAACAGATGATGTTAGG - Intergenic
1173552523 20:43942718-43942740 AAAAAAGAAAACAAGCAGCTTGG + Intronic
1173874385 20:46360842-46360864 AAAAATCAACAAATGCAGCCGGG - Intronic
1174522322 20:51141297-51141319 AAAAGTCAACAGATTCAGCAGGG - Intergenic
1174843511 20:53921508-53921530 AAGCAACAACAGCTGGAGCTGGG + Intergenic
1175051835 20:56162645-56162667 AAAAAAAAAGAGCTACAGCTTGG - Intergenic
1175358324 20:58387077-58387099 AAAAAAAAAAAGATACAGCATGG + Intergenic
1175559569 20:59909461-59909483 AAAAAACACTAGAGGCAGTTAGG - Intronic
1176186546 20:63783132-63783154 AAAAAACAAAAAACACAGCTGGG + Intronic
1176187878 20:63791333-63791355 AAAATACAAAAAAAGCAGCTGGG + Intronic
1176651603 21:9553312-9553334 AAAAAACAAAAAAAGTAGCTGGG - Intergenic
1176724058 21:10415183-10415205 TAAAAAGAAGAGTTGCAGCTGGG - Intergenic
1176733047 21:10519470-10519492 AAAAAACAAAAAAATCAGCTGGG - Intergenic
1176910401 21:14558380-14558402 AAAAAAAAACACTTTCAGCTGGG + Intronic
1177286848 21:19062685-19062707 GAAAAACAACAGATGCAAGAAGG + Intergenic
1177489031 21:21797417-21797439 AGAAAACAACAGAAGCAGCATGG - Intergenic
1177649764 21:23945641-23945663 AAAAAATAACAGTTGGAGCACGG + Intergenic
1178137115 21:29640163-29640185 AAAAAAAAAAAGAAGCAGCGGGG + Intronic
1178359851 21:31939701-31939723 AAAAAACAACACATGAGGCCGGG - Intronic
1178702150 21:34842771-34842793 AAAAACATACAGATGCAGCTGGG + Intronic
1178802436 21:35808597-35808619 GAAAAATAACAGATGCAGGGAGG + Intronic
1179434267 21:41349625-41349647 GACAAGCAACAGAAGCAGCTCGG + Intronic
1179794465 21:43774926-43774948 AGAAAAAAACAGTTCCAGCTGGG + Intronic
1180853251 22:19031985-19032007 AAAAAAAAAAAGAGGCTGCTGGG + Intergenic
1181679990 22:24488236-24488258 AAGAAACAACAGATTCAGGTTGG + Intergenic
1181682577 22:24506012-24506034 AAAAAAAAAAAAATGCAGTTAGG - Intronic
1181739281 22:24907506-24907528 AACAAAAAACAAAGGCAGCTGGG - Intronic
1181748621 22:24973372-24973394 AAAAACCATCATATGCAGTTTGG - Intronic
1181817628 22:25450577-25450599 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1182283143 22:29229346-29229368 AAAAAAAAGAAGATGCCGCTGGG + Intronic
1182298462 22:29324765-29324787 AAAAAAAAAAAAAGGCAGCTGGG + Intergenic
1182395740 22:30034492-30034514 AAAATACAAAAGCTGTAGCTAGG + Intergenic
1183283309 22:36945810-36945832 AAAAAAAAAAAGATACAGTTTGG - Intergenic
1184525911 22:45022503-45022525 AAGAAACAACAGATGTGGCTGGG - Intergenic
1184530875 22:45054865-45054887 AAAAAAAAACAGAGGAAGCCGGG + Intergenic
1184795045 22:46727438-46727460 AAAAAAAAAAAGAAACAGCTGGG - Intronic
1185118463 22:48951519-48951541 AAAAAAAAACAAATGTAGCCAGG + Intergenic
1185407199 22:50659632-50659654 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
949393753 3:3592565-3592587 AAAAAATAACAGATGCAGTGAGG + Intergenic
949446240 3:4136964-4136986 AAGAAACAACAGATGCCGGAGGG + Intronic
949876472 3:8629152-8629174 TTAAAACAACAGACACAGCTGGG - Intronic
950213916 3:11144042-11144064 AAAAACCAACAGATGATGGTAGG + Intronic
950587648 3:13906720-13906742 AAAAAACAACAGATGTTGCGAGG + Intergenic
951205238 3:19919356-19919378 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
952283014 3:31941471-31941493 AAATTCCAACAGAAGCAGCTAGG + Intronic
952318293 3:32251607-32251629 AAAAAGTAACAGATGTGGCTGGG - Intronic
952672744 3:35990680-35990702 AAAAAACAACAGAATTAGCCTGG - Intergenic
953950581 3:47186615-47186637 AAAAAACATCAGATGGATCCTGG - Intergenic
953999914 3:47548225-47548247 AAAAACCAAAAAATGTAGCTGGG + Intergenic
954032333 3:47828474-47828496 AAAAAAAAAAAGATGAGGCTGGG + Intronic
954069455 3:48132149-48132171 AAAAAACAACACCTGCACTTTGG - Intergenic
954337655 3:49929273-49929295 AAAAAGCAACAGAGGTAACTGGG - Intronic
954562501 3:51569991-51570013 AAAAAACTACAAAATCAGCTGGG - Intronic
954977354 3:54709000-54709022 AAAAAAAAAAAGATGAAGATGGG - Intronic
955161743 3:56470032-56470054 AAAACACAATAGGTGGAGCTTGG - Intergenic
955242525 3:57191219-57191241 AAAAAACAAAAAATCCTGCTGGG + Intergenic
955342312 3:58134544-58134566 AAGAAAAGTCAGATGCAGCTGGG + Intronic
955674860 3:61437411-61437433 AAAAAATAACAGATGCTGGAGGG - Intergenic
955997909 3:64696579-64696601 AAAAAAAAAAAGAAGCAGCCAGG + Intergenic
956291714 3:67667583-67667605 AAAAAAAAAAAGATGAAGATGGG + Intergenic
956413061 3:68998535-68998557 AAAAAACAACTGATCAAGCTAGG - Intronic
956477814 3:69641872-69641894 AAAAAATAACAAATGCTGCAAGG + Intergenic
956599946 3:71009907-71009929 AAAAAAAAAAAAATTCAGCTGGG - Intronic
956642311 3:71426765-71426787 TTAAAACATCAGATGCAGCCAGG + Intronic
956694715 3:71908414-71908436 AAAAAAAAAAAAGTGCAGCTGGG - Intergenic
956699814 3:71948964-71948986 AAAAAAAAAAAGAATCAGCTGGG - Intergenic
956727913 3:72171761-72171783 AAAAAAAAAAAAATGCTGCTTGG + Intergenic
957416250 3:79909297-79909319 AAAAAGACACAGATGTAGCTAGG + Intergenic
957622471 3:82611750-82611772 AGGAAACAACAGATGCTGGTGGG - Intergenic
957656455 3:83083921-83083943 AAAAAATAACAGATGTTGGTAGG - Intergenic
957690117 3:83556085-83556107 AAAAAAAAAAAGAAGCAGTTTGG + Intergenic
957747203 3:84361187-84361209 AAAAAACAAGCGATGCAGAAAGG - Intergenic
958090243 3:88868360-88868382 AAAAAACAAAAGAAGAAGCCAGG + Intergenic
958458701 3:94366354-94366376 AAGAAACAACAGATGCTGGCAGG - Intergenic
958465174 3:94448564-94448586 AAAAAATAGCAGATGCTGGTGGG + Intergenic
958843314 3:99235127-99235149 AGAAAATAACAGATGCTGGTGGG - Intergenic
959088946 3:101881681-101881703 AAAAAACAAAACATTCGGCTGGG - Intergenic
959254491 3:103991919-103991941 AGAAAACCACAGATGCCGCTGGG - Intergenic
959269858 3:104193094-104193116 AACAAACCACAGTTGAAGCTTGG + Intergenic
959450153 3:106488622-106488644 AAAAAAAAACAGATGCAAACGGG - Intergenic
959735784 3:109656223-109656245 AAAGAATAACAGAGGCATCTAGG - Intergenic
959974382 3:112442034-112442056 AAAAAACAACAGATGTTGGTGGG + Intergenic
959993706 3:112657336-112657358 AGAAAACAGCAGATGCTGGTGGG - Intergenic
960081722 3:113548555-113548577 GAAAAACAACAGATGCAAGAAGG + Intronic
960112302 3:113856832-113856854 AAAAAAAAAAATAGGCAGCTGGG - Intronic
960112468 3:113858385-113858407 AAAAAAAAAAAAATGTAGCTGGG - Intronic
960120287 3:113942207-113942229 AAAAAAAAAAAATTGCAGCTGGG - Intronic
960514572 3:118589529-118589551 AAAAAAAAAAAAAAGCAGCTTGG + Intergenic
960782635 3:121336600-121336622 AAAAAATAACAGATGCTGCAAGG + Intronic
960917184 3:122707635-122707657 AAAAAACAAAAAACGTAGCTGGG + Intronic
961689748 3:128660431-128660453 AAAAAACAAAAGATGTACATTGG + Intronic
961700590 3:128741677-128741699 AAAAAACAAAAGACACAGCCAGG - Intronic
961865791 3:129952695-129952717 AAGATATAACAGAAGCAGCTGGG - Intergenic
962333243 3:134499809-134499831 AAAAAAAAAAAGATGAAGATGGG - Intronic
962478276 3:135776861-135776883 AAAAAATAACAGATGTTGGTGGG + Intergenic
962529990 3:136270479-136270501 AAAAAACAACAGATGTGGCCGGG - Intronic
962542303 3:136394949-136394971 AAAAAAAAAAAAATGTAGCTAGG + Intronic
962586864 3:136850696-136850718 AAAAAAAAAATAATGCAGCTGGG + Intronic
962989892 3:140568398-140568420 GAAAAACACCAGAAGAAGCTGGG + Exonic
963513644 3:146280090-146280112 AAAAAACAAAAAAAGCAGCGAGG - Intergenic
963658335 3:148089224-148089246 AAAAAAAAAAAAGTGCAGCTAGG - Intergenic
964353658 3:155828883-155828905 AAAAAAAAACATATTCGGCTGGG - Intronic
964480789 3:157136498-157136520 GAAAAACAAGAGATCCACCTAGG + Intergenic
964535853 3:157720219-157720241 AAAAAAAAACAGATGCTTGTGGG - Intergenic
964589566 3:158345065-158345087 AAAAAAAAAAAAATGTAGCTGGG + Intronic
964775839 3:160276026-160276048 AAAATACAAAAAAAGCAGCTGGG - Intronic
964838715 3:160970436-160970458 AAAAAAAAAAATATTCAGCTTGG - Intronic
965350432 3:167605487-167605509 GAAAAAAAACAGATGCAGTCTGG + Intronic
965493772 3:169372680-169372702 AGACAACAGCAGAAGCAGCTTGG - Intronic
965554023 3:170001348-170001370 AACAAACAACATATGCAGCCGGG + Intergenic
965597846 3:170425524-170425546 AAAGAAAAACAAATTCAGCTAGG - Intronic
966010344 3:175067584-175067606 AAAAAATAACAGATGCTGCAGGG + Intronic
966142942 3:176776873-176776895 AAGAGAGAACAGATGTAGCTGGG - Intergenic
966181411 3:177192100-177192122 AAAAAAAAAGAGTTGAAGCTGGG + Intronic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
966721884 3:183071860-183071882 AAAAAAAAAAAAATTCAGCTGGG - Intronic
966793685 3:183695197-183695219 TAAAAACATCACTTGCAGCTGGG - Intergenic
967050106 3:185775027-185775049 AAAAAAAAAAAGAGGGAGCTGGG + Intronic
967227453 3:187305627-187305649 AAAAAAAAATAAATCCAGCTTGG + Intergenic
967310749 3:188103852-188103874 TTAAAACAACAAATGCAGCTGGG - Intergenic
967558592 3:190891013-190891035 AAGAAACAACTGATGTGGCTTGG - Intronic
967670831 3:192233202-192233224 AAAAAATAACAGATGCTGGTGGG - Intronic
968279886 3:197468439-197468461 AAGAAAATAAAGATGCAGCTGGG + Intergenic
968354394 3:198092861-198092883 AAAAAATAACAGCTGCTGGTGGG - Intergenic
968435371 4:583986-584008 AAAAAAAAAAGCATGCAGCTTGG - Intergenic
968638545 4:1696903-1696925 AAAAAAAAACAAACGCTGCTGGG + Intronic
968674128 4:1868260-1868282 AAAAAACTACAAAATCAGCTGGG - Intergenic
969139844 4:5059044-5059066 AAAAAAAAAAAAAAGCAGCTGGG - Intronic
969392320 4:6900191-6900213 AAAAAACCAAAAATGTAGCTGGG + Intergenic
969451990 4:7279262-7279284 GAAAAACATCAGATGGAGCTAGG + Intronic
969827112 4:9766365-9766387 AAAATACAAAAAATGCTGCTCGG + Intergenic
969851627 4:9962059-9962081 AAGAAACAACAGATGCTGATGGG + Intronic
969952177 4:10848798-10848820 AAAAAACAACAGATGCTGTCAGG - Intergenic
970048905 4:11888421-11888443 AAAAAACAACACATCCAGAAAGG + Intergenic
970277555 4:14418143-14418165 AGAACACAACACATGCAGCAGGG - Intergenic
970640593 4:18061459-18061481 AAAAAAAAAAAAAGGCAGCTAGG + Intergenic
970697796 4:18697942-18697964 AAAAAAAAACAGAAGCAGAAAGG - Intergenic
970763122 4:19515786-19515808 AAAGTAAAACAGATGCAGTTTGG - Intergenic
970780938 4:19736704-19736726 AAAAAATAAAAGATTTAGCTAGG + Intergenic
970871566 4:20822412-20822434 AAAAAACAATAGATGTTGGTTGG + Intronic
971228103 4:24773842-24773864 TAAAAAATACAGATACAGCTGGG + Intergenic
971798916 4:31262965-31262987 AAAAAATAGCAGATGCAGAATGG + Intergenic
972057243 4:34818719-34818741 AAAAAACAACAGATGCTGGTGGG + Intergenic
972167959 4:36310648-36310670 AAAAAAGAACCAATGAAGCTTGG - Intronic
972370831 4:38421787-38421809 ATAAAAGAACACATGAAGCTGGG + Intergenic
972601747 4:40579125-40579147 AAAAAAAAAAAAATGCAGCCAGG + Intronic
972894892 4:43607855-43607877 AAAAAACAGCAGATGTAACAAGG - Intergenic
973102364 4:46289047-46289069 AAAAAAAAACAGATGCTGGCAGG + Intronic
973238531 4:47932334-47932356 AAAAAAAAAAAAATGTAGCTAGG + Intronic
973284303 4:48398160-48398182 AAGAAACAACAGATGCTGGCTGG - Intronic
973341134 4:49005699-49005721 AAAAAACAACATAATCAGCCAGG - Intronic
973628476 4:52795891-52795913 AGAGAAAAACAGATTCAGCTGGG + Intergenic
973767358 4:54175249-54175271 AAAAAATAACAGATGCTGGCTGG + Intronic
973895931 4:55413138-55413160 AAAAAACAAAAAATTTAGCTGGG - Intronic
974158863 4:58110846-58110868 AAAAAACAACAGATACAAAAAGG - Intergenic
974199264 4:58617550-58617572 AGACAACAACAAATGCTGCTGGG - Intergenic
974454606 4:62110782-62110804 AAAAAGAAACAAATCCAGCTGGG - Intergenic
974570129 4:63635146-63635168 AAAAAATAACAGATGCGGTGAGG + Intergenic
975403829 4:73967466-73967488 AAAAAACCACAGATGTACTTAGG + Intergenic
975480750 4:74877396-74877418 AAAAAGCAACAGACGCTGGTGGG - Intergenic
975699956 4:77054833-77054855 TAAAACCTACAGATGTAGCTAGG + Intronic
976308332 4:83583685-83583707 AAAAAAAAAAAAATGAAGCTGGG + Intronic
976548421 4:86365000-86365022 AAAAAAGAACAGATACATATTGG + Intronic
976574872 4:86657641-86657663 AATAAACATCAGCAGCAGCTAGG - Intronic
976606215 4:86985513-86985535 AAAAAAAAAAAAATGTAGCTCGG + Intronic
976804734 4:89034415-89034437 AAAAAACAACAGATGTTGTCAGG + Intronic
976821376 4:89211085-89211107 AATAAACAACAGATGAGGCTGGG + Intergenic
977023323 4:91785004-91785026 AAATGACAACACATGCAGTTTGG + Intergenic
977460840 4:97322903-97322925 GAAAAACAGCAGATGCAACAAGG - Intronic
977594941 4:98868044-98868066 AAAAAACAAAAGCTTCATCTGGG + Intergenic
977611676 4:99040701-99040723 AAAAAAGAACAGATGAGCCTGGG - Intronic
977993587 4:103475547-103475569 AAAGAACAACAAATGTTGCTGGG - Intergenic
978112837 4:104983844-104983866 AAGAAACAACAGATGCTGACAGG + Intergenic
978119036 4:105056251-105056273 ACCAAACGGCAGATGCAGCTTGG - Intergenic
978685898 4:111442793-111442815 AAAAAACAACAGATGCTGGCAGG - Intergenic
978756016 4:112303704-112303726 AAAAAAAAAAAGATGTGGCTGGG - Intronic
978944330 4:114476756-114476778 AAAAAAAATCACATCCAGCTGGG - Intergenic
979353633 4:119675548-119675570 AAGAGGCAACAGAGGCAGCTGGG + Intergenic
979798652 4:124877846-124877868 AAAAAAGAACACAGGCAGCTGGG - Intergenic
980023349 4:127735441-127735463 AAAAAACAATATATGAAGATTGG - Intronic
980326021 4:131347507-131347529 CAAAAACAAAAAATGTAGCTTGG - Intergenic
981107850 4:140901778-140901800 AAGAAACACCAGATTCTGCTTGG + Intronic
981186451 4:141809235-141809257 AAAAACCAAGAGAGACAGCTGGG - Intergenic
981507544 4:145519389-145519411 AAAAAAAAAAAGGTTCAGCTGGG - Intronic
981735672 4:147947930-147947952 AAAAAAAAACAGTGGCAGGTAGG - Intronic
981738889 4:147982535-147982557 AAAAAAAAAAAGATTTAGCTGGG - Intronic
982457795 4:155630979-155631001 AAAAAAAAAAAGATGCTGCCTGG - Intergenic
982646607 4:158031844-158031866 AAAAAATAACAGATGCTGGTAGG + Intergenic
982659725 4:158192347-158192369 AAAAAACAACTGTGGCAGCCAGG - Intergenic
982726709 4:158913951-158913973 AATTAACAACAGATGGGGCTGGG + Intronic
982831315 4:160064209-160064231 AAAAAACAACAGATGTTGGCAGG - Intergenic
982993626 4:162312118-162312140 AAAAGAAAACAGATTTAGCTGGG + Intergenic
983372905 4:166885603-166885625 AAAAAGTAACAGGTGAAGCTGGG - Intronic
983419776 4:167502240-167502262 AAAAAATAACAGGTGCTGCATGG - Intergenic
984078182 4:175209106-175209128 AAGAAACAGCAGATGCAGGAAGG - Intergenic
984116044 4:175682677-175682699 AAAAGGCACCAGATACAGCTTGG + Intronic
984860202 4:184230830-184230852 AAAAAACAAAAGTCCCAGCTGGG + Intergenic
984968736 4:185167169-185167191 AAAAAACAACAGTTCAGGCTGGG + Intronic
984994649 4:185417746-185417768 AAAAATCAACAGAACCAGCCGGG + Intronic
985310135 4:188588724-188588746 AGAAAACAACAGAAGCAGGAAGG - Intergenic
985901977 5:2803587-2803609 AAACAACAACAAAACCAGCTTGG - Intergenic
986083417 5:4417659-4417681 AAAAAAAAGAATATGCAGCTTGG + Intergenic
986914970 5:12608311-12608333 AAGAAACAACAGATGCTGGCAGG - Intergenic
986971233 5:13339434-13339456 AAAAAAAAACAGATAAGGCTGGG - Intergenic
987175743 5:15306675-15306697 AAAAAACAACAGATGTTGGTGGG - Intergenic
987744848 5:21957563-21957585 AAAAAATAACAGATGCTGGCAGG - Intronic
987965113 5:24862812-24862834 AGAAAAAAGCAAATGCAGCTTGG + Intergenic
988076191 5:26358400-26358422 AAGAAACAACATATGCTGGTGGG - Intergenic
988387813 5:30589500-30589522 AACAAAGAACAGATGAATCTTGG - Intergenic
988402071 5:30775525-30775547 AAAAAAAAACTCCTGCAGCTAGG - Intergenic
988496082 5:31747462-31747484 AAAAAACAGCAGAAGCAGGGAGG - Intronic
988537891 5:32085245-32085267 AAAAAAAAAAAAAGGCAGCTGGG - Intronic
988746302 5:34142134-34142156 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
989227420 5:39046201-39046223 AAAAAAAAACAAAAACAGCTGGG + Intronic
989240182 5:39194603-39194625 AAAGACCAACGGATGCTGCTGGG + Intronic
989283986 5:39678116-39678138 AAAAAAAAACAGAAACAGCTGGG - Intergenic
989672161 5:43931421-43931443 AAGAAACAACAGATGCTGGCAGG - Intergenic
989693776 5:44175507-44175529 AAAAAATAACAGATGCTGGGAGG + Intergenic
989700066 5:44253093-44253115 AAAAAACAAGAGATTCTCCTTGG + Intergenic
989751728 5:44902905-44902927 AAAAAACAATTGTTGTAGCTAGG + Intergenic
990047262 5:51448350-51448372 AAAAATGAACAGATGAACCTTGG - Intergenic
990164368 5:52977982-52978004 AAAAAAAAACTCCTGCAGCTAGG + Intergenic
990247019 5:53873313-53873335 AAATAAAAACAGATGAGGCTGGG - Intergenic
990354215 5:54949912-54949934 AAAAAAAAAAAAATTCAGCTTGG + Intergenic
990384202 5:55243521-55243543 AAAAAAAAAAAGATTTAGCTGGG + Intergenic
990567760 5:57046962-57046984 AGAAAACAACAGAAGCAGGAAGG + Intergenic
990790851 5:59477541-59477563 AAAAAACAACAGATACTGGCAGG + Intronic
990934338 5:61131334-61131356 AAAAAACAACACAATTAGCTGGG - Intronic
991070305 5:62471122-62471144 AAAAAAAAAGAAATGCAACTAGG - Intronic
991230067 5:64322486-64322508 AAGAAACAATAGATGCTGGTGGG + Intronic
991293297 5:65054542-65054564 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
991299225 5:65112689-65112711 AAAAAAAAAAAGATTCAGCTGGG + Intergenic
991482089 5:67091438-67091460 AAAAAAGAAAAGCTGGAGCTGGG - Intronic
991513576 5:67408213-67408235 AAAAAACCACTGATGCAGTTTGG - Intergenic
991765054 5:69967689-69967711 AAAAAATAACAGATGCTGGCAGG - Intergenic
991782271 5:70150464-70150486 AAAAAATAACAGATGCTGGCAGG + Intergenic
991844286 5:70842760-70842782 AAAAAATAACAGATGCTGGCAGG - Intergenic
991874714 5:71150779-71150801 AAAAAATAACAGATGCTGGCAGG + Intergenic
992891298 5:81206769-81206791 ACAAAACTACAAATGCAGTTTGG - Intronic
992919804 5:81503157-81503179 AAAAAACAACAGATGCAGCTGGG + Intronic
993556670 5:89348104-89348126 AAAAAATAACAGATGCTGGTGGG + Intergenic
993692003 5:91013361-91013383 AAAAAATAACAGATGCTGTCAGG - Intronic
993735287 5:91469149-91469171 AGAAAAAAATAGATGCAACTTGG + Intergenic
993855513 5:93069752-93069774 ACAAGACAACAGATGCATTTTGG + Intergenic
994216534 5:97144055-97144077 AAAAAAAAAAGGATACAGCTAGG - Intronic
994237026 5:97374729-97374751 AAAAAACAACAGCAACAGCCGGG + Intergenic
994260514 5:97653224-97653246 AAAAAATAACAGATCTAGCAAGG - Intergenic
994505493 5:100638651-100638673 AGAAAACAACAGAAGCAGGAAGG + Intergenic
994593391 5:101801084-101801106 AAACAACAACAAAAGCAACTCGG + Intergenic
994666361 5:102710116-102710138 AAAAAAAAAAAGATACAGTTAGG - Intergenic
994705608 5:103202223-103202245 AAAATATTACATATGCAGCTGGG + Exonic
994911919 5:105920928-105920950 AAAAAATAACAGATGTTGGTTGG - Intergenic
995199121 5:109407355-109407377 AAACAACAACATAAGCATCTTGG + Intronic
995315670 5:110769487-110769509 AAAAAAAATGAAATGCAGCTGGG - Intergenic
995477876 5:112566015-112566037 AGAAAACAACAGAAGCAGGAAGG + Intergenic
995864754 5:116679044-116679066 AAAAAAGAATAAATTCAGCTGGG - Intergenic
996237698 5:121152560-121152582 AAAAAACAACAGATGTTGGTGGG - Intergenic
996664443 5:126042501-126042523 AAATAAAAACAAATGCTGCTTGG + Intergenic
998259062 5:140614211-140614233 AAAAAACAACAAATGCGGCCAGG + Intergenic
998632298 5:143912600-143912622 AAAAGAAAACAAAAGCAGCTAGG + Intergenic
998870500 5:146546897-146546919 AAAAAAGAACAAAGGCAGCCAGG - Intergenic
999057263 5:148591791-148591813 AAAAAATAACAGATGCTGCAAGG + Intronic
999950323 5:156642446-156642468 AAAAAAAGACTGATGCTGCTAGG - Intronic
1000317012 5:160102116-160102138 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1000317056 5:160102409-160102431 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1000460631 5:161513070-161513092 AAAAAACAAGAGATGCTGGTGGG + Intronic
1000596519 5:163221075-163221097 AAAAAAAAACCCATGCACCTGGG + Intergenic
1000856980 5:166411069-166411091 AACAAACAACCTATGTAGCTTGG - Intergenic
1000877292 5:166656780-166656802 AAAAAATAAAAGATTCAGCCAGG - Intergenic
1000924378 5:167176003-167176025 GAAAGACCACAGATACAGCTGGG - Intergenic
1001033259 5:168278185-168278207 AAAAAACAAAAAATTTAGCTGGG - Intergenic
1002035341 5:176464476-176464498 AAAAAAAAAAAGAATCAGCTTGG - Intronic
1002177187 5:177407787-177407809 AAAAAAAAAAAGATGCAGATGGG + Intronic
1002191544 5:177480642-177480664 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1002762256 6:211032-211054 AATAAACAGCAGGAGCAGCTTGG - Intergenic
1003666420 6:8115849-8115871 GAAAAACAAGAGAAGAAGCTCGG + Intergenic
1003673992 6:8185972-8185994 AAAAAACAACAGATGCTGGCAGG - Intergenic
1003712272 6:8605331-8605353 GAAAAACAACAGCTGCTGGTTGG - Intergenic
1003895236 6:10601168-10601190 CATAAATAACAGAAGCAGCTGGG + Intronic
1004415942 6:15424122-15424144 AAAAAAAAAAAGAGGCAGCCAGG - Intronic
1004570461 6:16839886-16839908 AAATTTCAACATATGCAGCTGGG + Intergenic
1004670693 6:17793751-17793773 AAAAAATAAAAGAATCAGCTGGG + Intronic
1004805316 6:19197949-19197971 AAAAAATAACAGATGTGGCAAGG - Intergenic
1005308276 6:24534439-24534461 AAAGAATAGCAGAAGCAGCTTGG + Intronic
1005487344 6:26313614-26313636 AAAAAATTACAGTTGCAGCGAGG + Intergenic
1005544449 6:26850367-26850389 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1005702732 6:28418825-28418847 AAAAAAAAAAAGATGCAGCTAGG + Intergenic
1005949755 6:30623071-30623093 AGAAAACAACAAATACAGCCAGG + Intronic
1006475911 6:34253691-34253713 AAAAAAAGACACTTGCAGCTGGG + Intergenic
1006537720 6:34713469-34713491 AACAAACAAAAAATGTAGCTAGG - Intergenic
1006901413 6:37504595-37504617 AAAAAAAAAAAGATGCTGCAGGG - Intergenic
1007093850 6:39201227-39201249 AAAAAAGAATTGATGCAGCTGGG - Intronic
1007194038 6:40044485-40044507 AAGAAACCACAGATGCTGGTTGG + Intergenic
1007308902 6:40929453-40929475 AAAAAAAAAGAGATGGAGTTTGG - Intergenic
1007708825 6:43808110-43808132 AAAAAATAGAAGAAGCAGCTAGG - Intergenic
1008607002 6:53150283-53150305 AAAAAAAAAAAGATGAAGCAGGG - Intergenic
1009015237 6:57891995-57892017 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1009318765 6:62258168-62258190 AAGAAACATGAGATGCAGTTGGG + Intronic
1010011941 6:71057919-71057941 ATAAAACAGCAGATGCAGGGAGG - Intergenic
1010084681 6:71903176-71903198 AAGAAACAACAGATGCTGGTGGG - Intronic
1010273791 6:73945848-73945870 AAAAAATAACAAATGCTGGTGGG - Intergenic
1010722550 6:79300274-79300296 GAGAAACAACAGATGCAGGAAGG - Intergenic
1010757166 6:79679261-79679283 AAAAAACAACAGAAGCTGGCAGG - Intronic
1010978106 6:82339397-82339419 AAGAAACAAAAGATGCAGGCTGG - Intergenic
1011105342 6:83773427-83773449 AGAAAACAACAGATGCTGCAAGG - Intergenic
1011145928 6:84216834-84216856 TAATAACAACTGTTGCAGCTAGG + Intronic
1011370525 6:86632653-86632675 AAAAAACCACAGATGCTGGCAGG - Intergenic
1011377199 6:86701744-86701766 GAGAAACAACAGATGCTGCAAGG - Intergenic
1011535508 6:88371833-88371855 AAAACACAGTAGATGCAGGTAGG + Intergenic
1012429566 6:99150248-99150270 ACAAAACACAAGATGCAGTTGGG - Intergenic
1012749250 6:103137106-103137128 AAAAAACATCAAATGCATATTGG + Intergenic
1013913955 6:115311671-115311693 AAAAAAAAAAAAATTCAGCTTGG - Intergenic
1013933689 6:115568033-115568055 AAACAACAACAGATGCTAGTGGG + Intergenic
1014058520 6:117044141-117044163 AAAAAAAAACTCCTGCAGCTAGG + Intergenic
1014077514 6:117253074-117253096 AAAAAAAAAAAAATTCAGCTAGG + Intergenic
1014334882 6:120120802-120120824 AAAAAATAACAGATGCTGGTGGG - Intergenic
1015320989 6:131874532-131874554 AAAAAACAACAGATGTAGTAAGG + Intronic
1015341450 6:132105689-132105711 AAAAAAAAAAAAATACAGCTGGG - Intergenic
1015544734 6:134349687-134349709 AAAAAAAAAAAGAAACAGCTTGG + Intergenic
1015741578 6:136460784-136460806 AAAAATCTTCAGATGCACCTTGG - Intronic
1015841535 6:137482182-137482204 AAAAAACAACAGAAAAAGATGGG + Intergenic
1016623060 6:146134768-146134790 AAAATACAAAAAATGTAGCTGGG + Intronic
1016789914 6:148057230-148057252 AAGAAACAGCAGATGCTGATGGG - Intergenic
1016824619 6:148376868-148376890 TAAAAACAAAAGATGAAACTCGG + Intronic
1017369093 6:153683600-153683622 AAAAAATAACAGGTGCTGGTGGG + Intergenic
1017380463 6:153822327-153822349 AAAAAATAACAGATGCTGGCAGG - Intergenic
1017489945 6:154936079-154936101 AAAAAACAACAAAATTAGCTGGG + Intronic
1017516291 6:155158764-155158786 AAAAAAAAACACTTGCAGCCTGG - Intronic
1017650953 6:156582160-156582182 AAAAAAAAAAAAAAGCAGCTGGG - Intergenic
1017762165 6:157577845-157577867 AAAAAATAACAGATGCAGGCTGG - Intronic
1018214475 6:161513696-161513718 TAAAAACAACAGCAGCAGCAAGG - Intronic
1018324164 6:162646577-162646599 TAAAAACAATAAATTCAGCTGGG - Intronic
1019580777 7:1761033-1761055 AAAAAACAAAAGCTGCACCGAGG + Intergenic
1020017876 7:4842058-4842080 AAAAAAAAAAAGATGCAACAAGG + Intronic
1020326804 7:6980577-6980599 AAACAACAACAAAAACAGCTAGG + Intergenic
1020490244 7:8773559-8773581 AACAAACAACAGATGTTGGTTGG - Intergenic
1020508595 7:9023198-9023220 AAAAAAGAACAGCTGAATCTCGG - Intergenic
1020884318 7:13803496-13803518 TAAAAAAAACACCTGCAGCTAGG - Intergenic
1021165538 7:17335691-17335713 AAAAAACAACCGATGGACTTGGG + Exonic
1021705569 7:23364385-23364407 AAAAAACAACAAAATTAGCTGGG + Intronic
1021727472 7:23563266-23563288 TAAAAACAAGTGATGCATCTTGG + Intergenic
1022303801 7:29127607-29127629 AAAAAACAGCAGAAGCAGGAAGG + Intronic
1022429199 7:30299618-30299640 AAAAAATAACAGTTACATCTGGG - Intronic
1022475798 7:30708727-30708749 AAAAAAAAAAAGAAGAAGCTGGG - Intronic
1023011593 7:35928938-35928960 AAAAAAAAAAGGATTCAGCTGGG + Intergenic
1023334098 7:39150453-39150475 AAAAAAAAAAAAATGTAGCTTGG - Intronic
1023796140 7:43793945-43793967 AAAAAAAAAAAGACTCAGCTGGG + Intronic
1024079551 7:45844951-45844973 AAAAAAAAAAGGATTCAGCTGGG - Intergenic
1024124755 7:46281937-46281959 AAAAAAAAAAAGATAGAGCTGGG + Intergenic
1024138830 7:46440482-46440504 CAAAACCAACAGATGCTACTCGG + Intergenic
1024165972 7:46730605-46730627 AAAAAACAACAGATGCTATGCGG + Intronic
1024320519 7:48062609-48062631 AAAAAACAACAGATCAACTTAGG + Intergenic
1024479985 7:49853023-49853045 TAAAAACAACAGCTGCACCAAGG + Intronic
1025098354 7:56115280-56115302 TAAAAAAAATAGATGCAGGTAGG - Intronic
1025125234 7:56339019-56339041 AAAAAAAAAAGGATTCAGCTGGG + Intergenic
1025278280 7:57604305-57604327 AAAAAAAAACAAAAGTAGCTGGG - Intergenic
1025715246 7:63950056-63950078 AAGAAACAGCAGCTTCAGCTTGG + Intergenic
1025794158 7:64722512-64722534 AAAAAAAAAAAGAAGAAGCTAGG - Intergenic
1025985225 7:66444879-66444901 TAAAAACATAAGGTGCAGCTTGG - Intergenic
1026134184 7:67644850-67644872 AAAAAACAAAAAAATCAGCTGGG + Intergenic
1026368130 7:69670578-69670600 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1026797067 7:73373044-73373066 AAAAAAAAAAAAAGGCAGCTGGG + Intergenic
1026939021 7:74276113-74276135 AAAAAAAAAAAGCAGCAGCTGGG + Intergenic
1026974039 7:74485624-74485646 AAAAAAAAATAGATGCAGCTGGG + Intronic
1027353447 7:77334596-77334618 AAAAAAAAAAAGATGAACCTGGG + Intronic
1027392573 7:77720057-77720079 AAAAAAGGACACATACAGCTGGG - Intronic
1027603384 7:80268648-80268670 AAAAAATAACAAATGCAGGAAGG + Intergenic
1028678204 7:93492886-93492908 TAAAAACAACATATGGATCTAGG + Intronic
1028715691 7:93964815-93964837 AAAAAATAACAGATGCTGGCGGG + Intronic
1029368196 7:100129915-100129937 AAAAAAAAAAAAATGTAGCTGGG - Intergenic
1029374713 7:100170727-100170749 AAAAAACAAAACAGGCAGATGGG + Intronic
1029572613 7:101380283-101380305 AAAAAAAAAAAAATGTAGCTGGG - Intronic
1030413324 7:109210149-109210171 GAGAAACAACAGATGCTGGTGGG - Intergenic
1030461958 7:109850029-109850051 AAAAAACAAAATATGAACCTTGG - Intergenic
1030794228 7:113768185-113768207 AAAAAAAAACTAATCCAGCTAGG - Intergenic
1031033008 7:116755087-116755109 GACAAAGAGCAGATGCAGCTTGG - Intronic
1031713818 7:125081816-125081838 AAAAAAAAAGTGATACAGCTTGG + Intergenic
1031813495 7:126402630-126402652 CAAAAACAAAAAATGCAGATTGG + Intergenic
1032101702 7:128984917-128984939 AAAAACCAAAAGAGGCAGTTAGG + Intronic
1032150019 7:129420638-129420660 AAAAAAGAACAGAATTAGCTGGG - Intronic
1032234834 7:130111548-130111570 AAAAAATAAAAGAAGTAGCTAGG + Intronic
1032346364 7:131120179-131120201 AAAAAAAAAAAGAAGCAGCCAGG + Intronic
1032349863 7:131151384-131151406 CAAAAACAACAGATCCAGTTTGG - Intronic
1032579559 7:133091745-133091767 AAAAAAAAACTAATGGAGCTGGG + Intergenic
1033282310 7:140014975-140014997 AAAAAACAGCAGGTGAATCTGGG + Intronic
1033305450 7:140222319-140222341 AAAAAACAACAAATTCGGCTGGG + Intergenic
1033344014 7:140513283-140513305 AAAAAAAAAAATATGTAGCTGGG + Intergenic
1033423834 7:141225689-141225711 TAAAAATGACAGATGTAGCTGGG - Intronic
1033629570 7:143143310-143143332 AAAAAATAACAAATTCAGCCAGG + Intergenic
1033782037 7:144683174-144683196 AAAAAAAAAAAGATGCAGAAAGG - Intronic
1034079207 7:148261147-148261169 GAAAAACAACAGATGCACAAAGG - Intronic
1034863095 7:154616920-154616942 AAAAAACAACAGCTGCAAGTTGG + Intronic
1035143985 7:156794681-156794703 AAAAAACAAATGATAAAGCTTGG - Intronic
1036096287 8:5727714-5727736 AAAAAAGAAAAGATCCAGCCAGG - Intergenic
1036119930 8:6004819-6004841 AAAAAAAACCAGATGCTGATGGG + Intergenic
1036164117 8:6415843-6415865 CAAAAACAAAAAAGGCAGCTGGG + Intronic
1036555369 8:9855027-9855049 AAAAAAAAAAAAATTCAGCTGGG + Intergenic
1036602571 8:10275597-10275619 AAAAAGCAAGAGATGGAACTAGG + Intronic
1036763088 8:11526066-11526088 TAAAAACAAAAGCTGCAGCTGGG - Intronic
1036792298 8:11729272-11729294 CAAAAAGAAAAAATGCAGCTGGG + Intronic
1037194677 8:16173942-16173964 AAAAAACAAAAAAGTCAGCTGGG - Intronic
1037687236 8:21151842-21151864 AAAAATTAACAGATGCTGCAAGG + Intergenic
1037800333 8:22030839-22030861 AAAAAATATCAGATAAAGCTGGG - Intronic
1038204256 8:25450009-25450031 AAAAAACCACACATACTGCTTGG + Intronic
1038573093 8:28679993-28680015 AAAAAAGAACTAATGCTGCTTGG - Intronic
1038792749 8:30683119-30683141 AAAAAAATAAAGATTCAGCTGGG - Intronic
1038944098 8:32337675-32337697 AAAAAAAAGCTGATGCAGTTAGG + Intronic
1039337705 8:36611067-36611089 AGAAAACAACAGAAGCAGGAGGG + Intergenic
1039440684 8:37593203-37593225 AAAAAAAAGCAAATGCACCTGGG + Intergenic
1040090880 8:43397337-43397359 AAAAAACAACAGATGCTGGTGGG - Intergenic
1040653893 8:49482105-49482127 AAAAAACAACAAATCCAGTTTGG - Intergenic
1040903080 8:52437439-52437461 GAAGAACAACAGAGGCAGCAGGG + Intronic
1041038193 8:53817240-53817262 AAAAAAAAAAAAATCCAGCTGGG + Intronic
1041089079 8:54285343-54285365 AAAAAAAAAAAGATCCAGCTGGG + Intergenic
1041285252 8:56253979-56254001 AAAAAAAAAAAGATGCAAGTGGG - Intergenic
1041560284 8:59209741-59209763 AAAAAACAACAGATGTTGGCAGG - Intergenic
1041740786 8:61154195-61154217 AAAAAACAAAAAAAGCATCTTGG - Intronic
1042220221 8:66466227-66466249 AAAAAAAAAAAAATTCAGCTGGG - Intronic
1042460483 8:69059921-69059943 TAAAAATAAGGGATGCAGCTGGG + Intergenic
1042646354 8:70991066-70991088 AAAAAACAACAAAAACATCTTGG - Intergenic
1042917998 8:73894131-73894153 AAAAAAGAGAAGAAGCAGCTGGG + Intergenic
1043270933 8:78332057-78332079 AAAAAAAGAAAGATTCAGCTTGG - Intergenic
1043493805 8:80778347-80778369 AAAAAATAACAGATGCTGGTTGG + Intronic
1043809954 8:84727020-84727042 ATGAAACAGCAGATGAAGCTTGG + Intronic
1043942171 8:86208252-86208274 AAAAAATAACAGATGCTGACAGG + Intergenic
1044222328 8:89683844-89683866 AAGAAACAATAGATGCTGGTGGG + Intergenic
1044415110 8:91929607-91929629 AAAAAAAAAAAAATTCAGCTGGG - Intergenic
1044508106 8:93044144-93044166 AAGAAACAACAGATGCTGATGGG - Intergenic
1045099314 8:98828460-98828482 AAAAAACAAAAGAAATAGCTGGG + Intronic
1045963094 8:107991877-107991899 AAAAAATAACAGATGCTGAGAGG + Intronic
1046009697 8:108531472-108531494 AAAACAAAACATAAGCAGCTGGG + Intergenic
1046630606 8:116619373-116619395 AAAAGTCAACAGATGCGGCCGGG + Intergenic
1046903958 8:119552964-119552986 AAAAAAAAAAAGCAGCAGCTGGG + Intergenic
1047753845 8:127903085-127903107 AAAAAATAACAGATGTTGGTGGG - Intergenic
1048012287 8:130467459-130467481 AAAAAAAAAAAGATTTAGCTTGG + Intergenic
1048033405 8:130653937-130653959 AAAAAACAACAGATGCTGGCGGG + Intergenic
1048142614 8:131809261-131809283 AAAAAACAACAAATGCATATGGG + Intergenic
1048213017 8:132472102-132472124 AAAAAATAACAGATGCTGATGGG + Intronic
1048265981 8:132987063-132987085 AAAAAAAAAAAGATGGAGCATGG + Intronic
1048296478 8:133218352-133218374 AAAAAACAATAGCCGCAGCAAGG + Intronic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1048690465 8:136956554-136956576 AATAAACAACAGATGCACACAGG + Intergenic
1049135251 8:140892237-140892259 ACAAAACCACAGATCCAGCCAGG + Intronic
1050341518 9:4644207-4644229 AAAAAAAAAAAAATGTAGCTGGG + Intronic
1050631529 9:7563672-7563694 ACAAAGCAACAGAGGCACCTAGG + Intergenic
1050849696 9:10268104-10268126 AAAAAAAAAAAGATGGAGATGGG - Intronic
1051294433 9:15580722-15580744 AAAAAATAACAGATGTTGCATGG + Intronic
1051647696 9:19286027-19286049 AAGAAAAAACAAAAGCAGCTGGG + Intronic
1051657400 9:19396251-19396273 AAAAAAAAAAAAATGCAGCTTGG - Intergenic
1051708887 9:19909762-19909784 GAAAATCAACAGATGCAGGAAGG - Intergenic
1052438867 9:28467013-28467035 AAAAAAAAAGAGAGTCAGCTAGG - Intronic
1052749448 9:32474459-32474481 AAAATACAACAGATGCAATGTGG + Intronic
1052831521 9:33220049-33220071 AAAAAACAAAATAAGCAGGTTGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053032664 9:34795083-34795105 AAAAAACAACACATTCATATAGG + Intergenic
1053174847 9:35915320-35915342 AAAAAAAAAAAGGTGCAGATGGG - Intergenic
1053270729 9:36747711-36747733 AGAAAATAACAACTGCAGCTGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055079834 9:72258150-72258172 AAAAAATAAAAAATGTAGCTGGG + Intergenic
1055262905 9:74459673-74459695 AAAAAAGAAAGGATGCAGCAGGG + Intergenic
1055421463 9:76147851-76147873 AAAAAAGAACAGATGTGGCTGGG - Intronic
1055437902 9:76310781-76310803 AAAAAATGCCAGATGCAGCCGGG + Exonic
1055548375 9:77406710-77406732 AAAAAAAAAAAGATGAGGCTGGG - Intronic
1055870964 9:80879444-80879466 AAACAACAACAAAAACAGCTGGG + Intergenic
1056225989 9:84495898-84495920 AAAAAAAGACAGACGCAGCCGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057473138 9:95375856-95375878 AAAAAACAAAAGAAGCTGCCTGG - Intergenic
1057500242 9:95591356-95591378 AAAAAAGAAAAAAGGCAGCTGGG - Intergenic
1057633196 9:96737534-96737556 GAAAAACAACACAGGAAGCTGGG - Intergenic
1057673770 9:97120448-97120470 AAAAAAAAAAAGATGGAGATTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058005514 9:99909935-99909957 AAAAAAGAAGAAATGCAGCTGGG + Intronic
1058056713 9:100456119-100456141 AAAAAGCAGCAGATGCAGCATGG - Intronic
1058124153 9:101172359-101172381 AAAAAACAAAATATGCTGCAAGG + Intronic
1058199607 9:102022871-102022893 GAAAAACAACAGATGCTGGCAGG - Intergenic
1058258570 9:102801826-102801848 AAGAAACAACAGATGCTGGAAGG + Intergenic
1058327048 9:103711357-103711379 AAAAAATAACAGATGCTGGTGGG - Intergenic
1058386090 9:104437502-104437524 AAGAAACAACAGATGCTGGGAGG - Intergenic
1058461046 9:105183074-105183096 AAAAAACAACAGATGGGGAGAGG - Intergenic
1058529890 9:105895073-105895095 AAGGAACAACAGATGCTGGTGGG - Intergenic
1058553653 9:106142420-106142442 ACAAAGAAACAGAAGCAGCTCGG + Intergenic
1058805312 9:108585493-108585515 AAAATACAACAAATGCAGTCTGG + Intergenic
1059070924 9:111135120-111135142 TAAGAACAAAAAATGCAGCTGGG - Intergenic
1059295507 9:113266573-113266595 AAAGAACCAGAGAGGCAGCTCGG - Intronic
1059831541 9:118101674-118101696 AAAAAAGGACAGATACATCTGGG + Intergenic
1059860743 9:118458383-118458405 AAAAATAAATAGATGCAGATAGG + Intergenic
1060460980 9:123854398-123854420 AAAAAATAAAAAATGAAGCTGGG + Intronic
1061023220 9:128030384-128030406 AAAAAAAAAAAGGTGCAGTTTGG + Intergenic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1203629334 Un_KI270750v1:56867-56889 AAAAAACAAAAAAAGTAGCTGGG - Intergenic
1185563652 X:1079840-1079862 AAAAAAAAAAAGACACAGCTGGG - Intergenic
1185657139 X:1694487-1694509 AAAAAACAAAAAATTTAGCTGGG + Intergenic
1185712871 X:2318197-2318219 AAAAAAAAAAAAAAGCAGCTGGG + Intronic
1185722111 X:2390431-2390453 TAAAAAAAAAAAATGCAGCTGGG - Intronic
1185895581 X:3855627-3855649 CAAAAACAACAGACGCATGTTGG - Intergenic
1185900700 X:3894051-3894073 CAAAAACAACAGACGCATGTTGG - Intergenic
1185905816 X:3932490-3932512 CAAAAACAACAGACGCATGTTGG - Intergenic
1186280887 X:7991810-7991832 AAATCACACCAAATGCAGCTTGG + Intergenic
1186471641 X:9826612-9826634 AAAATACAGAAGATGTAGCTGGG + Intronic
1186947693 X:14587437-14587459 AAAAAGCAACAGATACTGCAAGG - Intronic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187291120 X:17954180-17954202 AAAAAATAGCAGATGCTGGTAGG + Intergenic
1187325640 X:18284743-18284765 AAAAAACAACAGACGTGGCCGGG + Intronic
1187680512 X:21762555-21762577 AAAAAATAACAGATGAAGAATGG + Intergenic
1187834734 X:23420490-23420512 ACAACAGAAAAGATGCAGCTTGG + Intergenic
1188336376 X:28939026-28939048 AAAAAATAACAGATGCTGGCTGG + Intronic
1188635551 X:32426471-32426493 AAAAAATAACAGATGCTGTTGGG + Intronic
1188713037 X:33425436-33425458 AAAAAATAACAGATGCTGGTGGG - Intergenic
1188888332 X:35578490-35578512 AAAAAATAACAGATGCTGTTGGG + Intergenic
1189276348 X:39788945-39788967 AGAAAACTACAGAAGCAGGTAGG - Intergenic
1189769350 X:44408053-44408075 AAAAAAAAACAGAGAAAGCTGGG - Intergenic
1189893483 X:45629640-45629662 AAATAACAACACCTGAAGCTGGG + Intergenic
1190286466 X:48964726-48964748 AAAAAAAAAAAAATGCAGCCAGG + Intronic
1190530159 X:51367143-51367165 AAGAAACAATAGATGCTGCAAGG + Intergenic
1191701771 X:64049736-64049758 AAGAAACAACAGATGCTGGTGGG + Intergenic
1191779678 X:64852039-64852061 AAAAAAAAAGAGATTCTGCTTGG - Intergenic
1191944697 X:66519381-66519403 AAAAAATAACAGATGCTGGTGGG - Intergenic
1192134406 X:68583442-68583464 AAAAAACAAAAAACCCAGCTGGG - Intergenic
1192416894 X:70988979-70989001 AAAAAAAAAAAAAAGCAGCTAGG + Intergenic
1192724478 X:73733596-73733618 AAAAAACGACAGATGCTGACAGG - Intergenic
1192805784 X:74507249-74507271 AAAAAATCACAGATGAGGCTGGG - Intronic
1192965571 X:76173379-76173401 AAAATACAAAAAATGTAGCTGGG - Intronic
1193094837 X:77536033-77536055 AAAAAACAAAAGATGTGGCCAGG - Intronic
1193159249 X:78209432-78209454 AAGAAACAACAGATGCTGCTAGG + Intergenic
1193207585 X:78766751-78766773 AAAAAATAACAAATGCTGGTGGG - Intergenic
1193245275 X:79221100-79221122 AAAATACAACAGATACTGTTGGG - Intergenic
1193408432 X:81133197-81133219 AAAAAATAACAGATGCTGTGAGG + Intronic
1194437012 X:93879185-93879207 AAGAAACAACAGATGCTGGCGGG + Intergenic
1194713512 X:97263880-97263902 AAAAACTAACAGTTGGAGCTGGG - Intronic
1194949973 X:100114040-100114062 TAAAGACAACAGAGGCAGCAAGG + Intergenic
1195044092 X:101040301-101040323 AAAAAAAAAGAATTGCAGCTTGG + Intronic
1195310003 X:103623249-103623271 AAAAAAAAAGAAATGCAGATAGG + Intronic
1195791136 X:108587768-108587790 AAAAAATAACAGATGCTGCAAGG - Intronic
1195958721 X:110363037-110363059 AAAAAACAATAGATAAATCTTGG - Intronic
1196284005 X:113858409-113858431 AAGAAACAACAGATGCTGAAGGG - Intergenic
1196730916 X:118940810-118940832 AAAATACAAAAAATGTAGCTGGG - Intergenic
1196821404 X:119703985-119704007 AGGAAAAAACAGATGAAGCTGGG - Intergenic
1197107220 X:122731233-122731255 AAAAAATAACAGATGCTGGTAGG + Intergenic
1197259216 X:124299172-124299194 AAAAAATAACAGATGCTACTGGG + Intronic
1197260885 X:124316580-124316602 AAAATACAACAAAATCAGCTGGG + Intronic
1197407251 X:126067244-126067266 AAAAAATAACAGATGCTAGTGGG + Intergenic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1197883867 X:131197440-131197462 AAAAAAGAAAAGATTCATCTTGG + Intergenic
1197960603 X:132001492-132001514 AAAAAGCAACAGTTGTAACTTGG + Intergenic
1197960740 X:132003433-132003455 AAAAAGCAACAGCTGTAACTTGG - Intergenic
1198625189 X:138564552-138564574 AAGAAACAACAGGTGCTGCGAGG + Intergenic
1198728881 X:139706056-139706078 AAAAAACAACAGATGCTGGCTGG + Intronic
1198752624 X:139950708-139950730 AAAAAAGAACATATGTAGCTGGG + Intergenic
1198890860 X:141394790-141394812 GAAAACCACCAAATGCAGCTGGG - Intergenic
1198895897 X:141454245-141454267 AAAAAACAACAGATGCTGGTGGG + Intergenic
1198998373 X:142603213-142603235 AATAAATAACAGATGCTGCGAGG - Intergenic
1199414774 X:147568576-147568598 AAAAAATAACAGATGCTGGCCGG - Intergenic
1200655239 Y:5893223-5893245 AAAAATCAACAAATGCAGGCAGG + Intergenic
1200663114 Y:5986228-5986250 AAAAAGCACCAGATTCACCTGGG + Intergenic
1200788779 Y:7281570-7281592 AAAAAAAAAAAGAGGCAGCCGGG - Intergenic
1201592805 Y:15634153-15634175 ACAAAACAAATTATGCAGCTGGG + Intergenic
1201767710 Y:17588061-17588083 AAAAAAAAAAAAATGAAGCTGGG + Intergenic
1201833843 Y:18317924-18317946 AAAAAAAAAAAAATGAAGCTGGG - Intergenic